Rice salt tolerance related gene and application thereof

Abstract

The invention discloses a rice salt-tolerant related gene and a salt-tolerant favorable haplotype, a developed molecular marker and application in creation of a salt-tolerant rice new line. A rice receptor variety is introduced through a hybridization method and is used for breeding a new salt-tolerant rice variety. The invention further discloses a method for identifying the SPK1 gene haplotype. By means of the method, rice receptor varieties capable of being used for improvement can be determined, and auxiliary selection in filial generations can be achieved. Through the directional design improvement, the breeding of a new variety of salt-tolerant rice can be accelerated.

Description

Technical Field

[0001] The invention belongs to the field of agricultural biotechnology and relates to a rice salt tolerance related gene and application thereof. Background Art

[0002] There are about 9.9×10 7 Hectares, undeveloped saline-alkali land area is about 7.66 million hectares (110 million mu), and cultivated land affected by salinity is about 9.2 million hectares, accounting for 7.2% of the total cultivated land area in China. Soil salinization is an important obstacle to the productivity of cultivated land, which will inhibit crop growth and reduce fertilizer utilization. In severe cases, it may even lead to reduced production or even total crop failure. However, the area of ​​saline-alkali cultivated land in my country is increasing. On the one hand, this is because some newly reclaimed cultivated land is saline-alkali land, and on the other hand, it is due to secondary soil salinization.

[0003] Rice is the second largest food crop in my country, and the area of ​​rice affected by salinity is increasing. Rice is a salt-sensitive crop, and salt stress will inhibit the growth of rice roots, reduce the photosynthesis rate, shorten the growth of stems, and lead to a decrease in the number of effective panicles, a decrease in the number of panicles, a decrease in the yield, and affect the quality of rice.

[0004] In response to the increasingly serious salinity problem, breeding new salt-tolerant rice varieties is an important method to stabilize rice yields in saline-alkali farmland, and exploring salt-tolerant related gene resources is a prerequisite for breeding new salt-tolerant rice varieties using modern biological breeding technology. Studies have found that salt tolerance is a complex trait controlled by multiple genes, but the lack of salt-tolerant related gene resources with breeding value is still a bottleneck for breeding new salt-tolerant rice varieties using modern biological breeding technology. Summary of the invention

[0005] The purpose of the present invention is to disclose a rice salt-tolerance related gene and a salt-tolerance favorable haplotype, as well as a developed molecular marker and its application in the creation of a new salt-tolerance rice strain.

[0006] The invention provides a rice salt tolerance related gene, which is a protein kinase gene 1SPK1, and the amino acid sequence encoded by the gene is shown in SEQ ID NO:2.

[0007] Preferably, the nucleotide sequence is as shown in SEQ ID NO:1.

[0008] The present invention provides the application of the rice salt tolerance related gene in breeding rice salt tolerance varieties or in identifying rice salt tolerance.

[0009] Specifically, the method obtains a rice variety with reduced salt tolerance by knocking out the gene, or obtains a rice variety with enhanced salt tolerance by overexpressing the gene.

[0010] The present invention provides a method for identifying the SPK1 gene haplotype, and the rice SPK1 haplotype is determined by identifying the sequence of the rice SPK1 gene in rice;

[0011] Specifically, it includes the identification of the SPK1 gene using the following CAPS primers:

[0012] Primer sequence 1: 5'-TCAAGTCCAGCGACGTCTTC-3'

[0013] Primer sequence 2: 5′-TACAGGCTTTCACTGGGACG-3′;

[0014] The specific identification method is: using the genomic DNA of the sample to be tested as a template, after PCR amplification with the above-mentioned primers, the PCR product is digested with the restriction endonuclease BmgBI, and the DNA fragment size is detected by electrophoresis separation; two bands of 228 and 393 bp are hap1, three bands of 45, 228, and 348 bp are hap2, and four bands of 45, 228, 348, and 393 bp are hap1hap2 heterozygotes.

[0015] The present invention provides a method for breeding salt-tolerant rice varieties, which introduces a favorable salt-tolerant haplotype into a recipient variety by hybridization combined with molecular marker-assisted selection, wherein the favorable salt-tolerant haplotype is a rice SPK1 gene haplotype hap1.

[0016] Specifically, a rice variety identified to have a favorable haplotype for salt tolerance is used as a donor and introduced into a backcross parent through hybridization; preferably, backcrossing is performed four times in a row.

[0017] More specifically, after each backcross, the SPK1 gene was identified as hap1hap2 heterozygous in the F1 generation using the following CAPS primers:

[0018] Primer sequence 1: 5'-TCAAGTCCAGCGACGTCTTC-3'

[0019] Primer sequence 2: 5′-TACAGGCTTTCACTGGGACG-3′.

[0020] Among them, the specific identification method is: using the genomic DNA of the sample to be tested as a template, after PCR amplification with the above-mentioned primers, the PCR product is digested with the restriction endonuclease BmgBI, and the DNA fragment size is detected by electrophoresis separation; the two bands of 228 and 393bp are hap1, the three bands of 45, 228, and 348bp are hap2, and the four bands of 45, 228, 348, and 393bp are hap1 hap2 heterozygotes.

[0021] The salt-tolerance-related gene SPK1 and its salt-tolerance favorable haplotype disclosed in the present invention can be introduced into rice recipient varieties through hybridization methods for breeding new salt-tolerant rice varieties. The present invention also discloses a method for identifying the SPK1 gene haplotype, by which the rice recipient varieties that can be used for improvement can be determined and auxiliary selection can be made in hybrid offspring. The directional design improvement can accelerate the breeding of new salt-tolerant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Shows the identification results of SPK1 gene knockout rice plants.

[0023] Figure 2 The results of rice SPK1 gene function identification are shown. Among them, the maturity phenotype (A), plant height (B) and single plant yield (C) of wild type and spk1CRISPR mutant under normal and 0.3% salt stress treatment. Different letters under the violin plots in (B, C) indicate significant differences in the least significant difference (LSD) analysis at p = 0.05.

[0024] Figure 3 The results of rice SPK1 gene haplotype analysis are shown. Among them, (A) rice SPK1 gene haplotype. B is the plant height of rice varieties with three haplotypes of rice SPK1 gene under normal conditions, and C is the plant height under salt stress treatment; C is the single plant yield of rice varieties with three haplotypes of rice SPK1 gene under normal conditions, and D is the single plant yield under salt stress treatment. The p value is calculated by t-test analysis of different haplotypes.

[0025] Figure 4 The results of the field salt tolerance identification of rice SPK1 gene haplotype hap1 introgression lines are shown. Different letters under the violin plots indicate significant differences at p = 0.05 using the least significant difference (LSD) analysis. DETAILED DESCRIPTION

[0026] The present invention is described below through specific implementation modes in order to better understand the present invention, but it does not constitute a limitation of the present invention.

[0027] Example 1: Cloning of the Salt-Inducible Phosphokinase SPK1 Gene

[0028] 1. Salt stress treatment of rice

[0029] Seeds of salt-tolerant rice line IL1 were treated at 42°C for 3 days, soaked at room temperature for 2 days, and sown in nutrient soil. When the rice seedlings were 2 weeks old, they were treated with 150 mM NaCl. The roots and leaves of the rice seedlings were taken at 0, 1, 2, and 3 hours after treatment, washed with gauze, dried, and frozen in liquid nitrogen. At the same time, the root and leaf tissues of the control group without salt stress were taken at the corresponding time points.

[0030] 2. Transcriptome Sequencing

[0031] Total RNA was extracted from the above tissues respectively, and mRNA was enriched by Oligo dT, and then libraries were constructed and sequenced on the second-generation sequencer Illumina NovaSeq to obtain Fastq raw sequencing data.

[0032] 3. Transcriptome Data Analysis

[0033] The Fastq raw sequencing data were quality controlled to obtain high-quality data, which were aligned to the rice reference genome IRGSP1.0 using Hisat2, and the gene expression abundance was calculated using StringTie. Then, DESeq2 was used to analyze the differentially expressed genes, and the differentially expressed genes were determined based on the change fold ≥ 2 and FDR < 0.05.

[0034] Transcriptome analysis revealed that a gene encoding rice protein kinase was expressed more than three times higher in roots than in leaves and was induced by salt stress. It was named Salt induced protein kinase 1 (SPK1).

[0035] The cDNA of SPK1 was amplified from rice root cDNA using PCR primers 5'-ATGTCCCCCCCTATGCCGCTG-3' and 5'-TCAAGGAAGATGGTGATGC AG-3' and ligated into a T-vector. After sequencing, the coding sequence of the SPK1 gene of IL1 was found to be as shown in SEQ ID NO: 1.

[0036] Example 2: Creation of rice SPK1 gene knockout mutant

[0037] SEQ1 was input into CRISPR P (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR) and searched with the rice reference genome RAP-DB to obtain the TGCTGCTATCCGCTGTCCGACGG sgRNA sequence. 5'-GGCAGCTGCTATCCGCTGTCCGA-3' and 5'-TCGGACAGCGGATAGCAGCCAAA-3' were chemically synthesized. The above two chemically synthesized DNA fragments were mixed and annealed to obtain double-stranded oligo DNA, which was ligated to the Crispr-Cas vector digested with BsaI using T4 DNA ligase to obtain the SPK-CRISPR vector.

[0038] The SPK1-CRISPR vector was introduced into Agrobacterium, which then transformed rice callus tissue. After resistance screening, the plants were regenerated and transplanted into the field for fruiting.

[0039] Sequencing of the SPK1 gene in SPK1-CRISPR transgenic rice plants revealed a single base T insertion near the sgRNA sequence, which would lead to a frameshift mutation ( Figure 1 ).

[0040] Example 3: Functional identification of rice SPK1 gene

[0041] In order to study the function of rice SPK1 gene, we investigated the effect of rice SPK1 gene mutation on rice plant growth and yield under normal and salt stress treatments. The method is as follows: wild-type and SPK1 gene CRISPR edited mutant rice seeds were treated at 42°C for 3 days, sown in the seedling bed, and covered with plastic film to keep warm and moist. When the seedlings were one month old, they were transplanted into a salt pond with a salt content of 0.3%, with a plant spacing of 15 cm and a row spacing of 25 cm. A salt-free control was also set up. The height of the rice plant was measured after filling, and the rice ears were harvested from each plant after maturity, threshed, and weighed after drying ( Figure 2 ). The results showed that the plant height of the spk1 mutant was 8 cm shorter than that of the wild type under normal conditions and 5 cm shorter under 0.3% salt stress. The grain yield of the spk1 mutant was about 20% lower than that of the wild type control under both normal and salt stress treatments. This indicates that the rice SPK1 gene is involved in the regulation of rice growth and yield.

[0042] Example 4: Analysis of favorable haplotypes of SPK1 gene for salt tolerance in rice natural resources

[0043] 1. Rice Natural Resource Genome Resequencing

[0044] We collected 600 rice natural resources with broad representation and identified rice genotypes using the second-generation high-throughput sequencing method. The process is as follows: Illumina second-generation sequencing platform obtained sequencing data Fastq files, used BWA to align to the rice reference genome IRGSP1.0, and analyzed SNP / Indel according to the GATK process to obtain rice SNP / Indel variant site related data.

[0045] 2. Construction of SPK1 gene haplotypes in rice natural resources

[0046] We found 10 non-synonymous variant sites in the polymorphism analysis of SPK1 gene in 600 rice natural resources. Based on the different combinations of these variant sites in rice natural resources, they can be divided into three major haplotypes (hap1, hap2, hap3) (Table 1 and Figure 3 (A).

[0047] Table 1 SPK1 gene haplotype

[0048]

[0049] 3. Identification of salt tolerance of different SPK1 gene haplotypes in rice natural resources in the field

[0050] Field trials were conducted to identify the agronomic traits of rice varieties with different SPK1 gene haplotypes under normal and salt stress. The method is as follows: After soaking the rice seeds at room temperature for 1 day, they were sown in the seedbed and covered with plastic film to keep warm and moist. At 4 weeks of age, individual rice seedlings were transplanted with a plant spacing of 15 cm and a row spacing of 25 cm. After 15 days of transplanting, the rice seedlings were irrigated with saline containing 0.3% salt until maturity. During this period, the salt content in the rice field was continuously monitored, and the salt concentration in the rice field was maintained at 0.3-0.4% by adjusting the concentration of the irrigated saline. After maturity, the individual plants were harvested, dried, threshed, and weighed. Each variety was repeated 10 times, and the average yield was finally calculated. At the same time, fresh water irrigation was set as a normal control group.

[0051] The results are as follows Figure 3 As shown in Figure BE, under normal and 0.3% salt stress, compared with SPK1 gene haplotype hap1 and hap3 rice varieties, the plant height of haplotype hap2 rice varieties decreased by 4-15 cm (4-17%), and the yield per plant decreased by 1.2-3.0 g (4-

[0052] 10%). This indicates that the yield of rice varieties with SPK1 gene haplotypes hap1 and hap3 is significantly better than that of haplotype hap2. In rice breeding, the priority use of hap1 to replace hap2 is beneficial to improving the yield of rice under normal and salt stress conditions.

[0053] Example 5: Application of the favorable haplotype hap1 of rice SPK1 gene

[0054] According to the method of Example 4, it was found that the SPK1 gene of rice variety Shengdao 14 was hap2, and the SPK1 gene of rice variety IR29 was hap1. In order to prove whether the introduction of SPK1 gene hap1 into Shengdao 14 can improve the salt tolerance of rice, we used IR29 as the donor and Shengdao 14 as the backcross parent, and carried out 4 consecutive backcrosses. After each backcross, the F1 generation was identified as a hap1hap2 heterozygous for the SPK1 gene using the following CAPS primers.

[0055] Primer sequence 1: 5'-TCAAGTCCAGCGACGTCTTC-3'

[0056] Primer sequence 2: 5'-TACAGGCTTTCACTGGGACG-3'

[0057] The specific identification method is: using the genomic DNA of the sample to be tested as a template, after PCR amplification with the above primers, the PCR product is digested with restriction endonuclease BmgBI, and the size of the DNA fragment is detected by electrophoresis separation. The two bands of 228 and 393 bp are hap1, the three bands of 45, 228, and 348 bp are hap2, and the four bands of 45, 228, 348, and 393 bp are hap1hap2 heterozygotes.

[0058] The hap1-introduced line of Shengdao 14SPK1 gene was identified as hap1 in the above method from 200 isolated plants of the F2 generation (BC4F2) population after four backcrosses. The salt tolerance test was carried out in the field according to the method in Example 3. The results are as follows: Figure 4 Under control conditions, the yield per plant of hap1 introgressed line was 12.5% ​​higher than that of Shengdao 14, and under 0.3% salt stress treatment, the yield per plant of hap1 introgressed line was 22.1% higher than that of Shengdao 14, indicating that SPK1hap1 can increase the yield of rice under normal and salt stress conditions.

Claims

1. A rice salt tolerance-related gene, characterized in that: Protein kinase gene 1 SPK1 The amino acid sequence encoded by it is shown in SEQ ID NO:

2.

2. The rice salt tolerance-related gene according to claim 1, characterized in that The nucleotide sequence thereof is shown in SEQ ID NO:

1.

3. Use of the rice salt tolerance-related gene as claimed in claim 1 or 2 in breeding rice salt-tolerant varieties or in identifying rice salt tolerance.

4. The application as claimed in claim 3, characterized in that: The method obtains a rice variety with reduced salt tolerance by knocking out the gene, or obtains a rice variety with enhanced salt tolerance by overexpressing the gene.

5. A method for identifying SPK1 gene haplotype, characterized in that: The rice SPK1 haplotype was determined by identifying the sequence of the rice SPK1 gene in rice; Specifically, it includes the following CAPS primers identified as SPK1 Gene: Primer sequence 1: 5'-TCAAGTCCAGCGACGTCTTC-3' Primer sequence 2: 5′-TACAGGCTTTCACTGGGACG-3′; The specific identification method is: using the genomic DNA of the sample to be tested as a template, after PCR amplification with the above-mentioned primers, the PCR product is digested with the restriction endonuclease BmgBI, and the DNA fragment size is detected by electrophoresis separation; two bands of 228 and 393 bp are hap1, three bands of 45, 228, and 348 bp are hap2, and four bands of 45, 228, 348, and 393 bp are hap1 hap2 heterozygotes.

6. A method for breeding salt-tolerant rice varieties, characterized in that: The salt-tolerant favorable haplotype is introduced into the recipient variety by hybridization method combined with molecular marker-assisted selection. The salt-tolerant favorable haplotype is rice SPK1 gene haplotype hap1, whose nucleotide sequence is shown in SEQ ID NO: 3 and its encoded protein sequence is shown in SEQ ID NO:

4.

7. The method according to claim 6, characterized in that The rice varieties with favorable haplotypes for salt tolerance were identified as donors and introduced into the hybrid parents through hybridization; Preferably, 4 backcrosses are performed consecutively.

8. The method according to claim 7, characterized in that After each backcross, the F1 generation was identified using the following CAPS primers: SPK1 Gene is hap1hap2 heterozygous: Primer sequence 1: 5'-TCAAGTCCAGCGACGTCTTC-3' Primer sequence 2: 5′-TACAGGCTTTCACTGGGACG-3′.

9. The method according to claim 8, characterized in that The specific identification method is: using the genomic DNA of the sample to be tested as a template, after PCR amplification with the above-mentioned primers, the PCR product is digested with the restriction endonuclease BmgBI, and the DNA fragment size is detected by electrophoresis separation; two bands of 228 and 393 bp are hap1, three bands of 45, 228, and 348 bp are hap2, and four bands of 45, 228, 348, and 393 bp are hap1 hap2 heterozygotes.

Images