MITE transposon for regulating and controlling content of sulfo metabolite in tea tree and application of MITE transposon

Abstract

The invention discloses an MITE transposon for regulating and controlling the content of sulfo metabolite of a tea tree and application of the MITE transposon, and relates to the field of molecular biology. The nucleotide sequence of the MITE transposon is as shown in SEQ ID NO. 1. A whole genome association analysis method finds that insertion variation of an MITE transposon exists in a promoter region of a tea tree sulfotransferase gene. The insertion of the MITE transposon can cause the reduction of the expression quantity of the tea tree sulfotransferase gene, thereby influencing the content of sulfo metabolite. The method for screening the tea tree germplasm with the high sulfo metabolite content is developed based on the insertion variation, the tea tree variety with the high sulfo metabolite content can be rapidly screened, the breeding period is shortened, and the breeding efficiency is improved.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and in particular to a MITE transposon for regulating the content of sulfone metabolites in tea trees and an application thereof. Background Art

[0002] The biochemical reaction in which sulfonic acid groups (-SO3H) are introduced into metabolite molecules by different sulfotransferases is called sulfonation of metabolites. Sulfonation of small and large biomolecules is crucial for biological activity because it changes the biological and physical properties of molecules such as polysaccharides, proteins, hormones, and lipids. These studies have been widely used in the fields of biosynthesis and medicine, but there are few studies on sulfonation reactions in the plant field.

[0003] Under normal conditions, the expression of sulfotransferase genes is high, and jasmonic acid and other hormone metabolites undergo sulfonation modification, which reduces the content of hormones such as jasmonic acid and promotes growth; under adverse conditions, the expression of sulfotransferases decreases, and the content of jasmonic acid and other hormones increases, which participates in the plant's resistance to adversity. It can be judged that the sulfonation of metabolites and its regulatory mechanism are closely related to the environment, and they participate in the regulation of growth and stress resistance in tea plants.

[0004] Therefore, there is an urgent need to develop an accurate and rapid screening method for tea germplasm resources, so as to quickly and accurately screen out tea germplasm resources with high content of sulfone metabolites and improve breeding efficiency. Summary of the invention

[0005] The purpose of the present invention is to provide a MITE transposon for regulating the content of sulfone metabolites in tea plants and its application, so as to solve the problems existing in the above-mentioned prior art. The insertion of the MITE transposon will lead to a decrease in the expression of the tea plant sulfotransferase gene, thereby affecting the sulfone metabolite content. The present invention develops a method for screening tea germplasm with high sulfone metabolite content based on the insertion variation, which can quickly screen tea varieties with high sulfone metabolite content, help shorten the breeding period, and improve breeding efficiency.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a MITE transposon for regulating the content of sulfone metabolites in tea plants, and the nucleotide sequence is shown as SEQ ID NO.1.

[0008] The present invention also provides the use of the above-mentioned MITE transposon in regulating the content of sulfone metabolites in tea plants. The MITE transposon is inserted into the promoter region of the sulfotransferase gene of the tea plant, and the content of sulfone metabolites in the tea plant is reduced.

[0009] The present invention also provides the use of the above-mentioned MITE transposon in regulating the expression level of the tea tree sulfotransferase gene. The MITE transposon is inserted into the promoter region of the tea tree sulfotransferase gene, and the expression level of the tea tree sulfotransferase gene is reduced.

[0010] The present invention also provides a primer pair for screening tea germplasm with high sulfone metabolite content, comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3.

[0011] The present invention also provides the use of the primer pair in preparing a kit for screening tea germplasm with high sulfone metabolite content.

[0012] The present invention also provides a kit for screening tea germplasm with high sulfone metabolite content, comprising the above primer pair.

[0013] The present invention also provides the use of the primer pair in screening tea germplasm with high sulfone metabolite content.

[0014] The present invention also provides the use of the above-mentioned kit in screening tea germplasm with high sulfone metabolite content.

[0015] The present invention also provides a method for screening tea germplasm with high sulfone metabolite content, comprising the following steps:

[0016] Using the cDNA of the tea plant to be tested as a template, the above primer pair is used to perform PCR amplification to obtain an amplified product;

[0017] The amplified product is sequenced. When the amplified product does not contain the nucleotide sequence of the MITE transposon, the tea tree to be tested is a tea tree germplasm with a high sulfone metabolite content.

[0018] The present invention also provides a method for screening tea germplasm with high sulfotransferase gene expression, comprising the following steps:

[0019] Using the cDNA of the tea plant to be tested as a template, the above primer pair is used to perform PCR amplification to obtain an amplified product;

[0020] The amplified product is sequenced. When the amplified product does not contain the nucleotide sequence of the MITE transposon, the tea tree to be tested is a tea tree germplasm with a high sulfotransferase gene expression level.

[0021] The present invention discloses the following technical effects:

[0022] The present invention uses a genome-wide association analysis method to find that there is an insertion variation of a MITE transposon in the promoter region of the tea sulfotransferase gene. The insertion of the MITE transposon will lead to a decrease in the expression of the tea sulfotransferase gene, thereby affecting the content of sulfone metabolites.

[0023] The present invention develops a method for screening tea germplasm with high sulfone metabolite content based on the insertion mutation, which can quickly screen tea varieties with high sulfone metabolite content, help shorten the breeding period and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 is a schematic diagram of the variation in the promoter region of the sulfotransferase gene;

[0026] Figure 2 The PCR amplification reaction procedure for the promoter region of the sulfotransferase gene;

[0027] Figure 3 The figure shows the influence of the promoter region variation of the sulfotransferase gene on the metabolite content in the tea tree population; wherein, a is a statistical graph of the expression level of the sulfotransferase gene in tea tree materials with different genotypes; b is a statistical graph of the content of the sulfone metabolite cmp778 in tea tree materials with different genotypes; c is a statistical graph of the content of the sulfone metabolite cmp911 in tea tree materials with different genotypes; HapA represents the AA genotype; HapAB represents the AB genotype; and Hap B represents the BB genotype. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] The secondary mass spectrometry results of the sulfo metabolites cmp911 (sulfoeugenol) and cmp778 (unknown sulfo metabolite) appearing in the following examples are shown in Table 1. The chemical structure of sulfoeugenol is as follows:

[0034]

[0035] Table 1 Secondary mass spectrometry results of sulfone metabolites cmp911 and cmp778

[0036]

[0037] Example 1 Localization of the sulfotransferase gene CsST2A

[0038] The present invention collects 220 tea germplasm resources (Table 2), takes the genome of tea tree Fuding Dabai as the reference genome, analyzes its transcriptome mRNA, and obtains genotype files of 220 tea trees. At the same time, LC-MS is used to qualitatively and quantitatively analyze the sulfone metabolites in the flowers and leaves of the 220 tea germplasm resources, and 170 sulfone metabolites are identified in tea leaves based on the characteristic ion fragments of the sulfone metabolites. The content of the metabolites is used as phenotypic data for association analysis with the genotypic data, and a significantly associated QTL located on chromosome 9 of the FDDB tea genome is found. The MITE transposon in the promoter region of the sulfotransferase gene is identified in the QTL ( Figure 1 ), the nucleotide sequence of the MITE transposon is shown in SEQ ID NO.1, and the insertion of the MITE transposon in the promoter region of the sulfotransferase gene affects the content of sulfo metabolites.

[0039] SEQ ID NO.1:

[0040] gttctaaacctagctctacacagctggcaaggtaaaatattaaaattaaaaaataaaaaaaaataaaaacaaataaacaaaaaaacaagcataaatataatatcacatcataggtgggtcccacccattagagccctccctagagctctctttttaaagttctaaaacatttttgaaaaacttatcatttgtcagatacatagtttttttttctagcaataataaccttatcataaaaagtaaaaatttaaaactttaccaaaaatatttgtaaaaccagctcaaaaaaaaaaatatttgaatatcatttgtcatcattgaataacaataattgttaatatgataaatttatgtacaacactttattatcattttatgtgtcacaattttagtgatttaatgagtccctactcatatgtattatgaataaagtattgatagataataattcaatttgatatcacctataactgaatttttatgattgtcgataaaaaataaaaatataaaaaatattttttaaaaaaaacccatagtttttatgattataacgttttagattattagtttgaaagaattaaaataagttataaatttatttgatataccttgatatattctgttttttttttttttataaaaaaaaaaagaaaaaaagaaaagagagagagaggggttaaatttgtttggttacacgttatgtacaaatatctaacatctactcaaaacttataattaagacaaaagaaatagagttattttgtccatatgtattaagagcctttcagaaattatattttacagctt。

[0041] Table 2 220 tea germplasm resources

[0042]

[0043]

[0044]

[0045] Example 2 Correlation between promoter region variation and sulfone metabolite content

[0046] Extract leaf mRNA, and directly perform second-generation transcriptome sequencing after library construction. Align the sequencing results to the FDDB genome to obtain the genotype information of the tea tree samples and identify the variation in the promoter region of the sulfotransferase gene. Design the following primers:

[0047] Forward primer: 5'-TGTCCTATCCAACACTCTCTG-3' (SEQ ID NO. 2);

[0048] Reverse primer: 5'-GGAAGGTGGGGATGGTATGTTGCTATG-3' (SEQ ID NO. 3).

[0049] The DNA of 220 tea germplasm resources was used as template and the above primers were used for PCR amplification reaction. The amplification system was as follows: 2 μL of 10× amplification buffer, 200 μmol / L of each of the four dNTP mixtures, 2 pmol / L of each primer, 2.5 U of Taq DNA polymerase, MgCl2, and 1 μg / mL of dNTP. 2+ 1.5mmol / L, add double (or triple) distilled water to 20μL. Amplification procedure see Figure 2 .

[0050] After amplification, it was found that the population contained homozygous promoters without insertions (denoted as AA), promoters with insertions and no insertions (denoted as AB), and promoters with homozygous insertions (denoted as BB). The expression of the sulfotransferase gene and the content of sulfo metabolites showed a trend of gradual decrease, that is, AA>AB>BB ( Figure 3 ). After sequence comparison, it was found that there was a sequence difference of 807 bp between A and B ( Figure 1 ), which is a MITE transposon, and the nucleotide sequence is shown in SEQ ID NO.1.

[0051] Among them, the nucleotide sequence of the amplified fragment with MITE transposon insertion (SEQ ID NO.4) is:

[0052]

[0053] The nucleotide sequence of the amplified fragment without MITE transposon insertion (SEQ ID NO.5) is:

[0054] tgtcctatccaacactctctgaaagtttaccaaaaaataaaaaatttacaaccgtaatacaaagttctaattgttgaaaaaatatttctcatttttttaatttttca aattagttgaaaaaatgcaataaattatactaaaattgcaatcaaacacaattagtgaattttttttattaaataattgatttataagtgttataaaaaagagacaa aaattataaacaaaatattaaaattataaaattgtccaagcaaaaaaaaaaaaaaagtcaagagcaaaaagggaaaggaaaaaagaaagccacaaacactatata gtgtatagataagatgggttaggcaggctttcaaaaccattatcaagatcaagaatactgaatttgtggattacctaccatagcaacataccatccccaccttcc.

[0055] The genotypes, expression levels of sulfotransferase genes, and the contents of sulfo metabolites cmp911 and cmp778 of 220 tea tree materials were detected, and it was found that the insertion mutation in the promoter region reduced the expression level of the sulfotransferase gene. The contents of sulfo metabolites cmp911 and cmp778 in tea tree materials with genotype AA were significantly higher than those in materials with genotypes AB and BB ( Figure 3 ).

[0056] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A MITE transposon for regulating the content of sulfone metabolites in tea plants, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

1.

2. A use of the MITE transposon according to claim 1 in regulating the content of sulfone metabolites in tea plants, characterized in that: The MITE transposon is inserted into the promoter region of the sulfotransferase gene of the tea plant, and the sulfo metabolite content of the tea plant is reduced.

3. A use of the MITE transposon according to claim 1 in regulating the expression of tea plant sulfotransferase gene, characterized in that: The MITE transposon is inserted into the promoter region of the tea tree sulfotransferase gene, and the expression level of the tea tree sulfotransferase gene is reduced.

4. A primer pair for screening tea germplasm with high sulfone metabolite content, characterized in that: It comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

3.

5. Use of the primer pair according to claim 4 in preparing a kit for screening tea germplasm with high sulfone metabolite content.

6. A kit for screening tea germplasm with high sulfone metabolite content, characterized in that: Comprising the primer pair described in claim 4.

7. Use of the primer pair as claimed in claim 4 in screening tea germplasm with high sulfone metabolite content.

8. Use of the kit as claimed in claim 6 in screening tea germplasm with high sulfone metabolite content.

9. A method for screening tea germplasm with high sulfone metabolite content, characterized in that: The following steps are involved: Using the cDNA of the tea plant to be tested as a template, PCR amplification is performed using the primer pair described in claim 4 to obtain an amplified product; The amplified product is sequenced. When the amplified product does not contain the nucleotide sequence of the MITE transposon according to claim 1, the tea tree to be tested is a tea tree germplasm with a high sulfone metabolite content.

10. A method for screening tea germplasm with high sulfotransferase gene expression, characterized in that: The following steps are involved: Using the cDNA of the tea plant to be tested as a template, PCR amplification is performed using the primer pair described in claim 4 to obtain an amplified product; The amplified product is sequenced. When the amplified product does not contain the nucleotide sequence of the MITE transposon according to claim 1, the tea tree to be tested is a tea tree germplasm with a high expression level of the sulfotransferase gene.

Images