Method for improving wheat haploid inductivity

Abstract

The invention discloses a method for improving wheat haploid inductivity, which is used for obtaining a wheat plant with haploid induction by reducing or silencing expression of wheat TaPLA and TaCENH3alpha genes in wheat. The TaPLA gene and the TaCENH3 alpha gene in the genome level can be silenced through a gene transformation process, and the TaPLA gene and the TaCENH3 alpha gene silencing method is a powerful tool for silencing the TaPLA gene and the TaCENH3 alpha gene by utilizing a gene engineering technology. The haploid inductivity of wheat can be improved by silencing the two genes at the same time.

Description

Technical Field

[0001] The invention relates to a method for improving the haploid induction rate of wheat by simultaneously knocking out TaPLA and TaCENH3α genes through a wheat multi-gene editing system, and belongs to the field of genetic engineering. Background Art

[0002] In archaea and bacterial prokaryotes, the CRISPR / Cas9 (Clustered regularly interspaced short palindromic repeats) / (CRISPR-associated 9) system is an adaptive immune defense mechanism used to combat exogenous DNA such as invading viruses. The CRISPR / Cas9 system consists of two components: sgRNA (small guide RNA) and Cas9 nuclease. sgRNA identifies the corresponding target site sequence in the genome through complementary base pairing, thereby guiding the Cas9 nuclease to cut the target site sequence, causing a break in the DNA double strand. The organism repairs the DNA through homologous or non-homologous recombination, and site-directed mutations of the DNA sequence are introduced during the repair process. Therefore, this technology has been widely used in gene therapy for diseases and genetic improvement of crops. Wheat is an allohexaploid crop, consisting of three sets of genomes, A, B and D. The partially homologous genes of these three sets of genomes have a high degree of partial homology. Only when these partially homologous genes mutate at the same time can gene knockout mutants be obtained. By using the wheat gene editing system and designing sgRNA based on the conserved regions between homologous genes, it is possible to knock out all homologous genes simultaneously.

[0003] Wheat is an allohexaploid crop with a large genome and slow homozygosity of hybrid offspring. It often takes 8-10 years to breed a wheat variety using conventional breeding techniques. Haploid breeding technology can achieve rapid homozygosity of hybrid offspring and shorten the wheat breeding period to 2-3 years. Corn pollen induction and anther culture are currently the main means of haploid breeding of wheat, but the above two technologies have problems such as low efficiency, heavy genotype dependence and high cost, making it difficult to achieve commercial breeding, which seriously limits the application of haploid breeding technology. In 2019, Chen Shaojiang's team from China Agricultural University and Ye Xingguo's team from the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, respectively obtained the wheat phospholipase gene TaPLA1 / TaMTL gene through homologous cloning methods, and successfully mutated the gene using gene editing methods. The haploid induction rate of their strains was about 20%. In 2020, Lv Jian and Timothy Kelliher's team obtained a commercially operable paternal haploid induction line by screening the allele combination of the genome-edited centromere histone gene TaCENH3α, with a haploid induction rate of 7%. These studies have important guiding significance for the future development of wheat haploid breeding technology. Summary of the invention

[0004] The present invention overcomes the shortcomings of the above-mentioned prior art and uses a wheat multi-gene editing system to provide a method for simultaneously editing the two genes TaPLA and TaCENH3α to improve the haploid induction rate of wheat. The present invention is to transfer the constructed expression vector pBUE411-PLA-CENH3α with the two genes TaPLA and TaCENH3α knocked out into wheat, silence the expression of the TaPLA and TaCENH3α genes in wheat, and obtain wheat plants with a high haploid induction rate.

[0005] The invention provides a method for improving the haploid induction rate of wheat, and reducing or silencing the expression of wheat TaPLA and TaCENH3α genes in wheat.

[0006] Furthermore, the wheat TaPLA gene is located on 4A, 4B and 4D of chromosome 4 in wheat, named TaPLA-4A, TaPLA-4B and TaPLA-4D respectively, and the nucleotide sequences of TaPLA-4A, TaPLA-4B and TaPLA-4D are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 respectively; the wheat TaCENH3α gene is located on 1A, 1B and 1D of chromosome 1 in wheat, named TaCENH3α-1A, TaCENH3α-1B and TaCENH3α-1D respectively, and the nucleotide sequences of TaCENH3α-1A, TaCENH3α-1B and TaCENH3α-1D are shown in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 respectively.

[0007] Furthermore, the above method comprises the following steps:

[0008] 1) Design and synthesize sgRNA targeting TaPLA and TaCENH3α genes;

[0009] 2) The three sgRNAs obtained in step 1) were connected to the pBUE411 vector to construct a pBUE411-PLA-CENH3α binary vector with the function of knocking out wheat TaPLA and TaCENH3α genes;

[0010] 3) The binary vector obtained in step 2) is transformed into plants by Agrobacterium-mediated transformation, and the expression of wheat TaPLA and TaCENH3α genes is reduced or silenced, so as to obtain haploid-induced wheat plants.

[0011] Furthermore, the nucleotide sequences of the three sgRNAs of the TaPLA and TaCENH3α genes in step 1) are shown in SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9.

[0012] Furthermore, the pBUE411-PLA-CENH3α binary vector having the function of knocking out wheat TaPLA and TaCENH3α genes in step 3) comprises an expression cassette A and an expression cassette B;

[0013] The expression cassette A specifically includes the following elements from upstream to downstream: TaU3 promoter A from wheat, four sgRNAs of TaPLA and TaCENH3α genes, and terminator A;

[0014] The expression cassette B specifically includes the following elements from upstream to downstream: promoter B, corn Cas9 coding sequence, and terminator B.

[0015] Furthermore, the corn Cas9 coding sequence is shown in SEQ ID NO: 10; the sequence of the TaU3 promoter A is shown in SEQ ID NO: 11; the promoter B sequence is shown in SEQ ID NO: 12; the terminator A sequence is shown in SEQ ID NO: 13; and the terminator B sequence is shown in SEQ ID NO: 14.

[0016] Furthermore, the expression cassette A is located upstream of the expression cassette B, and the expression cassette A and the expression cassette B are connected in series.

[0017] Furthermore, the pBUE411-PLA-CENH3α binary vector also contains a resistance marker gene, such as a bar gene; the nucleotide sequence of the pBUE411-PLA-CENH3α binary vector is as follows:

[0018] >Vector

[0019]

[0020] Furthermore, the nucleotide sequence of the mutation detection primer pBUE411-F of the target site of the sgRNA used in step 2) is TTGTAAAACGACGGCCAGTG, and the nucleotide sequence of pBUE411-R is:

[0021] TGCACTGCAGGCATGCAA, the nucleotide sequence of PLA-Primer-F is:

[0022] ggagtgagtacggtgtgcTTCCTCGAGGCCAAGCTGCAG, the nucleotide sequence of PLA-Primer-R is: gagttggatgctggatggTTGCCGGGCGCGGTGATCAT, and the nucleotide sequence of CENH3α-Primer-F1 is:

[0023] ggagtgagtacggtgtgcACGCGCCGCAGTAAAACAAAC, the nucleotide sequence of CENH3α-Primer-R1 is: gagttggatgctggatggACCTGTCTCCTGCCGCCG.

[0024] Beneficial Effects

[0025] In practical applications, a wheat multi-gene editing vector is first constructed, and then an Agrobacterium-mediated wheat genetic transformation process is used to achieve silencing of TaPLA and TaCENH3α genes at the genome level. This is a powerful tool for silencing TaPLA and TaCENH3α genes using genetic engineering technology. Using wheat multi-gene editing technology to simultaneously silence these two genes can increase the haploid induction rate of wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Deduced amino acid sequence of the wild-type wheat TaPLA gene.

[0027] Figure 2 Deduced amino acid sequence of the wild-type wheat TaCENH3α gene.

[0028] Figure 3 Deduced amino acid sequence of mutant wheat TaPLA gene.

[0029] Figure 4 Deduced amino acid sequence of mutant wheat TaCENH3α gene.

[0030] Figure 5 Mutation types at sgRNA target sites in placenh3α mutants.

[0031] Figure 6 Wild-type wheat and haploid plants and ears.

[0032] Figure 7 Ploidy analysis of wild-type wheat and haploids. DETAILED DESCRIPTION

[0033] The following will further illustrate the technical solution designed in the present invention in conjunction with specific experimental examples. The present invention relates to the relevant embodiments, and the relevant changes and modifications made by those skilled in the art on this basis, if there is no creative work, will be regarded as the protection scope of the present invention.

[0034] The following examples are convenient for better understanding of the present invention, but they are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged. The high-fidelity enzyme required for PCR amplification, the T4 ligase required for DNA fragment ligation, the gel recovery kit required for enzyme fragment recovery, and the plasmid extraction kit were all purchased from Dalian Bao Biotechnology Company. The plasmid extraction kit was purchased from Tiangen Biology, the inorganic salts required for culture medium preparation were purchased from Sinopharm Group, and vitamins, antibiotics, and hormones were purchased from Sigma. The plant CRISPR / Cas9 gene editing vector is pBUE411, which contains the wheat U3 promoter TaU3 to initiate sgRNA. Cas9p simulates the characteristics of the 5'-end GC content of the grass plant gene, and is a designed and synthesized plant optimized codon gene. The Escherichia coli strain used in this laboratory is E.coli DH5α.

[0035] T4 ligase, DNA Marker DL2000 and other reagents were purchased from Takara; FastPfu, 2*Taq Mix, DH5α and other reagents were purchased from Beijing Quanshijin Company;

[0036] The restriction endonuclease BsaI-HF was purchased from NEB; the primers used were synthesized by Qingdao Qingke Zixi Biotechnology Co., Ltd., and the sequences are as follows:

[0037] Table 1 Primers used in this study

[0038]

[0039]

[0040] The wheat variety JW1 is a new germplasm with good tissue culture ability bred by the Crop Research Institute of Shandong Academy of Agricultural Sciences. It is available to the public from the Crop Research Institute of Shandong Academy of Agricultural Sciences.

[0041] Plasmid pBUE411 (17430 bp) was provided by Sun Qixin's research group at China Agricultural University; it is available to the public from China Agricultural University.

[0042] Experimental Example 1 Construction of expression vector

[0043] 1. Design of sgRNA targeting TaPLA and TaCENH3α

[0044] A suitable targeting site was found in the coding region of TaPLA and TaCENH3α genes through the website CRISPRdirect (http: / / crispr.dbcls.jp / ), and a 20 bp sequence fragment before the PAM structure was set as the target sequence. The sgRNA sequence of TaPLA was selected as CCT GGCCGACTACTTCGACTGCA and CCG ACTACTTCGACTGCATCGCC. The sgRNA sequence of TaCENH3α was selected as: CCC GGCCGTCAGGAAGACCAAGG.

[0045] 2. Linearization of pBUE411 vector

[0046] The pBUE411 vector was digested with BsaI endonuclease, and the pBUE411 vector was connected to the sgRNA. The connection reaction system was: 5×ligation Buffer 2μL, annealed oligo duplex 4μL, pBUE411 / BsaI 2ul (100ng), T4 ligase 1μL, ddH2O supplemented to 10μL, and the connection reaction was carried out at 25℃ for 30min.

[0047] 3. Conversion Verification

[0048] The ligation product was transformed into E. coli, and the recombinant plasmid was transformed into DH5α competent cells. After that, the cells were cultured on LB (kan) plates until clones grew out. Single clones were selected for bacterial liquid PCR identification and sequencing. The primers used were pBUE411-F and pBUE411-R (Table 1). TaU3 promoter sequence and sgRNA sequence were detected upstream of the target sequence, indicating that the sgRNA expression cassette was successfully constructed and successfully assembled into the pBUE411 binary expression vector, proving that the CRISPR / Cas9 gene editing vector of TaPLA-TaCENHα was successfully constructed.

[0049] Experimental Example 2 Transformation of Gene Editing Vector into Common Wheat

[0050] 1. Culture medium preparation: see Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol. 1223 DOI 10.007 / 978-1-4939-1695-5_15, Spring Science + Business Media New York 2015

[0051] 2. Agrobacterium transformation: Take wheat ears that have been pollinated for about 15 days, and remove the embryos from the grains. Shake the Agrobacterium suspension the day before the experiment, and culture it at 160r and 28 degrees for 24 hours. After the ears are ready, start preparing the Agrobacterium suspension. Take 1ml of the bacterial solution in a 1.5ml centrifuge tube, add 1.4ul of acetosyringone (0.1M) and mix well. Add the prepared bacterial solution and infect for 5 minutes, then place it on the co-cultivation medium and culture it in the dark at 23 degrees for 3 days. After co-cultivation, place it on the resting medium and culture it in the dark at 25 degrees for 5 days. Transfer the callus to the screening medium 1. Seal the culture dish with a sealing film and culture it in the dark in a 25.5-degree incubator for 2 weeks. Cut the callus and transfer it to the screening medium 2.

[0052] Seal the culture dish with a sealing film and culture it in a dark incubator at 25.5 degrees for 2 weeks. After 2 weeks of callus cutting and screening, calli showing resistance are transferred to the regeneration medium. Resistant calli generally have green buds or green spots, or beautiful beige spherical structures.

[0053] Mushy and brown callus should not be transferred. Callus with proliferation can be cut into smaller callus. Small pieces from the same callus should be placed on the same line again. Pay attention to the direction of the callus, for example, green buds and green spots facing up.

[0054] Seal the culture dish and place it in a 25-degree incubator for 2 weeks under light (16 hours). After 2 weeks of regeneration, transfer the healthy seedlings to a new resistance regeneration box. When the seedlings grow to a certain size, samples can be taken for testing.

[0055] 3. Mutant Detection in Transgenic Seedlings

[0056] Specific amplification of target sites and identification of mutants in T0 transgenic plants

[0057] Whether the target gene editing is successful requires sequencing to identify. This experiment uses the Hi-TOM gene editing site detection kit produced by Xi'an Qingxue Biotechnology Co., Ltd. The kit automatically completes the high-throughput library construction process through the PCR method, and uses the Hi-TOM online software to directly analyze the variation information of multiple samples and multiple sites. TaPLA and TaCENH3α are amplified using specific primers on both sides of the target sequence (Primer-F and Primer-R in Table 1). After the amplification product is built, it is sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing. The wild-type nucleotide sequences of the target genes TaPLA and TaCENH3α are shown in SEQ ID NO.1-6, and the deduced amino acid sequences are shown in Figure 1-2 As shown, the nucleotide sequence of the target gene can also be obtained after sequencing the mutant, and its deduced amino acid sequence is as follows Figure 3-4 The mutation types of sgRNA target sites are shown in Figure 5 The figure shows the insertion or deletion of bases. After comparison, the placenh3α-07 mutant inserted a base A at the +210 position of the CDS sequence of TaPLA-4A, causing the amino acid sequence translated from the 1061 nucleic acid sequences after the 209th position in the CDS region to be different from the amino acid sequence of the wild type; the +210 position of the CDS sequence of TaPLA-4B inserted a base T, causing the 1818 nucleic acid sequences after the 663rd position in the CDS region to be unable to be translated into an amino acid sequence; the +210 position of the CDS sequence of TaPLA-4D deleted a base C, causing the 699 nucleic acid sequences after the 262th position in the CDS region to be unable to be translated into an amino acid sequence; the + One base C was deleted at position +24, resulting in the inability to translate the 204 nucleic acid sequences after position 286 in the CDS region into amino acid sequences; one base C was deleted at position +24 of the CDS sequence of TaCENHα-1B, resulting in the inability to translate the 204 nucleic acid sequences after position 295 in the CDS region into amino acid sequences; the first case of the CDS sequence of TaCENHα-1D is that one base C was deleted at position +24, resulting in the inability to translate the 204 nucleic acid sequences after position 286 in the CDS region into amino acid sequences; the second case of the CDS sequence of TaCENHα-1D is that three bases CGT were deleted at position +24, resulting in the deletion of only the amino acid sequence V at position 9, while the other sequences remained unchanged.

[0058] The first round of PCR reaction system: 1 μL of DNA from wheat plant leaves of the placenh3α-07 mutant was used as a template, 10 μL of 2×Taq Master Mix in the kit, 0.5 μL of Primer-F and Primer-R (Table 1) (10 μM) each, and Nuclease-free water was added to make up the volume to 20 μL. The PCR reaction conditions were: denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 20 s, for a total of 33 cycles; and finally extension at 72°C for 5 min. After the PCR was completed, 5 μL of agarose gel electrophoresis was taken to detect the PCR product to ensure the presence of the target product and good specificity.

[0059] Then, the second round of PCR reaction was performed, with 12 μL of Hi-TOM Mix in the kit, 1 μL of the first round PCR product as template, and the volume was supplemented to 20 μL with Nuclease-free Water. PCR reaction program: 94℃ denaturation for 2 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 25 s, a total of 33 cycles; and finally 72℃ extension for 5 min.

[0060] 4. Haploid induction of placenh3α mutant

[0061] 4.1 Haploid induction rate of placenh3α mutant

[0062] The pollen of the placenh3α mutant of the three strains was hybridized with the stigma of the hexaploid wheat material, and the resulting hybrid seeds were planted to observe the occurrence of haploids. The induction rates are shown in Table 2. There were 45 hybrid offspring of placenh3α-8, of which 10 were haploids, and the induction rate was 22.22%; there were 185 hybrid offspring of placenh3α-14, of which 60 were haploids, and the induction rate was 32.43%; there were 120 hybrid offspring of placenh3α-7, of which 40 were haploids, and the induction rate was 33%; the highest haploid induction rate of these strains was 33%.

[0063] Table 2. Haploid induction rate of placenh3α-07 mutant

[0064]

[0065] 4.2 Phenotypes of haploids induced by placenh3α-induced lines

[0066] The haploid plants induced by the placenh3α induction line were shorter, had thinner stems, and shorter and thinner leaves than the control plants. Figure 6 A), the ears are short, thin and sterile ( Figure 6 B).

[0067] 4.3 Ploidy analysis of wild type and haploid

[0068] Take about 50 mg of young wheat leaves and put them into a culture dish with 1 ml of lysis solution, chop them with a safety blade, filter them, collect the filtrate, centrifuge and pour out the supernatant, add 200 ul of propidium iodide (PI) staining solution to the sediment, and detect it with a flow cytometer. The test results are as follows Figure 7 As shown, the main peak of the wheat control material is located near lane 100 ( Figure 7 A), the main peak of the haploid material is located near lane 50 ( Figure 7 B).

Claims

1. A method for improving the haploid induction rate of wheat, characterized in that: Reducing or silencing the expression of wheat TaPLA and TaCENH3α genes in wheat.

2. A method for improving the haploid induction rate of wheat as claimed in claim 1, characterized in that: The wheat TaPLA gene is located on 4A, 4B and 4D of the fourth chromosome in wheat, and is named TaPLA-4A, TaPLA-4B and TaPLA-4D respectively. The nucleotide sequences of TaPLA-4A, TaPLA-4B and TaPLA-4D are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 respectively; the wheat TaCENH3α gene is located on 1A, 1B and 1D of the first chromosome in wheat, and is named TaCENH3α-1A, TaCENH3α-1B and TaCENH3α-1D respectively. The nucleotide sequences of TaCENH3α-1A, TaCENH3α-1B and TaCENH3α-1D are shown in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6 respectively.

3. A method for improving the haploid induction rate of wheat as described in claims 1-2, characterized in that: The steps include: 1) Design and synthesize sgRNA targeting TaPLA and TaCENH3α genes; 2) The three sgRNAs obtained in step 1) were connected to the pBUE411 vector to construct a pBUE411-PLA-CENH3α binary vector with the function of knocking out wheat TaPLA and TaCENH3α genes; 3) The binary vector obtained in step 2) is transformed into plants by Agrobacterium-mediated transformation, and the expression of wheat TaPLA and TaCENH3α genes is reduced or silenced, so as to obtain haploid-induced wheat plants.

4. A method for improving the haploid induction rate of wheat as claimed in claim 3, characterized in that: The nucleotide sequences of the three sgRNAs of the TaPLA and TaCENH3α genes in step 1) are shown in SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO:

9.

5. A method for improving the haploid induction rate of wheat as claimed in claim 3, characterized in that: The pBUE411-PLA-CENH3α binary vector having the function of knocking out wheat TaPLA and TaCENH3α genes in step 3) comprises expression cassette A and expression cassette B; The expression cassette A specifically includes the following elements from upstream to downstream: TaU3 promoter A from wheat, four sgRNAs of TaPLA and TaCENH3α genes, and terminator A; The expression cassette B specifically includes the following elements from upstream to downstream: promoter B, corn Cas9 coding sequence, and terminator B.

6. A method for improving the haploid induction rate of wheat as claimed in claim 5, characterized in that: The corn Cas9 coding sequence is shown in SEQ ID NO: 10; the sequence of the TaU3 promoter A is shown in SEQ ID NO: 11; the promoter B sequence is shown in SEQ ID NO: 12; the terminator A sequence is shown in SEQ ID NO: 13; and the terminator B sequence is shown in SEQ ID NO:

14.

7. A method for improving the haploid induction rate of wheat as claimed in claim 5, characterized in that: The expression cassette A is located upstream of the expression cassette B, and the expression cassette A and the expression cassette B are connected in series.

8. A method for improving the haploid induction rate of wheat as claimed in claim 3, characterized in that: The pBUE411-PLA-CENH3α binary vector also contains a resistance marker gene.

9. A method for improving the haploid induction rate of wheat as claimed in claim 3, characterized in that: The nucleotide sequence of the mutation detection primer pBUE411-F of the target site of the sgRNA used in step 2) is TTGTAAAACGACGGCCAGTG, and the nucleotide sequence of pBUE411-R is: TGCACTGCAGGCATGCAA, the nucleotide sequence of PLA-Primer-F is: ggagtgagtacggtgtgcTTCCTCGAGGCCAAGCTGCAG, the nucleotide sequence of PLA-Primer-R is: gagttggatgctggatggTTGCCGGGCGCGGTGATCAT, the nucleotide sequence of CENH3α-Primer-F1 is: ggagtgagtacggtgtgcACGCGCCGCAGTAAAACAAAC, the nucleotide sequence of CENH3α-Primer-R1 is: gagttggatgctggatggACCTGTCTCCTGCCGCCG.

Images