Gene TdNRX1.1 related to high oxidative stress resistance of taxodium Zhongshanha and application of gene TdNRX1.1

Abstract

The invention discloses application of a TdNRX1.1 gene of taxodium Zhongshanha in cultivation of plant varieties with high oxidative stress tolerance, and belongs to the technical field of genetic engineering. The coding of the TdNRX1.1 gene is an amino acid sequence as shown in SEQ ID NO. 2. According to the invention, the tolerance of the plant to high oxidative stress can be improved by improving the expression of TdNRX1.1. The gene can be used for plant genetic engineering breeding, and a new way is provided for cultivating new germplasm capable of resisting high oxidative stress.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and specifically relates to a TdNRX1.1 gene sequence of Zhongshan fir and its application in regulating plant resistance to abiotic stress and cultivating abiotic stress-resistant varieties. Background Art

[0002] In the natural environment, plants often face various abiotic stresses, such as drought, salinization, low temperature, high temperature, strong light, ultraviolet radiation, pollution, etc. These adverse conditions pose a serious threat to plant growth and development, and may lead to a decrease in crop yield and quality. In order to adapt to and resist these environmental stresses, plants have evolved a complex set of physiological mechanisms, among which the antioxidant system plays a vital role.

[0003] Against the backdrop of global climate change, extreme weather events have become more frequent, posing new challenges to agricultural production. Although traditional breeding methods can improve the stress resistance of crops to a certain extent, their progress is relatively slow and it is difficult to meet the needs of a rapidly changing environment. In addition, the use of chemical protective agents not only increases costs, but may also cause environmental pollution and food safety problems. Therefore, the development of new technologies and methods that can enhance the antioxidant capacity of plants has become one of the focuses of modern agricultural research. Through genetic engineering technology, the stress resistance of crops can be improved more accurately, improving their ability to survive in harsh environments and yield stability.

[0004] However, the genetic regulatory network of plant response to abiotic stress is intricate, and the molecular regulatory mechanisms of plants with different genetic backgrounds vary greatly. Although some genes that respond to abiotic stress in plants have been reported, discovering and cloning more new genes that regulate plant resistance to abiotic stress, discovering new regulatory mechanisms, and developing new methods for cultivating plant varieties that resist abiotic stress are still technical issues that need to be solved urgently. Summary of the invention

[0005] To solve the above technical problems, the present invention provides a Taxodium 'Zhongshanshan' TdNRX1.1 gene sequence and its application in regulating plant resistance to abiotic stress and cultivating abiotic stress-resistant varieties.

[0006] The present invention clones the TdNRX1.1 gene of Zhongshan fir, constructs and compares the phenotype and survival rate of TdNRX1.1 overexpression strains under high oxidative stress. The TdNRX1.1 overexpression material and the control are treated with high concentration of methyl viologen, and it is found that the TdNRX1.1 transgenic Arabidopsis thaliana shows a higher survival rate and a stronger growth phenotype than the control; at the same time, under adverse conditions, compared with the control material, the fresh weight and root length of the transgenic Arabidopsis thaliana are also significantly improved. The above results show that the TdNRX1.1 transgenic plant has a stronger tolerance in the process of coping with high oxidative stress. Since the TdNRX1.1 gene comes from Zhongshan fir, those skilled in the art have reason to believe that increasing the expression of the TdNRX1.1 gene in Zhongshan fir plants can improve the tolerance of Zhongshan fir to high oxidative stress, and reducing the expression of the TdNRX1.1 gene can reduce the tolerance of Zhongshan fir to high oxidative stress, making it more sensitive to high oxidative stress. In addition, since many abiotic stresses can produce oxidative stress, those skilled in the art have reason to believe that plants overexpressing TdNRX1.1 may show higher tolerance under various abiotic stress conditions. The nucleotide sequence of the TdNRX1.1 gene is shown in SEQ ID NO.1, or is completely complementary to the sequence shown in SEQ ID NO.1, or is a nucleotide sequence encoding an amino acid sequence shown in SEQ ID NO.2. This gene is expected to be applied to genetic engineering breeding of plants, providing a theoretical basis for the creation or improvement of new germplasm that can resist high oxidative stress in plants. Taking into account the degeneracy of codons, modifying the bases of the above nucleotide sequence without changing the amino acid sequence also falls within the scope of protection of the present invention.

[0007] In one aspect, the present invention provides a protein for regulating the ability of a plant to cope with high oxidative stress, characterized in that the protein sequence is shown in SEQ ID NO.2.

[0008] Furthermore, the present invention provides a gene for regulating the ability of plants to cope with high oxidative stress, characterized in that the gene sequence encodes a nucleotide sequence of the amino acid sequence shown in SEQ ID NO.2.

[0009] In another aspect, the present invention provides a use of the aforementioned protein or the aforementioned gene in regulating the ability of a plant to cope with high oxidative stress.

[0010] Furthermore, the regulating the ability of the plant to cope with high oxidative stress is to increase the ability of the plant to resist high oxidative stress by overexpressing the aforementioned protein or the aforementioned gene, or to reduce the ability of the plant to resist high oxidative stress by reducing the expression of the aforementioned protein or the aforementioned gene.

[0011] In a preferred embodiment, the plant is a dicotyledon or a gymnosperm.

[0012] Furthermore, the plant is a plant of the Cruciferae family or the Taxaceae family.

[0013] Furthermore, the plant is a plant of the genus Arabidopsis or the genus Taxodium.

[0014] Furthermore, the plant is Arabidopsis thaliana or Cunninghamia lanceolata.

[0015] In another aspect, the present invention provides a use of the aforementioned protein or the aforementioned gene in breeding plant varieties with high tolerance to high oxidative stress and / or sensitivity to high oxidative stress.

[0016] Furthermore, the cultivation of plant varieties with high tolerance to high oxidative stress is to obtain plant varieties with high resistance to high oxidative stress by overexpressing the aforementioned protein or the aforementioned gene, and the cultivation of plant varieties sensitive to high oxidative stress is to obtain plant varieties sensitive to high oxidative stress by reducing the expression of the aforementioned protein or the aforementioned gene. The sensitivity to high oxidative stress means reducing the tolerance of Zhongshan fir to high oxidative stress.

[0017] In a preferred embodiment, the plant is a dicotyledon or a gymnosperm.

[0018] Furthermore, the plant is a plant of the Cruciferae family or the Taxaceae family.

[0019] Furthermore, the plant is a plant of the genus Arabidopsis or the genus Taxodium.

[0020] Furthermore, the plant is Arabidopsis thaliana or Cunninghamia lanceolata.

[0021] In a preferred embodiment, the ability of the plant to resist high oxidative stress refers to a higher survival rate of plant seeds under high oxidative stress conditions.

[0022] In another preferred embodiment, the ability of the plant to resist high oxidative stress refers to that the plant seedlings have a higher fresh weight per plant under high oxidative stress conditions.

[0023] In another preferred embodiment, the ability of the plant to resist high oxidative stress refers to the plant having a longer root length and / or a higher plant height under high oxidative stress conditions.

[0024] Compared with the prior art, the present invention has the following advantages: 1) The present invention provides a novel protein capable of regulating the ability of plants to cope with high oxidative stress.

[0025] 2) The present invention provides new genes that can regulate the ability of plants to cope with high oxidative stress.

[0026] 3) The present invention provides a gene and a protein that can function in very distantly related species. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The beneficial effects of the present invention are described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0028] Figure 1 Shown are the expression levels of TdNRX1.1 in wild-type and transgenic Arabidopsis.

[0029] Figure 2 Shown are the phenotypic analyses of TdNRX1.1-overexpressing Arabidopsis and wild-type Arabidopsis, wherein A is the phenotypic comparison of the wild-type and TdNRX1.1-overexpressing Arabidopsis in 1 / 2MS medium; B is the growth phenotype comparison of the wild-type and TdNRX1.1-overexpressing Arabidopsis in 1 / 2MS medium containing methyl viologen; C is the survival rate comparison of the wild-type and TdNRX1.1-overexpressing Arabidopsis in 1 / 2MS medium and medium containing methyl viologen; D is the average fresh weight of each plant of the wild-type and TdNRX1.1-overexpressing Arabidopsis in 1 / 2MS medium and medium containing methyl viologen; E is the average root length of the wild-type and TdNRX1.1-overexpressing Arabidopsis in 1 / 2MS medium and medium containing methyl viologen. DETAILED DESCRIPTION

[0030] The nucleotide sequence of the TdNRX1.1 gene of Taxodium vulgare in the embodiment is shown in SEQ ID NO.1: 5'-ATGGAAGGTTTAAGGTACCTGCTGTGCAGTGAGGACAGAGATTTTCTCATCACAAACAAT

[0031] The amino acid sequence of the Baldcypress TdNRX1.1 protein is shown in SEQ ID NO.2: .

[0032] Example Example 1 Construction of the overexpression vector of TdNRX1.1 gene of C. zhongshanensis Take the young leaves of the one-year-old cutting seedlings of "Zhongshanshanshan 406" and use the plant RNA extraction kit (Magen) to extract total RNA, and then amplify the target gene. The specific experiment is as follows: 1 μg of high-quality RNA (OD260 / OD280: 1.8-2.0; OD260 / OD230 ≈ 2.0) was reverse transcribed (Novozyme reverse transcription kit) to obtain the first-strand cDNA. The cDNA was used as a template to amplify the open reading frame (ORF) using La Taq® (Takara, Shanghai, China). The reaction system was: 2×PCR buffer 10 μL, 2 mM dNTPs 2 μL, F primer (5'-ATGGAAGGTTTAAGGTACCTG-3') 0.5 μL, R primer (5'-ACCTCTGTAACAATAATCTCCATC-3') 0.5 μL, cDNA template 1 μL, KOD FX (1U / μl) 0.4 μL, and water was added to 20 μL. The reaction conditions were: 95°C for 5 min; 95°C for 15 sec, 56°C for 30 sec, 72°C for 30 sec, 35 cycles; 72°C for 5 min. After the reaction, the PCR product was recovered by gel recovery kit (Magen) and cloned into pMD19-T vector (Takara, Shanghai, China) for sequencing verification.

[0033] The pCAMBIA1305-GFP vector was double-digested with restriction endonucleases XbaI and BamHI (Takara, Shanghai, China) to obtain a linearized vector. The TdNRX1.1 ORF was cloned into the 1305-GFP vector using the ClonExpress II One-Step Cloning Kit (Vazyme, Nanjing, China) and the primer pairs TdNRX1.1-1305F (aagtccggagctagctctagaATGGAAGGTTTAAGGTACCTGCTG) and TdNRX1.1-1305R (gcccttgctcaccatggatccACCTCTGTAACAATAATCTCCATCACA) containing the homology arms of the 1305 vector to form a recombinant vector (TdNRX1.1::GFP). Take all the products and add them to 100 μL of E. coli DH5α competent cells. Spread the transformation products on LB solid medium (containing kanamycin resistance, the concentration of kanamycin is 50 mg / L). Cultivate overnight at 37℃, and pick 4 single clones for colony PCR identification. Select 2 positive clones for sequencing, and obtain positive clones containing TdNRX1.1 gene sequences, and finally obtain the overexpression vector containing TdNRX1.1 target gene.

[0034] Example 2 Obtaining and Identifying TdNRX1.1 Transgenic Arabidopsis The TdNRX1.1 overexpression construct was transformed into Arabidopsis thaliana using the Agrobacterium-mediated floral dip method to generate transgenic Arabidopsis thaliana OE lines. Hygromycin (15 mg / L) was used to select transgenic seedlings. All transgenic seedlings were identified by PCR, the GFP vector fragment was amplified, and 10 positive T1 transgenic seedlings were propagated to obtain the T2 generation. The T2 generation seeds were germinated using a medium containing hygromycin. If all the seeds grew normally, it was proved that the line was homozygous. Three transgenic lines (OE1, OE2, and OE3) were selected for qRT-PCR detection, and subsequent experiments and analysis were carried out.

[0035] The process of qRT-PCR identification of the overexpression effect of TdNRX1.1 gene in transgenic Arabidopsis is as follows: 1. Total RNA was extracted from 7-day-old Arabidopsis seedlings using a plant RNA extraction kit (Magen). 1 μg of high-quality RNA (OD260 / OD280: 1.8-2.0; OD260 / OD230 ≈ 2.0) was reverse transcribed (Novagen reverse transcription kit) to obtain the first-strand cDNA.

[0036] 2. Using the cDNA in step 1 as a template, the expression of the TdNRX1.1 gene was detected by the primer pair TdNRX1.1-qF (ATGGAAGGTTTAAGGTACCTG) and TdNRX1.1-qR (ACCTCTGTAACAATAATCTCCATC), and the expression of the Arabidopsis thaliana housekeeping gene UBQ10 gene was detected by the primer pair UBQ10-qF (CGGAAAGCAGTTGGAGGATGG) and UBQ10-qR (CGGAGCCTGAGAACAAGATGAAG) of the Arabidopsis thaliana housekeeping gene UBQ10 as an internal reference. The quantitative PCR reagent was SYBR® Premix Ex Taq™ (TAKARA), and the quantitative PCR instrument was CFX 96 (Bio RAD). The reaction system was: 2×PCR buffer 5 μL, qF primer 0.4 μL, qR primer 0.4 μL, cDNA template 1 μL, sterile water 3.2 μL, total reaction volume 10 μL. Reaction procedure: 95℃ 30 sec; 95℃ 5 sec, 68℃ 30 sec, 45 cycles.

[0037] The results are as follows Figure 2 As shown, the expression levels of the TdNRX1.1 gene in the three selected strains were greatly increased, and these three overexpression strains were subsequently selected for experiments.

[0038] Example 3: Phenotypic analysis of Arabidopsis thaliana overexpressing TdNRX1.1 Homozygous overexpression and wild-type Col-0 plant seeds were surface sterilized with 0.4% sodium hypochlorite, sown on 1 / 2 MS fixed medium, and placed in a plant growth room for germination and growth after 3 days of cold treatment at 4°C. 7-day-old Arabidopsis seedlings were transferred to 1 / 2 MS fixed medium containing 0.2 μM methyl viologen, and phenotypic differences were observed and recorded after 14 days.

[0039] Phenotypic results are shown in Figure 2 A / B, the results showed that the growth of both the wild type and the overexpression lines was significantly inhibited under 0.2 μM methyl viologen stress, however, the growth state of TdNRX1.1 overexpression Arabidopsis was significantly higher than that of the wild type ( Figure 2 B).

[0040] In 1 / 2 MS medium, the survival rates of the wild type and overexpression lines were close to 100%. After 14 days in 1 / 2 MS medium containing 0.2 μM methyl viologen, the survival rate of the wild type was 77.78%, and the survival rates of OE-1, OE-2, and OE-3 were significantly higher than that of the wild type, at 87.5%, 100%, and 91.67%, respectively ( Figure 2 C).

[0041] Under 0.2 μm methyl viologen stress, the fresh weight of Col-0 was 2 mg, while the fresh weight of OE-1, OE-2 and OE-3 was between 3.1 mg and 5.2 mg ( Figure 2 D).

[0042] Under stress, the average maximum root length of Col-0 was 7.8 mm, while that of OE-1, OE-2 and OE-3 was 9.9 mm, 11.5 mm and 12.9 mm respectively. That is, under 0.2 μm methyl viologen stress, the survival rate, fresh weight and root length of the overexpression lines were significantly higher than those of the wild type ( Figure 2 E).

[0043] Based on the above results, it is confirmed that the TdNRX1.1 gene can improve the ability of plants to tolerate oxidative stress, and can therefore be used to improve the adaptability of plants to abiotic stress and can be used in plant breeding for abiotic stress resistance.

[0044] According to the disclosure and teaching of the above description, those skilled in the art to which the present invention belongs may also make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the scope of protection of the claims of the present invention. In addition, although some specific terms are used in this specification, these terms are only for the convenience of description and do not constitute any limitation to the present invention.

Claims

1. A protein for regulating the ability of plants to respond to abiotic stress, characterized in that: The sequence of the protein is shown in SEQ ID NO.

2.

2. A gene that regulates a plant's ability to adapt to abiotic stress, characterized in that: The gene encodes the amino acid sequence shown in SEQ ID NO.

2.

3. Use of the protein according to claim 1 or the gene according to claim 2 in regulating the ability of plants to cope with abiotic stress.

4. The use according to claim 3, characterized in that: The regulation of plant response to abiotic stress is to improve the plant's ability to tolerate high oxidative stress by overexpressing the protein of claim 1 or the gene of claim 2, or to reduce the plant's ability to tolerate high oxidative stress by reducing the expression of the protein of claim 1 or the gene of claim 2.

5. The use according to claim 3, characterized in that: The plant is a dicotyledon or a gymnosperm.

6. Use of the protein according to claim 1 or the gene according to claim 2 in breeding plant varieties with high tolerance to abiotic stress and / or sensitivity to abiotic stress.

7. The use according to claim 6, characterized in that: The method of cultivating a plant variety with high tolerance to abiotic stress is to obtain a plant variety with high tolerance to abiotic stress by overexpressing the protein described in claim 1 or the gene described in claim 2, and the method of cultivating a plant variety sensitive to abiotic stress is to obtain a plant variety sensitive to high oxidative stress by reducing the expression of the protein described in claim 1 or the gene described in claim 2.

8. The use according to claim 6, characterized in that: The plant is a dicotyledon or a gymnosperm.

9. The use according to any one of claims 3 to 8, characterized in that: The abiotic stress is oxidative stress.

Images