Method for rapidly obtaining cress transgenic roots by using agrobacterium rhizogenes
Through the genetic transformation method of Agrobacter rhizobium mediated by Agrobacterium rhizobium, the problem of low efficiency in water cress tissue culture technology was solved, and efficient acquisition of water cress transgenic roots was achieved, laying the foundation for research on water cress gene improvement and molecular mechanisms.
Patent Information
- Application Number
- CN202510073860.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-17
- Publication Date
- 2025-04-15
AI Technical Summary
In the prior art, the water celebrate tissue culture technology is not yet mature, and there are problems of high pollution rate, long cycle and low efficiency, which leads to the inability to establish a stable water celebrate genetic transformation system, which hinders the progress of water celebrate genetic improvement and molecular mechanism research.
Agrobacter rhizobacterium mediated method was used to infect the water celery plants after the root system after the removal of the root system, and to induce the new root culture of water celery by using the marker genes, the pollution problem during the tissue culture process was avoided and efficient water celery genetic transformation was achieved.
This method simplifies the operation steps, improves the acquisition efficiency of water celery's transgenic roots, avoids transformation failure caused by material contamination, and lays the foundation for water celery's high-quality resource breeding and functional genomics research.
Smart Images
Figure CN119824031A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a method for rapidly obtaining transgenic roots of water celery by using Agrobacterium rhizogenes. Background Art
[0002] Genetic transformation technology is very important in biological breeding. A stable genetic transformation system is conducive to improving crop traits, increasing crop yield and quality. With the development of the industrialization of biological breeding, the establishment of an efficient genetic transformation system is particularly important for obtaining transformants with excellent agronomic traits using transgenic, especially gene editing technology.
[0003] Agrobacterium rhizogenes is a soil bacterium belonging to the genus Agrobacterium of the family Rhizobium. It is a Gram-negative bacterium with a very wide range of infectivity, capable of infecting almost all dicotyledonous plants and a few monocotyledonous plants. The principle of using Agrobacterium rhizogenes to obtain transgenic plants is to transform the Ri plasmid T-DNA, construct a new Ri plasmid with the target gene and marker gene, and use the modified Ri plasmid Agrobacterium rhizogenes to infect plant wounds to induce the formation of positive root systems.
[0004] Water celery (Oenanthejavanica (Blume) DC.), also known as wild celery and water celery, is a perennial aquatic herb belonging to the genus Oenanthe of the Apiaceae family. Water celery likes moist and fertile soil and is resistant to waterlogging and cold. Its stems and leaves can be eaten as vegetables, and have the effects of moistening the intestines and relieving constipation, calming the liver and lowering blood pressure, supplementing iron and acting as a diuretic. As a vegetable that can be used as both medicine and food, it is very popular among consumers.
[0005] At present, the tissue culture technology of water celery is not yet mature. The research on the tissue culture system of water celery has problems such as high contamination rate, long cycle and low efficiency, which is not conducive to the research progress of the molecular genetic mechanism of water celery and variety improvement and planting. The research on the molecular mechanism of water celery is still at the stage of heterologous transformation of the model crop Arabidopsis. At present, the establishment of almost all genetic transformation systems needs to rely on the support of tissue culture technology. Since the tissue culture technology of water celery is not yet mature, there are problems such as low efficiency and high contamination rate, so it is impossible to establish a genetic transformation system of water celery. The above situation has hindered the use of Agrobacterium to induce positive plants of water celery and realize the stable genetic transformation and planting of water celery.
[0006] In order to deeply study the molecular mechanisms of agronomic traits of water celery and conduct genetic improvement at the molecular level, establishing a stable and efficient water celery genetic transformation system has become an urgent challenge that needs to be addressed. Summary of the invention
[0007] Purpose of the invention: In view of the problems existing in the prior art, the present invention proposes a new method for quickly obtaining transgenic roots of water celery using Agrobacterium rhizogenes. The present invention clarifies the most suitable transformation conditions for water celery, clarifies the water celery transformation resources with higher transformation efficiency, and then establishes a set of high-efficiency genetic transformation technology for water celery mediated by Agrobacterium rhizogenes.
[0008] Technical solution: A method for rapidly obtaining transgenic roots of water celery using Agrobacterium rhizogenes, the method comprising: taking water celery plants after removing the root system as explants, soaking the wound at the base of the petiole of the water celery plants in a liquid infectious agent, taking it out, and then dipping it in a solid infectious agent, and then planting it in a substrate for cultivation; the preparation methods of the liquid infectious agent and the solid infectious agent are as follows:
[0009] S1. Select Agrobacterium rhizogenes carrying a marker gene and culture it in a TY liquid medium containing kanamycin sulfate and streptomycin sulfate until the bacterial liquid OD600 = 0.8-1.0;
[0010] S2, take the bacterial solution in S1, spread it on TY solid medium containing kanamycin sulfate and streptomycin sulfate, and invert and culture until the surface of the medium is covered with a uniform layer of Agrobacterium rhizogenes as a solid infection material;
[0011] S3. Take the bacterial solution in S1, centrifuge to remove the supernatant, and resuspend it in infection solution to OD600 = 0.8-1.0 as the liquid infection medium.
[0012] Furthermore, the method specifically comprises the following steps:
[0013] Step 1: Preparation of nutrient solution for hydroponic celery;
[0014] Step 2: Select a water celery plant that has grown to two leaves and one heart in a water celery hydroponic nutrient solution, remove the root system and use it as an explant;
[0015] Step 3: Preparation of liquid infectious material and solid infectious material;
[0016] Step 4: Infection;
[0017] Step 5: Inducing and cultivating new root system;
[0018] Step 6: Detection of genetically modified roots.
[0019] Furthermore, the celery hydroponic nutrient solution contains a variety of macronutrient fertilizers and trace element fertilizers;
[0020] Macroelement fertilizers and their concentrations are: Ca(NO3)2, 825mg / L; KNO3, 404mg / L; NH4NO3, 40mg / L; MgSO4, 304mg / L; K2SO4, 340mg / L; KH2PO4, 460mg / L; trace element fertilizers and their concentrations are: EDTA-Fe, 20mg / L; BH3O3, 3mg / L; ZnSO4, 0.22mg / L; CuSO4, 0.08mg / L; 0.02mg / L(NH4)2MoO4.
[0021] Furthermore, the steps of preparing the liquid infection material and the solid infection material are as follows:
[0022] S1: Select Agrobacterium rhizogenes carrying a marker gene and culture it in TY liquid medium containing 50 mg / L kanamycin sulfate and 50 mg / L streptomycin sulfate until the bacterial liquid OD600 = 0.8-1.0;
[0023] S2, take 300 μl of the bacterial solution in S1, spread it on TY solid medium containing 50 mg / L kanamycin sulfate and 50 mg / L streptomycin sulfate, and culture it upside down at 28°C until the surface of the medium is covered with a uniform layer of Agrobacterium rhizogenes as a solid infection material;
[0024] S3. Take 50 mL of the bacterial solution in S1, centrifuge at 12000 rpm for 5-10 min, remove the supernatant, and resuspend the Agrobacterium rhizogenes at the bottom of the centrifuge tube with a resuspension solution to a concentration of OD600 = 0.8-1.0 as a liquid infection.
[0025] Furthermore, the marker gene vector carried by the Agrobacterium rhizogenes is pCAMBIA1300-35S-sGFP; the Agrobacterium rhizogenes is K599.
[0026] Furthermore, step four is specifically as follows:
[0027] Rinse the surface of the water celery taken out from the hydroponic culture medium to make sure there is no impurity attached to the surface, dry the surface moisture with a paper towel, use scissors to remove the water celery roots, and keep the above-ground stems and leaves; place the wound bottom facing down and soak it in the liquid infection for 30 minutes, then take it out and dip the wound part in the solid infection. After the infection is completed, plant it in the substrate immediately.
[0028] Furthermore, step five is specifically as follows;
[0029] The infected water celery plants are immediately planted in a substrate with a ratio of nutrient soil to vermiculite of 3:1 for cultivation, and watered until the substrate remains moist. The water celery is planted in a seedling pot with a substrate depth of 10 cm, and the water celery plants are vertically inserted at a substrate depth of 3-5 cm during planting; the infected water celery plants are placed in a greenhouse with a temperature of 15-20°C and a light intensity of 16h / darkness of 8h for induction cultivation for 12-15 days to obtain positive new root systems.
[0030] Furthermore, in step six, an excitation light source is used to perform green fluorescent protein signal excitation detection on the newly grown roots of the water celery to determine whether they are transgenic roots.
[0031] Beneficial effects: The present invention provides a method for rapidly obtaining transgenic roots of water celery using Agrobacterium rhizogenes, which has simple steps and is easy to operate. The method uses water celery petioles as explants and uses Agrobacterium rhizogenes for genetic transformation, and obtains stably transformed transgenic roots of water celery without the need for sterile tissue culture surfaces, thus avoiding the possibility of transformation failure caused by material contamination, and laying a foundation for subsequent high-quality resource breeding of water celery and research on functional genomics. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 It is a diagram of the genetic transformation process of the present invention;
[0033] Among them, a: preparation of water celery explants; bc: preparation and infection of liquid inoculants; de: preparation and infection of solid inoculants; f: induction culture of new root system; g: new hairy roots; h: positive hairy roots;
[0034] Figure 2 This is the positive root green fluorescent protein signal detection diagram;
[0035] Figure 3 This is the result of the root DNA level verification of "sq015";
[0036] Figure 4 This is the result of the root DNA level verification of "FQ1H";
[0037] Figure 5 This is the effect of different infection methods on the positive root conversion rate of the water celery resource "sq015";
[0038] Figure 6 This is a diagram showing the effect of different infection methods on the positive root conversion rate of the water celery resource "FQ1H";
[0039] Figure 7 This is the expression level diagram of OjTIFY2 in the root system of "FQ1H" in Example 1. DETAILED DESCRIPTION
[0040] The technical solution of the present invention is described in detail below in conjunction with specific embodiments, but the protection scope of the present invention is not limited to the embodiments.
[0041] Example 1
[0042] A method for rapidly obtaining transgenic roots of celery using Agrobacterium rhizogenes, Figure 1 It is a genetic transformation process diagram of the present invention, and the specific steps are as follows:
[0043] Step 1: Preparation of nutrient solution for hydroponic celery.
[0044] The nutrient solution contains a variety of macro-element fertilizers and trace element fertilizers.
[0045] Macronutrient fertilizers and their concentrations are: Ca(NO3)2, 825mg / L; KNO3, 404mg / L; NH4NO3, 40mg / L; MgSO4, 304mg / L; K2SO4, 340mg / L; KH2PO4, 460mg / L;
[0046] Trace element fertilizers and their concentrations are: EDTA-Fe, 20 mg / L; BH3O3, 3 mg / L; ZnSO4, 0.22 mg / L; CuSO4, 0.08 mg / L; 0.02 mg / L (NH4)2MoO4.
[0047] Step 2: Preparation of Water Celery Explants
[0048] The petiole bases of two resource water celery seedlings, "sq015" and "FQ1H", which had grown to two leaves and one heart in hydroponic culture medium, were selected as the infection objects.
[0049] Step 3: Preparation of infectious agents
[0050] (i) Activate the Agrobacterium rhizogenes strain K599 carrying the green fluorescent marker gene 35S::pCAMBIA1300-GFP, spread it on TY solid culture medium containing 50 mg / L kanamycin sulfate and 50 mg / L streptomycin sulfate, place it in an incubator at 28°C and culture it upside down for 36-48 hours to obtain a single colony, pick a single colony and place it in a sterile conical flask containing 60 ml TY liquid culture medium containing 50 mg / L kanamycin sulfate and 50 mg / L streptomycin sulfate, shake and culture it at 200 rpm, 28°C overnight until the bacterial solution concentration is OD600 = 0.8-1.0.
[0051] (ii) Take 300 μl of the above bacterial solution and spread it evenly on TY solid culture medium containing 50 mg / L kanamycin sulfate and 50 mg / L streptomycin sulfate, and culture it upside down at 28°C until the surface of the solid culture medium is covered with a uniform layer of Agrobacterium rhizogenes as a solid infection material.
[0052] (III) Take 50 mL of the bacterial solution in (I), centrifuge at 12000 rpm for 5-10 min, remove the supernatant, take 1 ml of the resuspension solution, pipette and mix the Agrobacterium rhizogenes at the bottom of the centrifuge tube, and then resuspend and culture with the resuspension solution until the concentration is OD 600 =0.8-1.0, as liquid infection.
[0053] The formula of TY solid culture medium is: 5g / L tryptone + 3g / L yeast extract + 7g / L agar + 10mM CaCl2; the formula of TY liquid culture medium is: 5g / L tryptone + 3g / L yeast extract + 10mM CaCl2.
[0054] The formula of the resuspension solution is: 10 mM MgCl2+10 mM MES+200 uMAS (acetosyringone), pH=5.8-5.8.
[0055] Step 4: Infection
[0056] First, rinse the surface of the water celery taken out of the hydroponic culture medium to make sure there is no impurities such as matrix attached to the surface. Use paper towels to absorb the surface moisture, use scissors to remove the water celery roots, and keep the above-ground stems and leaves. Place the wound bottom down in the liquid infection material for 30 minutes for infection treatment, then dip the wound part in the solid infection material. After infection, plant it in a matrix with a ratio of 3:1 of nutrient soil and vermiculite for cultivation.
[0057] The infection and culture process of the above steps do not require the use of a sterile tissue culture environment, which largely avoids the problem of contamination during the tissue culture process and is more convenient and efficient. It should be noted that when the wound is infected with solid infectious materials, the bottom cut surface of the wound needs to be placed flat on the culture medium, and the position should be constantly adjusted so that the bottom cut surface is in close contact with the bacterial layer.
[0058] Step 5: New root induction culture
[0059] Immediately after the infection, the plants are planted in a substrate with a ratio of nutrient soil to vermiculite of 3:1 for cultivation, and watered until the substrate remains moist. The water celery is planted in a seedling pot with a substrate depth of 10 cm, and the water celery plants are vertically inserted at a substrate depth of 3-5 cm during planting.
[0060] Place the infected water celery in a greenhouse with a temperature of 15-20℃ and 16h light / 8h dark for 12-15 days of induction culture to obtain positive new roots.
[0061] Step 6: Detection of genetically modified roots
[0062] (1) Fluorescence detection
[0063] The hairy roots of the transformed plants were observed using a fluorescence microscope, and the new roots grown from the water celery were excited and tested for green fluorescent protein signals using an excitation light source to confirm whether they were transgenic roots. Roots with green fluorescent signals were transgenic roots, while roots without green fluorescent signals were non-transgenic roots. Figure 2 This is the positive root green fluorescent protein signal detection diagram of this embodiment, Figure 2 It can be seen that both the "sq015" and "FQ1H" resource celery seedlings were successfully transformed.
[0064] (2) DNA level verification
[0065] The induced fluorescent hairy roots were quickly frozen in liquid nitrogen and ground into powder, and tissue DNA was obtained using the Novozyme kit for PCR amplification detection. The pCAMBIA1300-35S-sGFP detection primers were GFP-F (SEQ ID NO.1): 5'-GATATCTCCACTGACGTAAGGGATG-3', GFP-R (SEQ ID NO.2): 5'-AACTTGTGGCCGTTTACGTCG-3'.
[0066] The results are as follows Figure 3 and Figure 4 As shown, Figure 3 This is the result of the root DNA level verification of "sq015"; Figure 4 This is the verification result of the root DNA level of "FQ1H". Figure 3 and Figure 4 In the figure, WT is a control of water celery that was not infected, S1-S3 represent the numbers of three water celery strains "sq015" that were infected, and F1-F3 represent the numbers of three water celery strains "FQ1H" that were infected.
[0067] (3) Verification of OjTIFY2 expression level
[0068] In this example, Agrobacterium rhizogenes carries the target gene OjTIFY2, and tissue RNA is obtained using a Novagen kit and reversely transcribed into cDNA for quantitative detection. The primers for OjTIFY2 gene detection are OjTIFY2-F (SEQ ID NO.3): 5'-GAGCAGCAGAAGGGTACTCG-3', and OjTIFY2-R (SEQ ID NO.4): 5'-CTCGGGGCTTTGGAGAACAA-3'.
[0069] The nucleotide sequence of OjTIFY2 (SEQ ID NO.5) is:
[0070] ATGAATAATAAAATCATGGGAAGAAAGTGCAACTTGGAACTTGGACTTGAAACCC
[0071] CTTCATGTGATGATGATGATCATACACTGGGAGATATATGCCAACACCAACCAGTGA
[0072] TCGGGGAGGTGACACATAGGAATCCACGGGAGGAGCAGCAGAAGGGTACTCGAA
[0073] AGCTAACAATTTTCTATAATGGGAGAGTCAGTTCATGTGATGTTACAGAGATTCAG
[0074] GCTAGATCCATCATATCAGTTGCAAGTGAAGAAATTTTACTGAAAGAGAAGGAAG
[0075] CAATGACACCAACTTGCTCAGAGACATCTTTGGATTGTTCTCCAAAGCCCCGAGTC
[0076] ATGTATAAGCAGCAAAATATGAAAAGATCTTTGCAACAATTTCTTCAAAAGAGGAG
[0077] GACTAGGATCCGATCAACATCATCTTATTGTACTCCCTAG
[0078] By performing qRT-PCR detection on the "FQIH" water celery fluorescent hairy roots obtained in Example 1, it was found that the expression level of OjTIFY2 in the water celery root system was as follows: Figure 7 shown.
[0079] Example 2
[0080] Compared with Example 1, this embodiment is different only in the dipping operation in step 4. In this embodiment, no solid contaminant is dipped. The specific operation of step 4 in this embodiment is as follows:
[0081] First, rinse the surface of the water celery taken out from the substrate to make sure there is no substrate or other impurities attached to the surface. Use paper towels to absorb the surface moisture. Use scissors to remove the water celery roots, retain the above-ground stems and leaves, and place the bottom of the wound facing down in the liquid infection material for 30 minutes for infection treatment. After the infection is completed, immediately plant it in a substrate with a ratio of 3:1 between nutrient soil and vermiculite for cultivation.
[0082] Example 3
[0083] Compared with Example 1, this embodiment is different only in the dipping operation in step 4. This embodiment removes the operation of soaking the liquid contaminant for 30 minutes. The specific operation of step 4 in this embodiment is as follows:
[0084] First, rinse the surface of the water celery taken out from the substrate to make sure there is no substrate or other impurities attached to the surface. Use paper towels to absorb the surface moisture. Use scissors to remove the water celery roots, retain the above-ground stems and leaves, dip the bottom of the wound into solid infection materials, and then immediately plant it in a substrate with a ratio of 3:1 between nutrient soil and vermiculite for cultivation.
[0085] Example 4
[0086] Compared with Example 1, in this example, only in step 4, the solid infecting material is first dipped and then the liquid infecting material is poured. The specific operation is:
[0087] First, rinse the surface of the water celery taken out from the substrate to make sure there is no substrate or other impurities attached to the surface. Use paper towels to absorb the surface moisture. Use scissors to remove the water celery roots, retain the above-ground stems and leaves, dip the bottom of the wound (base of the petiole of the water celery) in solid infection material, and plant it in a substrate with a ratio of nutrient soil to vermiculite of 3:1. Immediately afterwards, pour 10 ml of liquid infection material on each plant.
[0088] The statistical table of the effects of different infection methods on the conversion efficiency of two water celery resources in Examples 1-4 is shown in Table 1. Figure 5 This is the effect of different infection methods on the positive root conversion rate of the water celery resource "sq015"; Figure 6 This is a graph showing the effects of different infection methods on the root positive root conversion rate of the water celery resource "FQ1H".
[0089] Table 1 Effects of different infection methods on the conversion efficiency of two water celery resources
[0090]
[0091] like Figure 3 , Figure 4 and Figure 7 As shown, the pCAMBIA1300-35S-sGFP band can be amplified in the fluorescent hairy roots of water celery obtained by induction of Agrobacterium rhizogenes. Further, by performing qRT-PCR detection on the "FQIH" fluorescent hairy roots of water celery obtained in Example 1, it was found that the expression level of the target gene OjTIFY2 carried by Agrobacterium rhizogenes was significantly enhanced compared with the uninfected control group. The above results all indicate that the fluorescent hairy roots are transgenic hairy roots induced by Agrobacterium rhizogenes, and it is feasible to use this system to transfer the target gene into the root system of water celery.
[0092] As described above, although the present invention has been shown and described with reference to specific preferred embodiments, it should not be construed as limiting the present invention itself. Various changes in form and details may be made without departing from the spirit and scope of the present invention as defined in the appended claims.
Claims
1. A method for rapidly obtaining transgenic roots of celery using Agrobacterium rhizogenes, characterized in that: The water celery plant after the root system is removed is taken as an explant, and the wound at the base of the petiole of the water celery plant is immersed in a liquid infection substance, and then taken out and dipped in a solid infection substance, and then planted in a substrate for cultivation; The preparation methods of the liquid infection material and the solid infection material are as follows: S1. Select Agrobacterium rhizogenes carrying a marker gene and culture it in a TY liquid medium containing kanamycin sulfate and streptomycin sulfate until the bacterial liquid OD600 = 0.8-1.0; S2, take the bacterial solution in S1, apply it on TY solid culture medium containing kanamycin sulfate and streptomycin sulfate, and invert and culture until the surface of the culture medium is covered with a uniform layer of Agrobacterium rhizogenes as a solid infection material; S3. Take the bacterial solution in S1, centrifuge to remove the supernatant, and resuspend it in infection solution to OD600 = 0.8-1.0 as the liquid infection medium.
2. The method according to claim 1, characterized in that The specific steps include: Step 1: Preparation of nutrient solution for hydroponic celery; Step 2: Select a water celery plant that has grown to two leaves and one heart in a water celery hydroponic nutrient solution, remove the root system and use it as an explant; Step 3: Preparation of liquid infectious material and solid infectious material; Step 4: Infection; Step 5: Inducing and cultivating new root system; Step 6: Detection of genetically modified roots.
3. The method according to claim 2, characterized in that The celery hydroponic nutrient solution contains a variety of macronutrient fertilizers and trace element fertilizers; Macronutrient fertilizers and their concentrations are: Ca(NO3)2, 825mg / L; KNO3, 404mg / L; NH4NO3, 40mg / L; MgSO4, 304mg / L; K2SO4, 340mg / L; KH2PO4, 460mg / L; Trace element fertilizers and their concentrations are: EDTA-Fe, 20 mg / L; BH3O3, 3 mg / L; ZnSO4, 0.22 mg / L; CuSO4, 0.08 mg / L; 0.02 mg / L (NH4)2MoO4.
4. The method according to claim 2, characterized in that: The steps for preparing liquid and solid infectious materials are as follows: S1: Select Agrobacterium rhizogenes carrying a marker gene and culture it in TY liquid medium containing 50 mg / L kanamycin sulfate and 50 mg / L streptomycin sulfate until the bacterial liquid OD600 = 0.8-1.0; S2, take 300 μl of the bacterial solution in S1, spread it on TY solid medium containing 50 mg / L kanamycin sulfate and 50 mg / L streptomycin sulfate, and culture it upside down at 28°C until the surface of the medium is covered with a uniform layer of Agrobacterium rhizogenes as a solid infection material; S3. Take 50 mL of the bacterial solution in S1, centrifuge at 12000 rpm for 5-10 min, remove the supernatant, and resuspend the Agrobacterium rhizogenes at the bottom of the centrifuge tube with a resuspension solution to a concentration of OD600 = 0.8-1.0 as a liquid infection.
5. The method according to claim 1, characterized in that The marker gene vector carried by the Agrobacterium rhizogenes is pCAMBIA1300-35S-sGFP; the Agrobacterium rhizogenes is K599.
6. The method according to claim 2, characterized in that Step 4 is as follows: Rinse the surface of the water celery taken out from the hydroponic culture medium to make sure there is no impurity attached to the surface, dry the surface moisture with a paper towel, use scissors to remove the water celery roots, and keep the above-ground stems and leaves; place the wound bottom facing down and soak it in the liquid infection for 30 minutes, then take it out and dip the wound part in the solid infection. After the infection is completed, plant it in the substrate immediately.
7. The method according to claim 2, characterized in that Step 5 is as follows: Immediately plant the infected water celery plants in a substrate with a ratio of nutrient soil to vermiculite of 3:1 for cultivation, water the substrate until it remains moist, and plant the water celery in a seedling pot with a substrate depth of 10 cm, and when planting, vertically insert the water celery plants at a substrate depth of 3-5 cm; Place the infected water celery plants in a greenhouse with a temperature of 15-20°C and 16h of light / 8h of darkness for 12-15 days of induction culture to obtain positive new roots.
8. The method according to claim 2, characterized in that: In step six, an excitation light source is used to detect green fluorescent protein signals on the newly grown roots of the water celery to determine whether they are transgenic roots.