Application of OsSCL25 gene in regulating and controlling salt stress resistance of rice

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to application of an OsSCL25 gene in regulating and controlling salt stress resistance of rice. Under the stress of salt, the survival rate, chlorophyll, fresh weight and dry weight of strain seedlings of the overexpressed OsSCL25 gene are higher than those of a wild type, the content of superoxide dismutase, peroxidase and malondialdehyde is lower than that of the wild type, and the content of proline is remarkably higher than that of the wild type and a mutant. The soluble sugar content of the wild type, the soluble sugar content of the OsSCL25 mutant and the soluble sugar content of the overexpression system are not obviously different under normal treatment, and the soluble sugar content of the overexpression system is obviously higher than that of the wild type and the soluble sugar content of the gene mutant after salt stress, so that the OsSCL25 gene participates in rice salt tolerance regulation. After the gene is over-expressed, the salt tolerance of the rice is obviously improved, so that a rice material suitable for saline-alkali soil planting improvement can be cultivated by utilizing the OsSCL25 through a biotechnology, and a new thought is provided for improving the planting rate of the rice in the saline-alkali soil.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and particularly relates to application of OsSCL25 gene in regulating rice salt stress tolerance. Background Art

[0002] The most sensitive periods to salt stress in the entire growth cycle of rice are the seedling stage and the reproductive stage. Existing studies mainly select salt-tolerant varieties by observing the salt-tolerance phenotype in the seedling stage. The main harm caused by salt stress to rice growth is cell osmotic imbalance and ion damage. Salt stress causes ion imbalance in rice cells, increased cell membrane permeability, a large number of ions entering the cells, generating ROS, causing the antioxidant system in the cells to be disordered and unable to perform normal physiological functions and thus inactivate; salt stress causes the degradation of chlorophyll in rice leaves in a short period of time, and the photosynthetic rate is reduced, resulting in insufficient energy supply and blocked protein synthesis; in addition, in order to adapt to salt stress, rice needs to use a lot of energy to regulate ion absorption and transport and produce substances that regulate osmotic pressure, such as sucrose, trehalose and proline, which leads to a significant decrease in rice yield and rice quality, and even after processing, it is difficult to meet human consumption needs.

[0003] Rice salt tolerance is a typical quantitative trait, which is regulated by multiple genes. Although multiple genes related to rice salt tolerance have been discovered and identified, improving rice salt tolerance is still difficult in this field. Therefore, identifying more candidate genes that can respond to salt stress is of great significance for comprehensively improving rice salt tolerance. Summary of the invention

[0004] The purpose of the present invention is to provide an application of the OsSCL25 gene in regulating rice salt stress tolerance. Overexpression of the OsSCL25 gene significantly improves rice salt tolerance, providing a new idea for increasing the rice planting rate in saline-alkali land.

[0005] The present invention provides application of OsSCL25 gene in regulating rice salt stress tolerance. The nucleotide sequence of the OsSCL25 gene is shown in SEQ ID NO.1.

[0006] As a preferred embodiment, the regulation is to improve the salt tolerance of rice after overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene in the target rice genome.

[0007] The present invention also provides a method for improving the salt tolerance of rice, comprising the following steps: overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene in the target rice genome;

[0008] The nucleotide sequence of the OsSCL25 gene is shown in SEQ ID NO.1.

[0009] As a preferred embodiment, the CDS sequence of the OsSCL25 gene is shown as SEQ ID NO.2.

[0010] As a preferred embodiment, the overexpression method is to transform the recombinant vector into rice to obtain rice with improved salt tolerance;

[0011] The recombinant vector comprises the OsSCL25 gene or the CDS sequence of the OsSCL25 gene.

[0012] As a preferred embodiment, the transformation method comprises Agrobacterium transformation.

[0013] The present invention also provides a recombinant vector for overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene, characterized in that the nucleotide sequence of the OsSCL25 gene is as shown in SEQ ID NO.1.

[0014] As a preferred embodiment, the basic framework of the recombinant vector includes the pUN1301 vector.

[0015] The present invention also provides a method for creating salt-tolerant rice germplasm, comprising the following steps: overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene in the target rice genome.

[0016] As a preferred embodiment, the rice includes Nipponbare.

[0017] Beneficial effects: The present invention provides an application of the OsSCL25 gene in regulating rice salt tolerance. Under salt stress, the seedlings of the strains overexpressing the OsSCL25 gene all showed higher survival rate, chlorophyll, fresh weight, and dry weight than the wild type, and their superoxide dismutase, peroxidase, and malondialdehyde contents were lower than those of the wild type, and their proline content was significantly higher than that of the wild type and the mutant. Under normal treatment, there was no significant difference in the soluble sugar content of the wild type, the OsSCL25 mutant, and the overexpression system. After salt stress treatment, the soluble sugar content of the overexpression system was significantly greater than that of the wild type and the gene mutant. Therefore, the OsSCL25 gene is involved in the regulation of rice salt tolerance. After overexpression of this gene, the salt tolerance of rice is significantly improved. Therefore, OsSCL25 can be used through biotechnology to cultivate improved rice materials adapted to saline-alkali land cultivation, providing a new idea for increasing the rice planting rate in saline-alkali land. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0019] Figure 1The OsSCL25 gene in Example 1 responds to salt stress; wherein the expression analysis of the rice OsSCL25 gene under salt stress treatment, each group of data was biologically repeated three times, **: P < 0.01 indicates the significance of the expression difference between the experimental group and the control under the t test;

[0020] Figure 2 The positive detection of the OsSCL25 overexpression strain and the determination of the gene expression in Example 2; A is the positive detection of the OsSCL25 overexpression strain, P is the positive control, N is Nipponbare, the negative control; the plants marked with white horizontal lines are positive plants of the overexpression system, and M5000 is the 5000 DNA marker; B is the OsSCL25 gene expression level of the overexpression strain; each group of data has three biological replicates, **: P < 0.01 indicates the significance of the expression difference between the experimental group and the control under the t test, WT represents the wild type, and OE#1 and OE#2 represent the OsSCL25 overexpression strain;

[0021] Figure 3 This is a schematic diagram of constructing the gene editing vector in Example 3;

[0022] Figure 4 It is the positive detection and gene editing site of the scl25 gene editing line in Example 3; A is the positive detection of the scl25 gene editing line, P is the positive control, N is Nipponbare, the negative control; scl25T0 is the T0 plant of the scl25 gene editing line, and M5000 is the 5000 DNA marker; B is the mutation site information of the gene editing lines scl25#1 and scl25#2, the numbers represent the relative position of the ATG start, the arrows represent the insertion or deletion position of the base, "+" represents the insertion of the base, and "-" represents the deletion of the base; the scale bar is 100 bases;

[0023] Figure 5 The phenotype of the OsSCL25 gene in Example 4 in response to salt stress; A is the phenotypic difference of the wild type, OsSCL25 gene editing line, and overexpression line under salt stress, and the scale is 10 cm; B is the survival rate of the wild type, OsSCL25 gene editing line, and overexpression line; C is the fresh weight of each strain and D is the dry weight of each strain; WT represents the wild type, scl25#1 and scl25#2 represent the OsSCL25 gene editing line, and OE#1 and OE#2 represent the OsSCL25 overexpression line; each group of data was biologically repeated three times, and multiple comparisons were performed according to the LSD method, and significant differences were marked with different lowercase letters, p<0.05;

[0024] Figure 6The figures are NBT and DAB staining of the wild type, OsSCL25 mutant and overexpression lines under salt stress in Example 4; A is the level of hydrogen peroxide detected by NBT staining in the wild type, OsSCL25 mutant and overexpression lines before and after salt treatment; B is the accumulation of superoxide anions detected by DAB staining in the wild type, OsSCL25 mutant and overexpression lines before and after salt treatment; WT represents the wild type, scl25#1 and scl25#2 represent the OsSCL25 gene-edited lines, OE#1 and OE#2 represent the OsSCL25 overexpression lines, and the scale bars are all 5 mm;

[0025] Figure 7 The physiological indexes of the wild type, OsSCL25 gene-edited lines, and overexpression lines after salt stress in Example 4 are measured; wherein A is superoxide dismutase activity (SOD); B is peroxidase activity (POD); C is hydrogen peroxide content; D is chloroplast content; E is catalase activity (CAT); F is malondialdehyde content (MDA); G is proline content; H is soluble sugar content; WT represents the wild type, scl25#1 and scl25#2 represent OsSCL25 gene-edited lines, OE#1 and OE#2 represent OsSCL25 overexpression lines, multiple comparisons were performed according to the LSD method, and significant differences were marked with lowercase letters, p<0.05. DETAILED DESCRIPTION

[0026] The present invention provides an application of an OsSCL25 gene in regulating rice salt stress tolerance, wherein the regulation is to improve the salt tolerance of rice after overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene in a target rice genome.

[0027]

[0028] As a specific implementation manner, the CDS sequence of the OsSCL25 gene is shown in SEQ ID NO.2: 5'--3'.

[0029] The present invention also provides a method for improving the salt tolerance of rice, comprising the following steps: overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene in the target rice genome; the nucleotide sequence of the OsSCL25 gene is shown in SEQ ID NO.1; the CDS sequence of the OsSCL25 gene is shown in SEQ ID NO.2. As a specific embodiment, the rice includes Nipponbare. The salt may be NaCl.

[0030] As a specific embodiment, the method for improving the salt tolerance of rice of the present invention comprises: transferring a recombinant vector containing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene into Agrobacterium EHA105, and transforming the recombinant vector into the target rice genome by using an Agrobacterium-mediated transgenic method to obtain rice with improved salt tolerance. As a specific embodiment, the basic skeleton of the recombinant vector can be a pUN1301 vector.

[0031] As a specific implementation method, under salt stress, after overexpressing the OsSCL25 gene in the target rice genome, compared with the wild type, the OsSCL25 overexpression line grew better than the wild type, had significantly fewer withered leaves than the wild type and the mutant, and the survival rate reached 70% after 14 days of recovery, indicating that OsSCL25 has a positive effect on regulating salt tolerance of rice seedlings.

[0032] As a specific embodiment, under salt stress, the seedlings of the strains overexpressing the OsSCL25 gene all showed higher chlorophyll, fresh weight, and dry weight than the wild type, and their superoxide dismutase, peroxidase, and malondialdehyde contents were lower than those of the wild type, and the proline content was significantly higher than that of the wild type and the mutant. Under normal treatment, there was no significant difference in the soluble sugar content of the wild type, the OsSCL25 mutant, and the overexpression line, but after salt stress, the soluble sugar content of the overexpression line was significantly greater than that of the wild type and the gene mutant, so the OsSCL25 gene was involved in the regulation of rice salt tolerance. After overexpression of this gene, the salt tolerance of rice was significantly improved, so that OsSCL25 can be used through biotechnology to cultivate rice materials adapted to saline-alkali land cultivation and improvement, providing a new idea for increasing the rice planting rate in saline-alkali land.

[0033] The present invention also provides a method for creating salt-tolerant rice germplasm, comprising the following steps: overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene in the target rice genome.

[0034] To further illustrate the present invention, the application of the OsSCL25 gene provided by the present invention in regulating rice salt stress tolerance is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0035] Unless otherwise specified, the present invention has no special requirements for the preparation raw materials, and commercially available products known to those skilled in the art can be used.

[0036] Example 1 Analysis of Salt Stress-Induced Expression Characteristics of Rice OsSCL25

[0037] In order to explore the effect of salt treatment on the expression of OsSCL25 gene (LOC_Os07g43950, as shown in SEQ ID NO.1), plump and uniform Nipponbare seeds (Li Y, Zhou J, Li Z, Qiao J, Quan R, Wang J, Huang R, Qin H. SALT AND ABA RESPONSE ERF1 improves seed germination and salt tolerance by repressing ABA signaling in rice. Plant Physiol. 2022Jun 1; 189(2): 1110-1127. doi: 10.1093 / plphys / kiac125. PMID: 35294556; PMCID: PMC9157093.) with no obvious spots on the appearance were selected and placed in a 37°C oven for 2 days until dormancy was broken, then soaked in 75% alcohol for 2 min for disinfection, and washed with clean water. The seeds are placed in a 30℃ incubator with clean water just covering them. The water is changed every 6 hours until the seeds turn white. The seeds that turn white are placed in a 37℃ incubator and covered with clean water for germination. After 1 day, the seeds that sprouted consistently are selected and placed in a 96-well black germination box. Use clean water for culturing in the first week and add 1 / 2 concentration of rice nutrient solution for culturing in the next two weeks. Complete rice nutrient solution needs to be prepared with 5 kinds of mother liquids. To each liter of complete rice nutrient solution, 1 mL of mother liquid 1, 1 mL of mother liquid 2, 1 mL of mother liquid 3, 1 mL of mother liquid 4 and 1 mL of mother liquid 5 need to be added (mother liquid 1: NH4NO3 80 g / L, NaH2PO4·2H2O 93 g / L, K2SO4 52.4 g / L; mother liquid 2: CaCl2·2H2O 44.2 g / L; mother liquid 3: MgCl2·6H2O 122 g / L; mother liquid 4: FeEDTA 19 g / L; mother liquid 5: H3BO3 3.01 g / L, MnSO4·5H2O 2.17 g / L, CuSO4·5H2O 0.075 g / L, ZnSO4·7H2O 0.2008 g / L, NaMoO4·2H2O 0.024 g / L), and the pH was adjusted to 5.8. The seedlings were cultured to the 4-leaf stage and divided into a control group and a treatment group. The control group was moved to a square plastic box containing complete rice nutrient solution for culture, and the treatment group was moved to a square plastic box containing complete rice nutrient solution with 150 mM NaCl (8.775 g NaCl was added per liter of complete rice nutrient solution).Then start timing, take the aboveground samples of the control group and the treatment group 1h, 3h, 6h, 9h, 12h, 24h, 48h, 72h, 120h, 168h after treatment, immediately take samples and harvest in liquid nitrogen, extract total RNA by Trizol method, grind the samples thoroughly and add 1mL RNAExtraction Reagent (manufacturer: Yisheng Biotechnology Co., Ltd., catalog number: 10606ES60), place at room temperature for 5 minutes, add 1 / 5 volume of chloroform, shake vigorously for 15 seconds, place at room temperature for 3 minutes, centrifuge at 4°C, 12000g for 10 minutes, then draw the supernatant into a new centrifuge tube, add 1 / 2 volume of isopropanol, invert and mix, place at room temperature for 10 minutes, centrifuge at 4°C, 12000g for 10 minutes, carefully remove the supernatant, add an equal volume of 75% ethanol to wash thoroughly, centrifuge at 4°C, 7500g for 5 minutes, remove the supernatant, place at room temperature to air dry for 10 minutes, and add 100μL sterile water to dissolve RNA. After complete dissolution, measure the RNA concentration and reverse transcribe it into cDNA using reverse transcription reagent (Yisheng Biotechnology Co., Ltd., catalog number: 11141ES60). Primers were designed and the expression level of OsSCL25 before and after salt treatment was detected by HieffqPCR SYBR Green MasterMix (Cat. No.: 11201ES08) provided by Yisheng Biotechnology Co., Ltd. Primer sequences: Primer F: 5'-ATGGGGAGAGGCTACAGTTAC-3' (as shown in SEQ ID NO.3); Primer R: 5'-GGGAGATCTCTACCACGTCC-3' (as shown in SEQ ID NO.4).

[0038] The results are as follows Figure 1 As shown in Table 1, the results showed that the OsSCL25 gene began to decrease 6 hours after salt stress, and the gene expression was significantly inhibited from 6 hours to 168 hours after the stress occurred. The difference reached a peak at 24 hours, when the expression level of the control group was about 3 times that of the salt treatment, and then the difference began to decrease, indicating that the rice OsSCL25 gene responded to salt stress.

[0039] Table 1 Gene expression data of rice OsSCL25 under salt stress

[0040]

[0041] Example 2 Construction and molecular identification of rice OsSCL25 gene overexpression vector

[0042] 1. Construction of rice OsSCL25 gene overexpression vector

[0043] According to the RNA extraction and reverse transcription method in Example 1, cDNA mixed samples of the aboveground and underground parts of Nipponbare seedlings were obtained. The cDNA mixed samples were used as templates, and corresponding primers were designed using the Chinese Rice website (https: / / www.ricedata.cn / ) and SnapGene software. The CDS fragment of the OsSCL25 gene (as shown in SEQ ID NO.2) was specifically amplified using ordinary Tap enzyme PCR reaction for subsequent experiments. The following primers (Primer F3: 5'-CGACTCTAGAGGATCCCCG GGATGGGGAGAGGCTACAGT-3' (as shown in SEQ ID NO.5); Primer R3: 5'-AATTCGAGC TCGGTACCCGGGTCACTTGTCATCGTCATCCTTGTAGTC-3' (as shown in SEQ ID NO.6)) were designed for PCR fragment amplification.

[0044] The reaction system was 10 μL: 5 μL 2×HieffPCR Master Mix, 0.25 μL Primer F, 0.25 μL Primer R, 0.5 μL of the above template, and 4 μL ddH2O. PCR reaction conditions: 98°C pre-denaturation for 5 min, 98°C denaturation for 30 sec, 54°C annealing for 30 sec, 72°C extension for 1 min, 32 cycles; 72°C extension for 3 min, 4°C storage. The success of the experiment was then determined based on the results of agarose gel electrophoresis. The DNA purification kit (Cat. No. DR0101250) provided by Hangzhou EasySide Biotechnology Co., Ltd. was used to recover and purify the correct target gene fragment to obtain the CDS fragment of the OsSCL25 gene with restriction sites.

[0045] A Smal restriction site (Thermo Fisher Scientific, catalog number: ER0661) was selected in the multiple cloning site region of the pUN1301 (Xia C, Liang G, Chong K, Xu Y. The COG1-OsSERL2 complex sensescold to trigger signaling network for chilling tolerance in japonica rice. Nat Commun. 2023 May 29; 14 (1): 3104. doi: 10.1038 / s41467-023-38860-4. Erratumin: Nat Commun. 2024 April 26; 15 (1): 3536. doi: 10.1038 / s41467-024-47895-0. PMID: 37248220; PMCID: PMC10227007.) vector, and the vector plasmid was linearized by restriction digestion. The restriction digestion method was carried out according to the instructions. Subsequently, the OsSCL25 gene overexpression recombinant vector was obtained by homologous recombination.

[0046] Homologous recombination: The homologous recombination method Clone Express II One Step Cloning Kit (Nanjing Novogene Biotech Co., Ltd., Catalog No.: C112-01) was used to insert the CDS fragment of the OsSCL25 gene into the Smal region of the pUN1301 vector multiple cloning site according to the instructions. The resulting overexpression recombinant vector was named pUN1301-OsSCL25.

[0047] 2. Identification of OsSCL25 gene overexpression lines in rice

[0048] The pUN1301-OsSCL25 overexpression recombinant vector obtained in the previous step was transformed into Agrobacterium EHA105. After successful transformation, rice OsSCL25 gene overexpression T0 generation transgenic plants were obtained by rice genetic transformation method.

[0049] Agrobacterium transformation: Take out 100μL of Agrobacterium competent medium from the -80℃ refrigerator, melt it on ice until it is in the state of ice-water mixture, add 10μL of pUN1301-OsSCL25 vector recombinant plasmid, pipette and mix well, then freeze in liquid nitrogen for 5min, water bath at 37℃ for 5min, and then ice bath for 5min; add 750μL of LB liquid medium without antibiotics, then shake at 28℃ and 200rpm for more than 2h; absorb 100μL of the above-recovered Agrobacterium liquid and apply it on the solid LB medium containing 50mg / L rifampicin and 50mg / L kanamycin antibiotics, turn the plate upside down, and culture at 28℃ for 3 days. Pick a single clone from the plate and culture it in liquid LB containing rifampicin and kanamycin antibiotics, then send it to the company for sequencing and screening of positive clones to obtain Agrobacterium containing pUN1301-OsSCL25 vector.

[0050] Obtaining transgenic rice lines: (1) Select 20g of disease-free Nipponbare rice seeds and remove the seed shells to ensure the integrity of the seed embryo. Soak in 75% alcohol for 1min, wash with ddH2O, and disinfect with 20% sodium hypochlorite for 20min. Then wash with sterile water and place in a clean bench to dry. Place callus culture medium (KNO3 2.83g / L, CaCl2·2H2O 0.166g / L, MgSO4·7H2O 0.185g / L, K2HPO4 0.4g / L, (NH4)2SO4 0.463g / L, KI08mg / L, H3BO3 1.6mg / L, MnSO4·4H2O 4.4mg / L, ZnSO4·7H2O 1.5mg / L, FeSO4·7H2O 27.8mg / L, Na2·EDTA·2H2O 37.3mg / L, inositol 0.1g / L, glycine 2mg / L, VB30.5mg / L, VB60.5mg / mL, VB11mg / L, 2,4-D 0.1mg / L, hydrolyzed casein 0.3g / L, proline 2.878g / L, sucrose 30g / L, 2,4-D 0.1mg / L, agar 7g / L, pH adjusted to 5.8), the whole process was sterile, and cultured at 28°C under continuous light for 8 consecutive days until good callus tissue grew.

[0051] (2) After resuspending the Agrobacterium containing the pUN1301-OsSCL25 vector in liquid LB, 100 μL was applied to AB solid medium (NaH2PO4 1 g / L, NH4Cl 1 g / L, MgSO4·7H2O 0.3 g / L, KCl 0.15 g / L, CaCl2·2H2O 12 mg / L, FeSO4·7H2O 2.5 mg / L, glucose 5 g / L, agar 15 g / L, kanamycin 50 mg / L, rifampicin 50 mg / L, pH adjusted to 5.8) and cultured at 28°C. After 3 days, the cells were cultured with 20 mL of AAM liquid culture medium (KCl 0.3 g / L, CaCl2·2H2O 15 mg / L, MgSO4·7H2O 25 mg / L, NaH2PO4 15 mg / L, KI 0.75 mg / L, H3BO 33 mg / L, MnSO4·4H2O 10 mg / L, ZnSO4·7H2O 2 mg / L, NaMoO4·2H2O 0.25 mg / L, CuSO4·5H2O 0.025 mg / L, CoCl2·6H2O 0.025 mg / L, FeSO4·7H2O 27.8mg / L, Na2·EDTA·2H2O37.3mg / L, inositol 0.1g / mL, glycine 7.5mg / L, VB31mg / L, VB61mg / L, VB110mg / L, glutamine 0.9g / L, arginine 0.177g / L, aspartic acid 0.3g / L, hydrolyzed casein 0.5g / L, glucose 18g / L, sucrose 20g / L, pH adjusted to 5.2) Rinse the cultured Agrobacterium from the AB solid medium and adjust the bacterial solution concentration to OD 600 =0.1, and after adjusting the OD value, add 20 μL of 100 mM acetosyringone and place on a shaker for 1 h to obtain the treated bacterial solution.

[0052] (3) Select good callus tissue and place it in the above-treated bacterial solution and shake it gently for 5 minutes. Then pour out the bacterial solution, place the callus tissue in a sterile filter paper culture dish to absorb the excess bacterial solution, and then place it in 2N6-AS solid medium (50mL 20×N6 macroelement mother solution, 10mL 100×N6 trace element mother solution, 10mL 100× iron salt mother solution, 10mL 10mg / mL inositol, 1mL 2mg / mL glycine, 0.5mL 1mg / mL VB3, 0.5mL 1mg / mL VB6, 0.1mL 10mg / mL VB1, 0.45mL 0.25mg / mL 2,4-D, 0.3g hydrolyzed casein, 10g glucose, 30g sucrose, dilute to 1L with water, adjust the pH to 5.2, add 7g agar powder, sterilize at high temperature and high pressure, cool and add 1mL under sterile conditions The cells were cultured on 100 mM AS) at 25°C in the dark for 3 days.

[0053] (4) After 3 days, the callus tissue after dark culture was collected into a sterile Erlenmeyer flask, rinsed with sterile water 10 times, placed on sterile filter paper, air-dried, and then transferred to N6-DS medium (N6D solid medium plus 300 mg / L timentin and 50 mg / L hygromycin) and illuminated at 28°C for 14 days.

[0054] (5) The newly grown resistant callus in (4) was transferred to RE differentiation medium (NH4NO3 1.65 g / L, KNO3 1.9 g / L, CaCl2·2H2O 0.44 g / L, MgSO4·7H2O 0.37 g / L, KH2PO4 0.17 g / L, MnSO4·4H2O 0.223 g / L, ZnSO4·7H2O 8.6 mg / L, CuSO4·5H2O 0.025 mg / L, CoCl2·6H2O 0.025 mg / L, KI 0.83 mg / L, H3BO3 6.2 mg / L, NaMoO4·2H2O 0.25 mg / L, Na2·EDTA·2H2O 0. 37.3mg / L, inositol 0.1g / L, glycine 2mg / L, VB30.5mg / L, VB60.5mg / L, VB10.1mg / L, sucrose 30g / L, kinetin 2mg / L, naphthaleneacetic acid 0.2mg / L, agar 7g, pH adjusted to 5.8), light yellow callus will have green spots, after the green spots differentiate into green seedlings, transfer to HF rooting medium (based on RE differentiation medium, kinetin and naphthaleneacetic acid are removed, and the rest are the same), cultured at 32℃ for one week. After the seedlings grow to 10cm in height, they are hardened and transferred to the field, and transgenic positive plants are obtained after detection.

[0055] ①PCR positive test

[0056] Extract leaf DNA of OsSCL25 overexpression lines obtained by rice genetic transformation (Lv Yaci. Research Progress on Plant DNA Extraction Methods [J]. Examination Weekly, 2011, (57): 176-177.), design the following primers, and perform PCR amplification using genomic DNA as a template. Primer F4 sequence is a sequence located on the pUN1301 vector, and Primer R4 is a sequence of the OsSCL25 gene CDS (Primer F4: 5'-TTTTTAGCCCTGCCTTCATACG-3' (as shown in SEQ ID NO.7); Primer R4: 5'-CCTGCCCGTCCATGTAGTAT-3' (as shown in SEQ ID NO.8)). After agarose gel electrophoresis, observe the size of the target band, as shown in FIG. Figure 2 The plants shown in A are consistent with the positive control and the plants without the target band are negative. The positive overexpression lines are named OE#1 and OE#2.

[0057] ② Detection of OsSCL25 gene expression

[0058] Use the information provided by Yisheng Biotechnology Co., Ltd. PCR SYBR Green Master Mix (Cat. No.: 11200ES08) was used to detect the transcription level of OsSCL25 in the wild type and overexpression lines OE#1 and OE#2. OsActin (Gao R, Lu Y, Wu N, Liu H, Jin X. Comprehensive study of serine / arginine-rich (SR) gene family in rice: characterization, evolution and expression analysis. Peer J. 2023 Oct 13; 11: e16193. doi: 10.7717 / peerj.16193. PMID: 37849832; PMCID: PMC10578304.) was used as the internal reference gene, and the primers for detecting the expression of the OsSCL25 gene were Primer F6 and Primer R6 (Primer F6: 5'-ATGGGGAGAGGCTACAG TTAC-3' (as shown in SEQ ID NO. 9); Primer R6: 5'-GGGAGATCTCTACCACGTCC-3' (as shown in SEQ ID NO. 10)).

[0059] The relative expression results of OsSCL25 gene in OsSCL25 overexpression lines are shown in Figure 2 B and Table 2. The results showed that the expression level of OsSCL25 gene in OE#1 and OE#2 was more than 100 times that of wild-type Nipponbare.

[0060] Table 2 OsSCL25 gene expression data of overexpression lines

[0061] WT OE#1 OE#2 0.763129604 12.06982901 13.7053443 0.683020128 12.23831755 12.7875384 0.641712949 11.90366011 12.87648276

[0062] Example 3 Construction and molecular identification of rice OsSCL25 gene mutant transgenic plants

[0063] (1) Construction and transformation of gene editing vectors

[0064] Target design: Complete the design of two editing targets of the OsSCL25 gene on the CRISPER-GE (http: / / skl.scau.edu.cn / ) website.

[0065] Target 1 sequence: GGAATCTTCGTCGGGACTGC (as shown in SEQ ID NO. 11);

[0066] The sequence of target 2: GGAATCTTCGTCGGGACTGC (as shown in SEQ ID NO.12).

[0067] Vector construction: Cas9Pubi-H vector (Ma Convenient,High-EfficiencyMultiplex Genome Editing in Monocot and Dicot Plants.Mol Plant.2015Aug;8(8):1274-84.doi:10.1016 / j.molp.2015.04.007.Epub 2015Apr 24.PMID:25917172.). The vector was constructed according to the method reported by the team of Academician Liu Yaoguang (Ma X, Zhang Q, Zhu Q, et al. A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants [J]. Mol Plant, 2015, 8 (8): 1274-1284.), such as Figure 3 As shown, gRNA is connected to the vector to obtain a gene editing vector.

[0068] The obtained gene editing vector was transformed into Agrobacterium EHA105 according to the method of Agrobacterium transformation in Example 2, and the recombinant Agrobacterium with correct sequencing results was saved. According to the method of obtaining transgenic rice strains in Example 2, the gene editing vector was transformed into Nipponbare rice, and transgenic plants were obtained by rice tissue culture.

[0069] (2) Molecular identification of rice OsSCL25 gene mutant transgenic plants

[0070] The leaf DNA of the gene-edited plants obtained after tissue culture was extracted, and specific primers GE-SISVD-F: 5'-TATCCCTCACCAGATCCACC-3' (as shown in SEQ ID NO.13); and GE-SISVD-R: 5'-AGCACCCTTGTCAACAACCT-3' (as shown in SEQ ID NO.14) were designed, and PCR amplification was performed to detect the gene-edited positive plants ( Figure 4 The PCR products were sent to Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results identified two homozygous plants with mutations in the OsSCL25 gene, named scl25#1 and scl25#2. The editing sites of scl25#1 and scl25#2 are shown in Figure 2. Figure 4 As shown in B. In the scl25#1 strain, a nucleotide T was inserted in the first exon of the OsSCL25 gene, and a nucleotide A was inserted in the second exon; in the scl25#2 strain, a nucleotide sequence TAAATTCCTGACTAAATATTGACTAA (as shown in SEQ ID NO.15) was inserted in the first exon of the OsSCL25 gene, and a nucleotide sequence GCCATTCGGACAATT (as shown in SEQ ID NO.16) was deleted in the second exon, resulting in a frameshift mutation.

[0071] Example 4 Identification of salt tolerance of OsSCL25 gene mutants and overexpression strains

[0072] The wild type, homozygous OsSCL25 gene-edited line and overexpression line were subjected to salt treatment experiments at the seedling stage to observe their phenotypes and measure physiological and biochemical indices.

[0073] (1) Identification of salt-tolerance phenotypes of OsSCL25 mutants and overexpression strains

[0074] Wild-type, OsSCL25 gene-edited, and overexpression rice seeds that were plump and uniform and had no obvious lesions on the appearance were selected, and the germination and seed soaking method, rice seedling culture method, and salt treatment method in Example 1 were referred to. The seeds were cultured in a rice culture box at 28° C. for two weeks, cultured with clean water in the first week, cultured with 1 / 2 concentration rice nutrient solution from the second week, and cultured with complete rice nutrient solution in the control group from the third week, and cultured with the complete rice nutrient solution containing NaCl in Example 1 in the treatment group, and a salt stress experiment was performed.

[0075] Reference Example 1: The wild-type, OsSCL25 gene-edited, and overexpression seedlings with consistent growth were treated with a nutrient solution with a concentration of 150 mM NaCl, and the salt-containing nutrient solution was replaced every three days for 7 days. The complete rice nutrient solution was then used to restore the treatment for 14 days, and the survival rate was recorded, and the fresh weight and dry weight were recorded.

[0076] After 7 days of salt treatment, it was found that compared with the wild type, the mutant scl25 had more withered leaves and grew worse than the wild type. After 14 days of recovery from normal treatment, the survival rate of the wild type was close to 60%, which was significantly higher than that of scl25 ( Figure 5 A and B and Table 3); before salt treatment, there was no significant difference in fresh weight and dry weight among the wild type, mutant, and overexpression lines. After salt treatment, the fresh weight and dry weight of scl25 were significantly lower than those of the wild type ( Figure 5 C and D and Table 4). Compared with the wild type, the OsSCL25 overexpression line grew better, with significantly fewer wilted leaves than the wild type and mutant. After 14 days of recovery from normal treatment, the survival rate reached 70%, which was slightly higher than that of the wild type and 3 times that of scl25 ( Figure 5 These results suggest that OsSCL25 plays a positive role in regulating salt tolerance in rice seedlings.

[0077] Table 3 Survival rate data of wild type, OsSCL25 gene editing line and overexpression line

[0078] WT scl25#1 scl25#2 OE#1 OE#2 50％ 14％ 14％ 64％ 71％ 57％ 21％ 21％ 71％ 57％ 57％ 28％ 35％ 71％ 71％

[0079] Table 4 Determination data of fresh weight and dry weight of each strain

[0080]

[0081] (2) Analysis of physiological indicators of salt stress in OsSCL25 gene mutants and overexpression strains

[0082] In order to further verify that OsSCL25 positively regulates the salt tolerance of rice seedlings, leaf samples of the control group in step (1) of this example and the wild type, OsSCL25 gene mutant and overexpression line plants that did not recover after treatment with 150 mM NaCl were taken for NBT and DAB (Meng F, Feng N, Zheng D, Liu M, Zhou H, Zhang R, Huang X, Huang A. Exogenous Hemin enhances the antioxidant defense system of rice by regulating the AsA-GSH cycle under NaCl stress. Peer J. 2024 Apr 19; 12: e17219. doi: 10.7717 / peerj.17219. PMID: 38650645; PMCID: PMC11034499.) staining to observe the accumulation of reactive oxygen species in different strains after salt treatment. At the same time, chlorophyll content, soluble sugar content, proline content, SOD enzyme activity, POD enzyme activity, CAT enzyme activity, MDA content, and hydrogen peroxide content were measured (Luo C, Akhtar M, Min W, Alam Y, Ma T, Shi Y, She Y, Lu X. The suppressed expression of a stress responsive gene 'OsDSR2' enhances rice tolerance in drought and salt stress. J Plant Physiol. 2023 Mar; 282: 153927. doi: 10.1016 / j.jplph.2023.153927. Epub 2023 Jan 19. PMID: 36682133.).

[0083] Before salt stress treatment, there was no significant difference in the leaves of wild type, mutant, and overexpression line after NBT and DAB staining. After salt stress, more blue-black spots and brown spots were attached to the surface of mutant leaves. After NBT staining, the leaves of mutant scl25#1 showed a larger area of ​​blue-black spots ( Figure 6 Middle A), after DAB staining, the leaves of the mutant scl25#1 also showed more brown spots, while the leaves of the overexpression line showed fewer spots after salt treatment ( Figure 6 Middle B), there is no significant difference between the overexpression line and the wild type, indicating that the mutant leaves accumulate more hydrogen peroxide and superoxide anions than the wild type and overexpression lines. The results showed that compared with the wild type, the leaves of the OsSCL25 mutant accumulated more ROS under salt stress, while the overexpression line was the opposite.

[0084] The most important free radical scavenger in plants is SOD, and its activity determines whether the plant's metabolism is balanced. After salt stress, the SOD activity of the mutant scl25 was about 20% higher than that of the wild type, and there was no significant difference in the SOD activity of the overexpression line with that of the wild type ( Figure 7 A and Table 5), NBT staining showed that the mutant scl25 accumulated more superoxide anions, and it can be inferred that the mutant accumulated more SOD activity in order to adapt to salt stress; POD is an important peroxidase that catalyzes reactions with peroxide as a substrate, and has the function of hydrolyzing hydrogen peroxide, thereby protecting cells. After salt stress, the POD activity of the mutant scl25 was about 10% higher than that of the wild type ( Figure 7 B and Table 5). Through DAB staining, we can know that the mutant scl25 accumulates more hydrogen peroxide. It can be inferred that the mutant generates more POD in order to remove the excessive accumulation of hydrogen peroxide caused by salt stress. CAT is the best antioxidant enzyme in plants. It decomposes excess hydrogen peroxide into water and oxygen, protects plants from oxidative stress, and produces less toxic hydroxyl free radicals. After salt stress, the CAT activity of the mutant scl25 is about 10% higher than that of the wild type, and the overexpression line is significantly lower than the wild type ( Figure 7 E and Table 5); the appearance of MDA indicates that the level of free radicals in cells is too high, and its excessive accumulation can cause damage to plant cell membranes, affect cell physiological functions, and thus lead to cell senescence and death. After salt stress, the MDA content of mutant scl25 was significantly higher than that of wild-type and overexpression plants, and the MDA content of mutant scl25 was nearly twice that of overexpression plants ( Figure 7 F and Table 6), indicating that the degree of tissue peroxidation damage in the mutant scl25 was higher than that in the wild type and the overexpression line, and it accumulated more cytotoxicity, while there was no significant difference between the overexpression line and the wild type; hydrogen peroxide is one of the products of aerobic metabolism in plants, but at high concentrations it will inhibit plant growth, cause cellular oxidative damage, and lead to cell death. Compared with the wild type, the mutant scl25 accumulated more hydrogen peroxide after salt treatment, which was about 33% higher than the wild type, while the hydrogen peroxide content of the overexpression line was slightly lower than that of the wild type ( Figure 7 C and Table 6), indicating that the mutant scl25 accumulated more reactive oxygen species, and the overexpression strain grew better under salt damage conditions than the mutant scl25.

[0085] Chlorophyll content can indicate the efficiency of photosynthesis in leaves. Abiotic stress can inhibit photosynthesis in plants and thus affect chlorophyll content. Chlorophyll also plays an important role in plant stress resistance. There was no significant difference in chlorophyll content among the wild type, OsSCL25 mutant, and overexpression line under normal treatment. After salt stress, the chlorophyll content of the mutant scl25 was significantly lower than that of the wild type, while the chlorophyll content of the OsSCL25 overexpression line was significantly higher than that of the wild type ( Figure 7 D and Table 5), the chlorophyll content of the overexpression line was nearly twice that of the mutant, further indicating that the overexpression line was more salt tolerant than the mutant scl25. Proline accumulation is an important metabolic adaptive mechanism of plants under biotic and abiotic stresses. Its main function is to act as an osmotic regulating substance to maintain the osmotic balance inside and outside the cell and enhance plant stress resistance. When plants encounter biotic and abiotic stresses, they promote the formation of proline metabolic adaptive mechanisms, thereby osmotic regulating substances to maintain the osmotic balance inside and outside the cell and enhance plant stress resistance. There was no significant difference in the proline content of the wild type, OsSCL25 mutant, and overexpression line under normal treatment. After salt stress, the proline content of the OsSCL25 overexpression line was significantly higher than that of the wild type ( Figure 7 G and Table 6), the proline content of the overexpression line was nearly twice that of the mutant, and the proline content of the mutant scl25 was significantly lower than that of the wild type, indicating that the overexpression line grew stronger than the mutant under salt stress because of its stronger free radical scavenging ability. Soluble sugar is not only the source of plant growth and development, but also provides a large amount of energy in the process of regulating ion absorption and transport in order to adapt to biotic and abiotic stresses, and plays an important role in regulating osmotic pressure. After salt stress, the increase in soluble sugar content of the mutant scl25 was lower than that of the wild type and the overexpression line, and the soluble sugar content of the overexpression line was slightly higher than that of the wild type and significantly higher than that of the mutant ( Figure 7 H and Table 6), indicating that the overexpression line has stronger balance of reactive oxygen species and antioxidant capacity in plants than the wild type.

[0086] Table 5 Superoxide dismutase activity (SOD), peroxidase activity (POD), catalase activity (CAT) and chlorophyll content test results

[0087]

[0088] Table 6 Test results of hydrogen peroxide content, malondialdehyde content (MDA), proline content and soluble sugar content

[0089]

[0090]

[0091]

[0092] These results suggest that the antioxidant capacity of OsSCL25 gene mutant plants under salt stress is reduced, while overexpressing the OsSCL25 gene in the Nipponbare rice variety can improve the salt tolerance of rice.

[0093] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of OsSCL25 gene in regulating rice salt stress tolerance, characterized in that: The nucleotide sequence of the OsSCL25 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The regulation is to improve the salt tolerance of rice after overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene in the target rice genome.

3. A method for improving the salt tolerance of rice, characterized in that: The method comprises the following steps: overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene in the target rice genome; The nucleotide sequence of the OsSCL25 gene is shown in SEQ ID NO.

1.

4. The method according to claim 3, characterized in that The CDS sequence of the OsSCL25 gene is shown in SEQ ID NO.

2.

5. The method according to claim 3, characterized in that: The overexpression method is to transform the recombinant vector into rice to obtain rice with improved salt tolerance; The recombinant vector comprises the OsSCL25 gene or the CDS sequence of the OsSCL25 gene.

6. The method according to claim 5, characterized in that The transformation method includes Agrobacterium transformation.

7. A recombinant vector for overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene, characterized in that: The nucleotide sequence of the OsSCL25 gene is shown in SEQ ID NO.

1.

8. The recombinant vector according to claim 7, characterized in that The basic framework of the recombinant vector includes the pUN1301 vector.

9. A method for creating salt-tolerant rice germplasm, characterized in that: The method comprises the following steps: overexpressing the OsSCL25 gene or the CDS sequence of the OsSCL25 gene in the target rice genome.

10. The method according to claim 9, characterized in that The rice includes Nipponbare.

Images