Application of inhibiting proliferation and growth of cancer cells by expressing and connecting H1.4 C terminal of histone H1 family member

Abstract

The invention belongs to the field of gene engineering, and particularly discloses an application for inhibiting proliferation and growth of cancer cells by expressing and connecting an H1.4 C terminal of a histone H1 family member, especially for lung cancer and bladder cancer cells. In the invention, a specific nucleic acid fragment is designed to encode the histone fragment, and a plasmid containing the nucleic acid fragment is constructed. Furthermore, the plasmid is packaged by utilizing a lentiviral vector technology, so that a target gene is efficiently introduced into a cell, and a cell model for expressing the terminal fragment of the histone H1.4 C is established. Meanwhile, the invention provides a specific primer sequence for constructing the cell model.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically discloses an application of inhibiting the proliferation and growth of cancer cells by expressing the C-terminus of a linker histone H1 family member H1.4. Background Art

[0002] According to the latest report data from the International Agency for Research on Cancer (IARC), there will be 20 million new cancer cases in 2022, and 9.7 million cancer deaths. The number of new cancer cases is expected to increase to 35 million in 2050. Cancer has become a major public health problem in the world. With the continuous increase in cancer cases, the research on new cancer treatment options has become a research hotspot worldwide.

[0003] Five different types of histones are involved in the correct folding of eukaryotic DNA chromatin, namely four histones H2 A, H2 B, H3 and H4 and one linker histone H1. The H1 histone family contains many types of variants or subtypes. Linker histone H1 is a smaller protein (~200aa) with a three-domain structure consisting of a short N-terminal tail (~20-35aa), a central globular domain (~70aa) and a long, extremely basic C-terminal tail (~100aa). The C-terminal domain (CTD) adopts a widely folded structure when interacting with DNA. Linker histone H1.4 (also known as HIST1H1E, H1F4 and H1e, etc.) belongs to the H1 histone family and is located in the histone gene cluster region on human chromosome 6 with the H1.1-H1.5 genes. Currently, many studies have shown that histone H1.4 is associated with human clinical diseases.

[0004] The C-terminal domain of linker histone H1 plays an important role in chromatin condensation. Studies have shown that de novo frameshift mutations in the CTD coding region of H1.4 are associated with Rahman syndrome, but there are few studies on the role of the C-terminal domain of H1.4 in diseases. Summary of the invention

[0005] In view of the above problems, the present invention discloses an application of inhibiting the proliferation and growth of cancer cells by expressing the C-terminus of the linker histone H1 family member H1.4.

[0006] The present invention includes the following technical solutions:

[0007] The present invention detects the growth and proliferation of cancer cells by transferring fragmented histone H1.4, and discloses for the first time the application of the histone H1.4 C-terminal fragment in inhibiting the proliferation and growth of cancer cells.

[0008] The invention also discloses a nucleic acid fragment, which contains a nucleic acid sequence encoding the histone H1.4 C-terminal fragment.

[0009] Preferably, the amino acid sequence of the histone H1.4 C-terminal fragment is as shown in SEQ ID NO.1.

[0010] Preferably, the above nucleic acid fragment is shown in the sequence of SEQ ID NO.2.

[0011] The present invention also discloses a primer sequence for constructing a cell model expressing the C-terminus of the linker histone H1 family member H1.4. The primer sequence is shown in SEQ ID NOs. 3 and 4.

[0012] Preferably, the tumor cells described in the present invention are lung cancer cells or bladder cancer cells.

[0013] More preferably, the lung cancer cells are A549 and the bladder cancer cells are T24.

[0014] Preferably, in some embodiments, we use MTT, cell scratch assay and soft agar colony formation assay to detect the effect of the drug on the proliferation and migration ability of cancer cells.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The present invention innovatively designed and implemented a study aimed at exploring new avenues for cancer treatment. By carefully constructing a plasmid capable of expressing the C-terminal fragment of histone H1 family member H1.4 and using an efficient lentiviral vector system, we successfully transfected this key gene fragment into lung cancer cells (especially A549 cell line) and bladder cancer cells (especially T24 cell line). In order to verify the transfection effect, we used Western Blot experimental technology to detect the expression of the target protein and confirmed the successful construction of the cell model, laying a solid foundation for subsequent research.

[0017] On this basis, we further explored the effect of expressing the C-terminus of linker histone H1.4 on cell growth characteristics. Through the MTT cell proliferation experiment, we accurately evaluated the changes in cell proliferation ability after transfection; at the same time, using technical means such as cell scratch experiments, we further observed the changes in cell migration ability. The changes in cell anchorage-independent growth were detected by soft agar colony formation experiments. The results of these functional experiments revealed the important role of the histone H1.4 C-terminal fragment in regulating tumor cell growth, proliferation and migration. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the plasmid map for expressing the C-terminus of the linker histone H1 family member H1.4 in the present invention;

[0019] Figure 2 This is the gel electrophoresis result after H1.4 C plasmid was double digested with BamHI and EcoRI;

[0020] Figure 3 Schematic diagram of the construction of lung cancer cell lines and bladder cancer cell lines expressing the C-terminus of the linker histone H1 family member H1.4 in the present invention: Western Blot was used to examine the expression of the histone H1.4 C fragment in A549 cells and T24 cells;

[0021] Figure 4 Schematic diagram of the experimental results of detecting the effect of expressing the C-terminus of the linker histone H1 family member H1.4 on the proliferation ability of cancer cells in the present invention (Figure A is a statistical graph of the MTT experimental results performed in A549 empty cells and A549 cells transferred with the histone H1.4 C-terminus; Figure B is a statistical graph of the MTT experimental results performed in T24 empty cells and T24 cells transferred with the histone H1.4 C-terminus);

[0022] Figure 5 Schematic diagram of the experimental results of detecting the effect of expressing the C-terminus of the linker histone H1 family member H1.4 on the movement and migration ability of cancer cells in the present invention, (Figure A is a cell scratch test result diagram of A549 empty cells and A549 cells transferred with the histone H1.4 C-terminus; Figure B is a cell scratch test data statistical diagram of A549 empty cells and A549 cells transferred with the histone H1.4 C-terminus; Figure C is a cell scratch test result diagram of T24 empty cells and T24 cells transferred with the histone H1.4 C-terminus; Figure D is a cell scratch test data statistical diagram of T24 empty cells and T24 cells transferred with the histone H1.4 C-terminus);

[0023] Figure 6 Schematic diagram of the experimental results of detecting the effect of expressing the C-terminus of the linker histone H1 family member H1.4 on the anchorage-independent growth of cancer cells in the present invention: Figure A is the experimental results of the soft agar colony formation experiment in A549 empty cells and A549 cells transferred with the histone H1.4 C-terminus, and Figure B is the experimental data statistical graph of the anchorage-independent growth of A549 empty cells and A549 cells transferred with the histone H1.4 C-terminus. DETAILED DESCRIPTION

[0024] The present invention is further described below in conjunction with the accompanying drawings and embodiments, and the contents of the embodiments are not intended to limit the protection scope of the present invention.

[0025] The technical solution provided in the embodiment of the present invention is an application of inhibiting the proliferation and growth of cancer cells by expressing the C-terminus of the linker histone H1 family member H1.4, comprising the following steps:

[0026] Construction of the C fragment plasmid of S1 histone H1.4;

[0027] S2. Construction of cell model of histone H1.4 C fragment plasmid;

[0028] S3. Detect the effect of histone H1.4 C fragment on the proliferation ability of cancer cells;

[0029] S4. Detect the effect of the C fragment of histone H1.4 on the movement and migration ability of cancer cells;

[0030] S5. Detect the effect of histone H1.4 C fragment on the anchorage-independent growth of cancer cells;

[0031] Example 1

[0032] A plasmid was constructed to express the C-terminal fragment of the linker histone H1 family member H1.4.

[0033] The amino acid sequence of the histone H1.4 C-terminal fragment is shown in SEQ ID NO.1 as follows:

[0034] NKKAASGEAKPKAKKAGAAKAKKPAGAAKPKKKATGAAT PKKSAKKTPKKAKKPAAAAGAKK-AKSPKKAKAAKPKKAPKSPA KAKAVKPKAAKPKTAKPKAAAKPKKAAAKKK.

[0035] The base sequence of the C-terminal fragment of histone H1.4 is shown in SEQ ID NO.2 as follows:

[0036] AACAAGAAGGCGGCCTCTGGGAAGCCAAGCCTAAGGCTAAAAAGGCAGGCGCGGCCAAGGCCAAGAAGCCAGCAGGAGCGGCGAAGAAGCCCAAGAAGGCGACGGGGGGCGGCCACCCCAAGAAGAGCGCCAAGAAGACCCCAAAGAAGGCGAAGAAGCCGGCTGCA GCTGCTGGAGCCAAAAAAGCGAAAAGCCCGAAAAAGGCGAAAGCAGCCAAGCCAAAAAAGGCGCCCAAGAGCCCAGCGAAGGCCAAAGCAGTTAAAACCCAAGGCGGCTAAACCAAAGACCGCCAAGCCCAAGGCAGCCAAGCCAAAGAAGGCGGCAGCCAAGAAAAAG.

[0037] Add specific restriction sites and protective base sequences to both ends of F and R, and add Myc tag to the F end to facilitate subsequent detection and identification. The primers are designed according to the primer design rules as follows

[0038] MYC-H1.4C-EcoRI-F:AGAATTCATGGAGCAGAAACTCATCTCTGAAGAGGATCTGAACAAGAAGGCGGCCTCTG=SEQ ID NO.3.

[0039] H1.4C-BamHI-R:

[0040] AGGATCCCTACTTTTTTCTTGGCTGCCG=SEQ ID NO.4.

[0041] The designed primers were sent to the company for synthesis. The obtained primers were used for PCR reaction to obtain the target fragment. The target fragment was connected to the pCDH-CMV-MCS-EF1-Puro vector. The connected product was plated and singles were selected to extract the H1.4 C-terminal plasmid. The plasmid map is shown in Figure 1 , double enzyme digestion identification of plasmid (such as Figure 2 The plasmid was then sent to a biological company for sequencing to ensure the correctness of the plasmid.

[0042] Example 2

[0043] A cell model expressing the C-terminal fragment of H1.4, a member of the linker histone H1 family, was constructed.

[0044] The day before, add 8 × 10 5293FT cells were cultured for 12 hours until the cell density reached 70%-80% and the cells were in good condition. Lentivirus was prepared. PEI transfection reagent was used. According to the instructions, 125ul PEI Buffer and 3ug target plasmid and 1ug auxiliary plasmids PLP1, PLP2, and VSVG were added to the sterilized EP tube. Take a new EP tube and add 125ul PEI Buffer to it. After mixing, let it stand for 15 minutes. After 48 hours, the virus was collected and filtered with a 0.45μm filter membrane. The counted A549 or T24 (1×10 5 The cells were cultured in 6-well plates and Polybrene (8 μg / mL) was added. After returning to the incubator and culturing for 48 h, puromycin was added to screen out the cell lines that were successfully stably transfected.

[0045] Example 3

[0046] Detect the expression of the C-terminal fragment of H1.4, a member of the linker histone H1 family, in cells.

[0047] When the A549 or T24 cells required for the experiment reach 80-90%, remove the cells, place them on ice, discard the culture medium, wash twice with PBS, add RIPA lysis buffer, let stand for 5 minutes, collect the cells with a cell scraper, lyse for 30 minutes, pre-cool the high-speed centrifuge in advance, centrifuge at 4°C, 12000rpm, centrifuge for 20 minutes, take the supernatant and transfer it to a new EP tube. Determine the protein concentration: add 10μL protein sample and 100μL BCA colorimetric solution to each well of the 96-well plate, and repeat 3 wells for each protein sample. At the same time, prepare standard protein solutions with different concentration gradients to make a standard curve. Incubate at 37°C for 30 minutes, measure the OD570 absorbance value, and calculate the concentration of each protein sample based on the standard curve. The remaining protein sample is diluted with 5× Loading Buffer and heated at 100°C for 5 minutes. The obtained samples were subjected to SDS-polyacrylamide gel electrophoresis according to the measured protein concentration, and then transferred to the membrane at a constant current of 300mA for 2 hours. After the transfer, they were blocked with 5% skim milk for 1.5 hours, and the primary antibody was diluted according to the antibody instructions, and incubated at 4°C overnight. The PVDF membrane was washed with TBST solution 3 times, each time on a shaking table for 10 minutes. The secondary antibody was diluted according to the antibody instructions, and incubated at room temperature for 2 hours. The PVDF membrane was washed with TBST solution 3 times. Then it was exposed using a developer. Figure 3 The results showed that the MYC tag on the histone H1.4 C fragment was successfully detected and the cell model was successfully constructed.

[0048] Example 4

[0049] Effect of expressing the C-terminal fragment of linker histone H1 family member H1.4 on cell proliferation ability.

[0050] When the A549 or T24 cells required for the experiment reach 80%, perform cell subculture, obtain cell suspension, and count the cells at 1×10 per well. 3 The density of cells / 100μL was set on a 96-well plate. To ensure the accuracy and reliability of the experimental results, 6 parallel wells were set for each cell type, and this setting was repeated on 6 plates. After that, one plate was taken out every day, 10μL of MTT solution was added, and incubated in an incubator for 4 hours to ensure that MTT and cells fully interacted. After 4h, the 96-well plate was taken out, the liquid in the well was discarded, 150ul DMSO was added, and incubated in a light-proof shaker for 30min. The absorbance of OD450 was measured with an enzyme reader. After that, each plate was operated as above at the same time. The data obtained were sorted and analyzed and processed on the software. Figure 4 The results showed that the proliferation rate of cells transfected with the C fragment of histone H1.4 lentiviral vector was significantly reduced compared with that of cells in the empty vector control group; from this we concluded that the introduction of the C fragment of histone H1.4 would reduce the proliferation ability of cells.

[0051] Example 5

[0052] Effect of expressing the C-terminal fragment of the linker histone H1 family member H1.4 on cell migration ability.

[0053] When the density of A549 or T24 cells in the 6-well plate grows to about 90%, use a 10μL pipette tip to draw a "+" in the culture dish, and repeat 3 wells for each cell type. Discard the old culture medium in the well, wash off the detached and floating cells with PBS, and finally add 3mL of culture medium. Use a microscope to take pictures. In order to observe the process of cell migration and healing, it is required to repeat the picture at the same position of "+" every 6 hours to ensure the consistency and comparability of the data. Arrange all the photos and use software to analyze the degree of cell healing. Results are shown in Figure 5 The results showed that the number of cell migration in cells into which the C fragment of histone H1.4 was transferred was significantly reduced by about 20% compared with the control group. This result indicates that the transfer of the C fragment of histone H1.4 will reduce the migration ability of cells.

[0054] Example 6

[0055] Effect of expressing the C-terminus of the linker histone H1 family member H1.4 on anchorage-independent cell growth.

[0056] Aliquot 1.2% and 0.7% agarose and 2XDMEM, and preheat them in a water bath to prevent them from solidifying. Quickly mix 1.2% agarose with an equal volume of 2XDMEM, add 1.5 ml to each well of a six-well plate, and wait for them to completely solidify.

[0057] The experimental cells A549 were digested and blown evenly, and the cells were counted. The cells were added to 2XDMEM and quickly mixed with an equal volume of 0.7% agarose, and added to a six-well plate that had been solidified before, adding 2 ml to each well, and after it solidified, 1 ml of normal cell culture medium was added.

[0058] MTT: 20ul of the cells used in the above experiment were added to a 96-well plate, repeated 3 times in parallel, and taken out after 4 hours of incubation. 10μL of MTT solution was added and incubated in an incubator for 4 hours to ensure that MTT and cells fully interacted. After 4 hours, the 96-well plate was taken out, the liquid in the wells was discarded, and 150ul of DMSO was added and incubated in a light-proof shaker for 30 minutes. The absorbance of OD450 was measured with an enzyme-labeled instrument.

[0059] During the culture period, replace the top culture medium with fresh one every 3-4 days. When the white monoclonal cell clusters can be observed with the naked eye, discard the old culture medium, add 25ul of 20mg / ul INT, culture overnight, and take photos and record the next day. Figure 6 , showing that the introduction of histone H1.4 C fragment into cells would inhibit the cells' ability to grow independently of anchorage.

[0060] As can be seen from the above examples, the present invention constructs a plasmid expressing the C-terminal fragment of the linker histone H1 family member H1.4, prepares a lentivirus, transfects it into lung cancer cells and bladder cancer cells, and detects the transfection effect of the plasmid by Western Blot experiments to determine that the cell model is successfully constructed. In order to explore the effect of expressing the C-terminal of the linker histone H1 family member H1.4 on cell growth, functional experiments such as MTT, cell scratch, and soft agar colony formation experiments are used to detect the proliferation and migration abilities of cells. The present invention will provide new ideas for future cancer treatment.

[0061] The above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is impossible to list all the embodiments here. Any obvious changes or modifications derived from the technical solution of the present invention are still within the scope of protection of the present invention.

Claims

1. An application of inhibiting the proliferation and growth of cancer cells by expressing the C-terminus of the linker histone H1 family member H1.

4.

2. The use according to claim 1, characterized in that: The amino acid sequence of the histone H1.4 C-terminal fragment is shown in SEQ ID NO.

1.

3. A nucleic acid fragment, characterized in that Contains a nucleic acid sequence encoding the histone H1.4 C-terminal fragment as claimed in claim 2.

4. The nucleic acid fragment according to claim 3, characterized in that The nucleic acid sequence is shown as SEQ ID NO.

2.

5. A primer sequence for constructing a cell model expressing the C-terminus of the linker histone H1 family member H1.4, characterized in that: The primer sequences are shown in SEQ ID NOs. 3 and 4.

6. The use according to claim 1, characterized in that: The tumor cells are lung cancer cells or bladder cancer cells.

7. The use according to claim 6, characterized in that: The lung cancer cells are A549 and the bladder cancer cells are T24.

8. The use according to claim 1, characterized in that: The application is to inhibit the proliferation and growth of cancer cells by expressing the C-terminus of the linker histone H1 family member H1.4.

Images