NOTCH2NLC gene GGC repetition number detection method, kit and application

Abstract

The invention relates to the field of molecular biology diagnosis, in particular to a PCR amplification method of a NOTCH2NLC gene 5'untranslated region GGC repetition number and application of the PCR amplification method in preparation of a neuron intracellular inclusion body disease related gene nucleic acid detection kit. According to the PCR amplification detection method, at least four primers are used for amplifying a CGG repetitive sequence in a non-transcriptional region at the 5'end of the NOTCH2NLC gene. Meanwhile, PCR products are analyzed through PCR amplification and capillary electrophoresis, accurate quantitative analysis can be conducted on high-GGC repetitive sequences, the method is simple, rapid and accurate, the variation situation of the CGG repetition number can be detected only through one-time PCR experiment, a result can be obtained within 5 hours from a DNA sample, and the detection technology is simple in process and easy to achieve standardization.

Description

Technical Field

[0001] The present invention relates to the field of molecular biological diagnosis, and in particular to a method, a kit and an application for detecting the GGC repeat number of a NOTCH2NLC gene. Background Art

[0002] Neuronal intranuclear inclusion disease (NIID) is a rare, chronic progressive neurodegenerative disease characterized by eosinophilic hyaline inclusions in the central and peripheral nervous systems and visceral organs. The disease has a large clinical heterogeneity and can present with symptoms of damage to the cortex, pyramidal tract, extrapyramidal system, cerebellum, peripheral nerves, and autonomic nerves, mainly manifested as cognitive impairment, limb weakness, paresthesia, autonomic dysfunction, ataxia, Parkinson's symptoms, epilepsy, paroxysmal impaired consciousness, stroke-like attacks, encephalitis-like attacks, etc.

[0003] Since the clinical manifestations of NIID are diverse, the diagnosis of NIID is very challenging. Before the pathogenic gene of NIID is discovered, in order to diagnose whether the patient has the disease, in addition to combining skin biopsy and head imaging tests, genetic testing will be performed to exclude the possibility of other genetic diseases, such as Huntington's disease, Alzheimer's disease, multiple system atrophy, spinocerebellar ataxia, fragile X chromosome syndrome, etc. Although the first case of NIID was diagnosed in 1968, it was not until 2019 that its pathogenic gene was finally determined, confirming that the GGC repeat expansion of the NOTCH2NLC gene is related to the onset of NIID. The NOTCH2NLC gene is located at the 1q21.1 locus of human chromosome 1 and encodes a secreted polypeptide with a structure similar to the N segment of the NOTHC2 gene, which is the result of partial duplication of NOTCH2. There are multiple homologous genes of the NOTCH2NLC gene: NOTCH2NLA, NOTCH2NLB and NOTCH2NLR, and the sequence similarity is greater than 99% within the 100kb genomic sequence interval. The (GGC)9(GGA)2(GGC)2 repeat expansion mutation in the 5' untranslated region (UTR) of the NOTCH2NLC gene is the cause of NIID disease. The GGC repeat count of the NOTCH2NLC gene in normal adults does not exceed 40 times, and the repeat count exceeding 60 times is pathogenic. The GGC repeat count of NIID patients with tremor as the main clinical phenotype is closer to 60 times; the GGC repeat count of patients with Parkinson's syndrome as the main manifestation is about 80 times; the GGC repeat count of patients with cognitive impairment as the main manifestation is about 120 times, and the GGC repeat count of patients with muscle weakness as the main manifestation reaches 200 times. At the same time, the interruption sequence of GAA or AGC in the GGC repeat may advance the age of onset, and the repeat number and interruption sequence may have different clinical symptoms.

[0004] At present, most of the literature on NOTCH2NLC gene uses third-generation sequencing and repeat-primed PCR (repeatprimed PCR, RP PCR) to confirm the number of GGC repeats. Third-generation sequencing is a single-molecule nanopore sequencing technology that can directly read long DNA fragments and identify long repeat expansion regions in genes. Third-generation sequencing technology does not require the introduction of additional PCR amplification, so it is not affected by high GC content, but the cost is high. RP-PCR is a method for detecting the number of repeats based on PCR amplification technology. Due to the high GC ratio of the sequence, it is easy to encounter difficulties when amplifying high repeat numbers. In view of this, the relevant field needs an improved method to detect the number of GGC repeats of the NOTCH2NLC gene in a human individual in a more accurate and specific way, so as to determine whether the human individual has neuronal nuclear inclusion disease. Summary of the invention

[0005] The object of the present invention is to provide a method for detecting the number of GGC repeats in the 5' untranslated region of NOTCH2NLC gene and its application in preparing a nucleic acid detection kit for genes related to neuronal nuclear inclusion disease.

[0006] In order to achieve the above-mentioned invention object, the present invention adopts the following technical scheme: The present invention provides a PCR amplification detection primer set for the number of GGC repeats in the 5' untranslated region of NOTCH2NLC gene, comprising the following 4 primers: (1) The first primer is a primer that binds to the upstream region of the GGC repeat in the 5' untranslated region of the NOTCH2NLC gene, contains a non-human genomic sequence at the 5' end of the primer, and introduces a mismatch base at the second to last or third base at the 3' end; (2) The second primer is a primer that binds to the GGC repeat downstream region of the 5' untranslated region of the NOTCH2NLC gene, contains a non-human genome sequence at the 5' end of the primer, and introduces a mismatch base at the second to last or third base at the 3' end; (3) The third primer is a primer that binds to the GGC repeat sequence in the 5' untranslated region of the NOTCH2NLC gene, containing GGC, CGG, GCG, CCG, GCC or CGC repeat sequences and non-human genomic sequences; (4) The fourth primer contains the non-human sequence of the third primer.

[0007] The present invention also provides a PCR amplification detection primer set for the number of GGC repeats in the 5' untranslated region of NOTCH2NLC gene, comprising the following 4 primers: (1) The first primer is a primer that binds to the upstream region of the GGC repeat in the 5' untranslated region of the NOTCH2NLC gene, and introduces a mismatch base at the second to last or third base at the 3' end; (2) The second primer is a primer that binds to the downstream region of the GGC repeat in the 5' untranslated region of the NOTCH2NLC gene, and introduces a mismatch base at the second to last or third base at the 3' end; (3) The third primer is a primer that binds to the GGC repeat sequence in the 5' untranslated region of the NOTCH2NLC gene, containing GGC, CGG, GCG, CCG, GCC or CGC repeat sequences and non-human genomic sequences; (4) The fourth primer contains the non-human sequence of the third primer.

[0008] The GGC, CGG, GCG, CCG, GCC or CGC repeating sequence of the third primer contains 4 to 7 GGC, CGG, GCG, CCG, GCC or CGC sequence repeating sequences.

[0009] The final concentration of the third primer in the PCR reaction is at least 500 times lower than the final concentrations of the first primer, the second primer and the fourth primer.

[0010] Further, the first primer P1 is: 5'-GTTGCTACCCTCGTTCCGA CATTTGCGCCTGTGCTTCGCAC-3′; The second primer P2 is: 5'- GTTGCTACCCTCGTTCCGA GCCCACAGCAGAGCGGCGAAG-3'; 5' end modified with FAM fluorescence; The third primer P3 is: 5'- GTAGCCGTTGCTACCCTCGTTCCGA GGCGGCGGCGGCGGC-3′; The fourth primer P4 is: 5'- GTAGCCGTTGCTACCCTCGTTCCGA -3'; The single-lined part is the non-human genome sequence.

[0011] The above primers can also be: First primer P5: 5′-GGGAGTCGAGGCATTTGCGCCTAT-3′; Second primer P6: 5′-CAGCACAGCCAGAGCGCCAGCAGCGCCCACAGCAGAGCTGC-3′; The third primer P3: 5'- GTAGCCGTTGCTACCCTCGTTCCGA GGCGGCGGCGGCGGC-3′; The fourth primer P4: 5'- GTAGCCGTTGCTACCCTCGTTCCGA -3'; The single-lined portion is a non-human genomic sequence, the 5' end of the first primer P5 is modified with FAM fluorescence, and the 5' end of the fourth primer is modified with NED fluorescence.

[0012] The present invention also provides a kit for detecting the number of GGC repeats in the 5' untranslated region of NOTCH2NLC gene, wherein the kit comprises any one of the above primer sets.

[0013] The present invention also provides a use of any of the above-mentioned PCR amplification detection primer sets in the preparation of a neuronal intranuclear inclusion disease nucleic acid detection kit, wherein the kit comprises an amplification reagent, an NIID positive control and an NIID blank control; The amplification reagent includes NIID reaction solution, NIID primer mixture, and DNA polymerase; The NIID primer mixture comprises the primer set according to claim 6 or 7; The NIID reaction solution comprises 10X Taq Buffer, dATP, dTTP, dGTP, dCTP and an enhancer, wherein the enhancer is one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol; The NIID positive control includes plasmids with NOTCH2NLC gene GGC repeat numbers of 11, 19, 22, 26, 35, 40, 93, and 102; The NIID blank control was a Tris solution with a pH of 8.5.

[0014] Furthermore, the calculation of the number of repeats in the detection kit uses the NIID positive control to establish a standard curve with various different GGC repeat numbers and corresponding fragment sizes, and the formula is y=ax+b, where y represents the fragment length obtained by the test, and x represents the GGC repeat number. The fragment length obtained from the sample to be tested is used using the above formula to obtain the GGC repeat number result.

[0015] The beneficial effects of the present invention are: (1) The first primer and the second primer of the present invention can specifically amplify a specific full-length fragment containing GGC repeats in the 5' untranslated region of the NOTCH2NLC gene. The third primer contains a GGC, CGG, GCG, CCG, GCC or CGC sequence and a non-human genomic sequence, and the fourth primer is the non-human genomic sequence of the third primer. The third primer can adhere to various positions of the GGC repeat region and amplify amplification products of various sizes with the second primer and the fourth primer, and each amplification product differs by 3bp. The PCR efficiency decreases as the fragment length increases. Therefore, when the amplified CGG repeat region is longer, the peak value of the CGG amplification product peak will be lower, and each peak will continuously differ by 3bp to form a stutter peak. If the stutter peak extends beyond the specific NOTCH2NLC gene fragment amplified by the first primer and the second primer, it represents a larger fragment of the specific full-length fragment of the NOTCH2NLC gene GGC repeat, so the stutter peak can be used as a check for a longer specific full-length fragment.

[0016] (2) The third primer in the present invention has a significant difference in the final concentration of the reaction from the first primer, the second primer, and the fourth primer. At the same time, the GC ratio of the third primer is high, so the Tm value is the highest among all primers. It will amplify the fastest during the amplification process and produce a shadow peak amplification product. The amount of the third primer added is very small, and it will be used up first during the amplification process, so a part of the shadow peak amplification product with non-human sequence is amplified, and the fourth primer uses the shadow peak amplification product of the non-human sequence as a template to further amplify the amount of the shadow peak product. Therefore, by adjusting the difference in the Tm value and concentration of the four primers, the competitive inhibition during amplification is reduced, the amplification efficiency is increased, and the shadow peaks (stutter peaks) with high intensity of GGC repeat fragments and the high-intensity NOTCH2NLC gene GGC repeat-specific full-length fragments can be generated at the same time, which can more clearly distinguish the extended long fragment samples.

[0017] (3) There are multiple homologous genes of NOTCH2NLC gene: NOTCH2NLA, NOTCH2NLB and NOTCH2NLR, and the sequence similarity within the 100kb genomic sequence interval is greater than 99%. The upstream and downstream sequences of the GGC repeat series are very similar, so the primer design method based on allele specific amplification (ASA) was improved. Since DNA polymerase cannot repair the single base mismatch at the 3' end of the primer, amplification is hindered. At the same time, the improved design of introducing mismatch bases at the second to last or third base at the 3' end of the primer can improve the specificity of NOTCH2NLC detection.

[0018] (4) In addition to the GGC sequence repeats, the NOTCH2NLC gene also has GGA, AGC or other repeat interruption forms. The deletion and duplication of the NOTCH2NLC gene may be involved in the onset of NIID and may affect the age of onset. The combination of the repeat number and the interruption sequence may have different clinical symptoms. When the third primer of the present invention encounters an interruption sequence in the GGC repeat sequence, the shadow peak will be concave and present a shorter detection peak. Therefore, in addition to being used for the verification of larger fragments (mutants), the shadow peak can also indicate whether there is an interruption sequence. Figure 6 The solid arrows point to depressions that indicate interrupted sequences.

[0019] (5) When performing capillary electrophoresis on the fragments with high GGC repeats in the NOTCH2NLC gene (CG ratio can reach more than 80%), the actual fragment size will be very different from the predicted fragment size. If the GGC repeat number is calculated based on the fragment size, the result will be different from the actual GGC repeat number fragment length, resulting in misjudgment of the result. This kit is designed to contain NIID positive controls of 11, 19, 22, 26, 35, 40, 93, and 102. In addition to being used as quality control for the reagents, the NIID positive controls of 11, 19, 22, 26, 35, 40, 93, and 102 are used to establish a standard curve and calculate the GGC repeat number of the test sample. Because of the high span of repeat number controls and the evenly distributed repeat number points, the accuracy of the detection of the neuronal nuclear inclusion disease gene is significantly improved, making the detection method of neuronal nuclear inclusion disease more complete and accurate.

[0020] (6) The neuronal nuclear inclusion disease-related gene NOTCH2NLC gene nucleic acid detection kit of the present invention can accurately quantitatively analyze high GGC repeat sequences, and is currently a relatively simple, rapid and accurate detection method in NOTCH2NLC molecular diagnosis. Only one PCR experiment is required to detect the variation in the number of GGC repeats. Starting from the DNA sample, the result can be obtained within 5 hours. The detection technology process is simple and easy to standardize. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of primer set design.

[0022] Figure 2 Schematic diagram of primer set design.

[0023] Figure 3 This is the NIID positive control result diagram.

[0024] Figure 4 This is the NIID positive control standard curve.

[0025] Figure 5 For normal type (GGC repeat number 15,25) samples based on Figure 1 Figure 1. Results of primer design.

[0026] Figure 6 For mutant (GGC repeat number 18,133) samples based on Figure 1 Figure 2. Primer design results.

[0027] Figure 7 For mutant samples (GGC repeat number 20, >200), based on Figure 1 Figure 2. Primer design results.

[0028] Figure 8 For normal type (GGC repeat number 15,25) samples based on Figure 2 Figure 1. Results of primer design.

[0029] Fig. 9 For mutant (GGC repeat number 18,133) samples based on Figure 2 Figure 1. Results of primer design.

[0030] Fig.10 For mutant samples (GGC repeat number 20, >200), based on Figure 2 Figure 1. Results of primer design. DETAILED DESCRIPTION

[0031] Example 1 PCR amplification and result analysis 1. The components of NOTCH2NLC reaction solution are shown in Table 1, and the sequences of the primers are shown in Table 2.

[0032] Table 1 NOTCH2NLC reaction solution composition table Table 2 Sequences of primers 2. Sample processing: Human genomic DNA was extracted from EDTA anticoagulated whole blood samples using the nucleic acid extraction reagent (centrifugal column method, catalog number 04020001) produced by Xiamen Bioxun Biotechnology Co., Ltd. for subsequent PCR reactions. The DNA concentration was 2.5 ng / uL~50 ng / uL, and the OD260nm / OD280nm ratio was between 1.6-2.0.

[0033] 3. Preparation of amplification reagents: (1) Prepare amplification reagents according to Table 3 below: Table 3 Amplification reagent preparation table The NIID reaction solution is 10X Taq Buffer, dATP, dTTP, dGTP, dCTP, and enhancer; The NIID primer mix is ​​the primer set in Table 1.

[0034] (2) Oscillate the prepared reagent evenly with an oscillator and centrifuge briefly in a microcentrifuge to allow the liquid to settle to the bottom of the tube.

[0035] (3) Add 18 μL of the prepared amplification reagent to each PCR reaction tube and transfer it to the sample processing area for sample loading.

[0036] 4. Sample addition: Add 2 μL of the genomic DNA of the sample to be tested, NIID positive control (plasmids containing NOTCH2NLC gene GGC repeat numbers 11, 19, 22, 26, 35, 40, 93, 102, purchased from Universal Biotechnology) and NIID blank control (tris solution with a pH of 8.5) to the corresponding PCR reaction tubes containing 18 μL of amplification reagent, cover the PCR reaction tubes, and centrifuge briefly.

[0037] 5. PCR amplification and capillary electrophoresis analysis: (1) Perform PCR reaction in reaction system 1 and reaction system 2 respectively. Set the reaction program as shown in Table 4 and the reaction volume as 20 μL. Table 4 Amplification reaction procedure (2) Capillary electrophoresis analysis of PCR amplification products: Use ABI3130, ABI3730, ABI3500Dx, or ABISeqStudio Genetic Analyzer capillary genetic analyzer for detection. Take 1uL PCR amplification product, 0.5uL 1200 LIZ Size Standard, and 9uL Hi-Di Formamide, mix well, denature at 95℃ for 3min, put on ice for 2min, and detect on the machine.

[0038] 6. Interpretation of results: (1) Calculation of GGC repeat number: Use GeneMapper software to analyze the results. Establish a standard curve based on the known NIID positive control GGC repeat numbers of 11, 19, 22, 26, 35, 40, 93, 102 and the detection fragment length results. The formula is y=ax+b, where y represents the fragment length detected, and x represents the GGC repeat number. The a and b values ​​are obtained. The fragment size obtained by the GeneMapper software of the sample to be tested, as well as the a and b values, are inserted into the formula to obtain the GGC repeat number. Figure 4 The calculation formula is y = 2.9343x + 167.25. Substitute the fragment size y obtained from the sample to be tested into the formula to obtain the GGC repeat number x.

[0039] (2) The GGC repeat amplification products form stutter peaks. If they extend beyond the first NOTCH2NLC gene peak, it means that there is a larger fragment of NOTCH2NLC gene amplification product, which can be used as an auxiliary confirmation of the large fragment of NOTCH2NLC gene. Figure 6 The shadow peak result graph shows a depression (arrow), which indicates an interrupted sequence.

[0040] Example 2 1. Collect 100 EDTA anticoagulated whole blood samples from patients suspected of having neuronal intranuclear inclusion disease, use a nucleic acid extraction kit to extract human genomic DNA, and use a micro-spectrophotometer to detect the concentration and purity of DNA. The concentration of the 100 samples was 2.5ng / uL-50ng / uL, and the ratio of OD260nm / OD280nm was between 1.6-2.0.

[0041] 2. According to the steps of Example 1, DNA was added and the reaction was carried out using a PCR instrument. The NIID positive control and linearity results were shown in Table 2. Figure 3 and Figure 4 .

[0042] 3. According to the steps of Example 1, the results were analyzed. The results are shown in the following table. Compared with the results of the third-generation sequencing, the repeat number requirements were met. Among them, 23 cases of NIID mutant type were detected and 77 cases of NIID normal type were detected (Table 5). The results were consistent with the third-generation sequencing.

[0043] Table 5 Test results of 100 samples Table 5-1 Table 5-2 Table 5-3 The results of the two sets of primers were consistent; the results of sample 11 are shown in Figure 5 , Figure 8 , the results of sample 66 are shown in Figure 7 , Fig.10 , the results of sample 94 are shown in Figure 6 , Fig. 9 .

[0044] Example 3 Reagent Performance Verification 1. Positive reference conformity rate Four reference samples P1-P4 were tested, which were samples of the NOTCH2NLC gene mutation type for neuronal nuclear inclusion disease. The GGC repeat number of reference P1 was 11,97, the GGC repeat number of reference P3 was >200, >200, and the GGC repeat number of reference P4 was 11, >200; reference P2 was a mutant mosaic sample with GGC repeat numbers of 11,107,144,151. High, medium, and low concentrations were tested, respectively, with concentrations of 50 ng / uL, 25ng / uL, and 5ng / uL, respectively. Each concentration was tested in triplicate, and the positive compliance rate of the test results was 100%.

[0045] 2. Negative reference conformity rate Six reference samples N1~N6 were tested. N1~N4 were wild-type samples of NOTCH2NLC gene for neuronal nuclear inclusion disease, with GGC repeat numbers of 16, 16, 17, 18, 16, 22, 11, 16, respectively. N5~N6 were non-human genomic DNA samples, with high, medium and low concentrations of 50 ng / uL, 25ng / uL and 5ng / uL, respectively. Each concentration was tested in triplicate, and the negative compliance rate of the test results was 100%.

[0046] 3. Repeatability Three reference samples were tested, and the GGC repeat numbers of NOTCH2NLC gene were 11, 16, 11, 97, 11, and >200, respectively. The DNA was diluted to concentrations of 10 ng / uL and 5 ng / uL, respectively, and 10 replicates were performed on each sample. The repeat number judgments were all correct, and the test results were all consistent.

[0047] 4. Minimum detection limit The positive reference was diluted to 10ng / µL, 5ng / µL, and 2.5ng / µL, and 20 replicates were performed on each. The number of replicates of the test results all met the requirements.

[0048] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A primer set for PCR amplification detection of the number of GGC repeats in the 5' untranslated region of NOTCH2NLC gene, characterized in that: Contains the following 4 primers: (1) The first primer is a primer that binds to the upstream region of the GGC repeat in the 5' untranslated region of the NOTCH2NLC gene, contains a non-human genomic sequence at the 5' end of the primer, and introduces a mismatch base at the second to last or third base at the 3' end; (2) The second primer is a primer that binds to the GGC repeat downstream region of the 5' untranslated region of the NOTCH2NLC gene, contains a non-human genome sequence at the 5' end of the primer, and introduces a mismatch base at the second to last or third base at the 3' end; (3) The third primer is a primer that binds to the GGC repeat sequence in the 5' untranslated region of the NOTCH2NLC gene, containing GGC, CGG, GCG, CCG, GCC or CGC repeat sequences and non-human genomic sequences; (4) The fourth primer contains the non-human sequence of the third primer.

2. A primer set for PCR amplification detection of the number of GGC repeats in the 5' untranslated region of NOTCH2NLC gene, characterized in that: Contains the following 4 primers: (1) The first primer is a primer that binds to the upstream region of the GGC repeat in the 5' untranslated region of the NOTCH2NLC gene, and introduces a mismatch base at the second to last or third base at the 3' end; (2) The second primer is a primer that binds to the downstream region of the GGC repeat in the 5' untranslated region of the NOTCH2NLC gene, and introduces a mismatch base at the second to last or third base at the 3' end; (3) The third primer is a primer that binds to the GGC repeat sequence in the 5' untranslated region of the NOTCH2NLC gene, containing GGC, CGG, GCG, CCG, GCC or CGC repeat sequences and non-human genomic sequences; (4) The fourth primer contains the non-human sequence of the third primer.

3. The PCR amplification detection primer set according to any one of claims 1 or 2, characterized in that: The GGC, CGG, GCG, CCG, GCC or CGC repeat sequence of the third primer contains 4 to 7 GGC, CGG, GCG, CCG, GCC or CGC sequence repeat sequences.

4. The detection primer set for PCR amplification according to any one of claims 1 or 2, characterized in that: The final concentration of the third primer in the PCR reaction is at least 500 times lower than the final concentrations of the first primer, the second primer and the fourth primer.

5. The PCR amplification detection primer set according to any one of claims 1 or 2, characterized in that: First primer P1: 5′-GTTGCTACCCTCGTTCCGACATTTGCGCCTGTGCTTCGCAC-3′; The second primer P2: 5'-GTTGCTACCCTCGTTCCGAGCCCACAGCAGAGCGGCGAAG-3'; the 5' end is modified with FAM fluorescence; The third primer P3: 5'-GTAGCCGTTGCTACCCTCGTTCCGAGGCGGCGGCGGCGGC-3'; The fourth primer P4: 5'-GTAGCCGTTGCTACCCTCGTTCCGA-3'.

6. The detection primer according to claim 2, characterized in that: The primers include: First primer P5: 5′-GGGAGTCGAGGCATTTGCGCCTAT-3′; Second primer P6: 5′-CAGCACAGCCAGAGCGCCAGCAGCGCCCACAGCAGAGCTGC-3′; The third primer P3: 5'-GTAGCCGTTGCTACCCTCGTTCCGAGGCGGCGGCGGCGGC-3'; The fourth primer P4: 5′-GTAGCCGTTGCTACCCTCGTTCCGA-3′; The 5' end of the first primer P5 is modified with FAM fluorescence, and the 5' end of the fourth primer is modified with NED fluorescence.

7. A kit for detecting the number of GGC repeats in the 5' untranslated region of NOTCH2NLC gene, characterized in that : The kit comprises the primer set according to any one of claims 1-2.

8. Use of the PCR amplification detection primer set according to any one of claims 1 or 2 in preparing a nucleic acid detection kit for neuronal nuclear inclusion disease, characterized in that: The kit includes an amplification reagent, an NIID positive control and an NIID blank control; The amplification reagent includes NIID reaction solution, NIID primer mixture, and DNA polymerase; The NIID primer mixture comprises the primer set according to claim 6 or 7; The NIID reaction solution comprises 10X Taq Buffer, dATP, dTTP, dGTP, dCTP and an enhancer, wherein the enhancer is one or more of betaine, dimethyl sulfoxide, glycerol or ethylene glycol; The NIID positive control includes plasmids with NOTCH2NLC gene GGC repeat numbers of 11, 19, 22, 26, 35, 40, 93, and 102; The NIID blank control was a Tris solution with a pH of 8.

5.

9. The use according to claim 8, characterized in that: The calculation of the repeat number in the detection kit uses the NIID positive control to establish a standard curve with various different GGC repeat numbers and the corresponding fragment size, and the formula is y=ax+b, where y represents the fragment length obtained by the test, and x represents the GGC repeat number. The fragment length obtained from the sample to be tested is used using the above formula to obtain the GGC repeat number result.

Images