Application of fungal marker or detection reagent thereof in preparation of hepatocellular carcinoma evaluation product

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of a fungal marker or a detection reagent thereof in preparation of a hepatocellular carcinoma evaluation product. The fungal marker comprises a Candida genus and / or a Meyerozyma genus. The invention further discloses a method for preparing the fungal marker. Based on ITS2 data, two fungal hepatocellular carcinoma types, namely the C type and the M type, are established, Candida and Meyerozyma are taken as driving bacteria respectively, and the tumor diameter of the C type hepatocellular carcinoma is remarkably larger than that of the M type hepatocellular carcinoma. According to the discovery, a new basis can be provided for research and development of clinical treatment schemes or treatment medicines for hepatocellular carcinoma. Meanwhile, the most important strain C.boidinii in the C type can promote the progress of the hepatocellular carcinoma, and is possibly a risk factor of poor prognosis of the hepatocellular carcinoma. Meanwhile, the invention designs the C.boidini probe with the highest coverage rate and good specificity, and the C.boidini probe can be applied to identification and detection of C.boidini in a clinical sample.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of fungal markers or detection reagents thereof in the preparation of hepatocellular carcinoma assessment products. Background Art

[0002] Hepatocellular carcinoma, as a malignant tumor with high morbidity and mortality, is a disease that seriously threatens life and health. At present, the main clinical treatment methods for hepatocellular carcinoma include targeted therapy and immunotherapy. Although the above methods have made certain progress in the field of tumor treatment, it cannot be ignored that the limitations of their efficacy are very obvious, and only a certain group of patients can benefit from them. There is a significant gap between this and the urgent needs of the majority of patients in actual clinical treatment.

[0003] Tumors show a high degree of heterogeneity in biological characteristics, which means that tumor cells from different individuals differ in multiple dimensions such as morphology, gene expression, metabolism, and signal transduction networks. It is precisely because of this high degree of heterogeneity that the diagnosis and treatment of tumors face great difficulties and uncertainties. Therefore, the typing information obtained from multiple dimensions is of great value in achieving accurate diagnosis and treatment of clinical tumors.

[0004] In the emerging research hotspot of tumor microenvironment, microorganisms have gradually emerged and are widely recognized by the scientific community as an indispensable new component of the tumor microenvironment. More and more research evidence shows that microorganisms are closely related to the occurrence and development of various types of tumors, their invasion and metastasis capabilities, and the prognosis and survival of patients. For example, some intestinal microorganisms can indirectly or directly affect the growth and spread of tumor cells by regulating the body's immune system, metabolic homeostasis, and signal transduction pathways. However, there are currently few studies on the relationship between intratumoral fungi and hepatocellular carcinoma.

[0005] Intratumoral fungi, as a special component of the microbial community in the tumor microenvironment, may play an extremely important role in the occurrence, development, metastasis and drug resistance of hepatocellular carcinoma. Therefore, with the help of modern advanced microbial detection technologies, such as high-throughput sequencing technology, metagenomic analysis methods and fluorescence in situ hybridization technology, in-depth analysis of the species composition, abundance distribution, community structure and functional characteristics of intratumoral fungi may open up new strategies and directions for the treatment of hepatocellular carcinoma, thus hopefully filling the gaps in current treatment methods. Furthermore, it provides ideas for the development of products for diagnosis, classification, treatment or prognosis evaluation of hepatocellular carcinoma. Summary of the invention

[0006] In view of the above-mentioned deficiencies, the present invention provides the use of fungal markers or their detection reagents in the preparation of hepatocellular carcinoma assessment products. The fungal markers include the genus Candida and / or the genus Meyerozyma. Based on ITS2 data, the present invention established two types of fungal hepatocellular carcinoma, namely type C and type M, with the genus Candida and the genus Meyerozyma as the driving bacterial genera, respectively. The tumor diameter of type C hepatocellular carcinoma is significantly larger than that of type M. This discovery can provide a new basis for the clinical treatment of hepatocellular carcinoma or the development of therapeutic drugs. At the same time, C. boidinii, the most important species in type C, can promote the progression of hepatocellular carcinoma and is likely to be a risk factor for poor prognosis of hepatocellular carcinoma. At the same time, the present invention designs a C. boidini probe with the highest coverage and good specificity, which can be used for the identification and detection of C. boidinii in clinical samples.

[0007] The technical solution of the present invention includes:

[0008] In a first aspect, the present invention provides the use of fungal markers or reagents for detecting fungal markers in the preparation of a hepatocellular carcinoma assessment product, wherein the fungal markers include one or more of the genera Candida and Meyerozyma.

[0009] Preferably, the hepatocellular carcinoma assessment product has at least one of the following functions:

[0010] (1) Diagnosis of hepatocellular carcinoma;

[0011] (2) Hepatocellular carcinoma classification;

[0012] (3) Hepatocellular carcinoma treatment evaluation;

[0013] (4) Prognosis assessment of hepatocellular carcinoma;

[0014] (5) predict the risk of recurrence of hepatocellular carcinoma;

[0015] (6) Screening of anti-hepatocellular carcinoma drugs;

[0016] (7) Customized medication regimen for hepatocellular carcinoma.

[0017] Specifically, the hepatocellular carcinoma assessment product functions by detecting the expression level of fungal markers in the sample to be tested.

[0018] Preferably, the expression level of the fungal marker is positively correlated with the severity of hepatocellular carcinoma.

[0019] Specifically, the sample to be tested includes: one or more of serum, plasma, urine, cell culture supernatant, and tissue sample.

[0020] Preferably, the sample to be tested is a liver tissue sample.

[0021] Specifically, the detection method includes: one or more of traditional culture detection, microscopy detection, immunological detection method, and molecular biology detection method.

[0022] Preferably, the detection method is a molecular biology detection method, and more preferably a fluorescence in situ hybridization method.

[0023] Preferably, the hepatocellular carcinoma assessment product comprises: a reagent, a kit, a test paper or a chip.

[0024] Preferably, the fungal marker is Candida boidinii.

[0025] Specifically, the reagent for detecting fungal markers includes a probe of Candida boidinii.

[0026] Preferably, the probe has a nucleotide sequence as shown in SEQ ID NO.1.

[0027] Specifically, the probe is labeled with fluorescent groups at the 5' end and the 3' end.

[0028] Preferably, the fluorescent group includes one or more of Texas Red, FAM, VIC, TET, CAL Gold 540, JOE, HEX, TAMRA, ROX, CY3, and CY5.

[0029] More preferably, the fluorescent group is Texas Red.

[0030] Specifically, the fungal marker screening method comprises:

[0031] S1. Based on the ITS2 sequence database, the Partitioning Around Medoids clustering method was used to determine the optimal number of clusters using the Calinski-Harabasz Index;

[0032] S2. Visualization through principal coordinate analysis to clarify the classification of hepatocellular carcinoma;

[0033] S3. Use ROC curve to perform sensitivity and specificity analysis to verify the fungal markers for HCC typing.

[0034] In a second aspect, the present invention provides the use of a fungal marker inhibitor in the preparation of an anti-hepatocellular carcinoma drug, wherein the fungal marker comprises one or more of the genera Candida and Meyerozyma.

[0035] Specifically, the anti-hepatocellular carcinoma drug includes one or more of chemically synthesized drugs, plant extracts, microbial metabolites, and biological preparations.

[0036] Specifically, the dosage form of the anti-hepatocellular carcinoma drug includes a dosage form for gastrointestinal administration or a dosage form for parenteral administration.

[0037] Preferably, the dosage forms for administration via the gastrointestinal tract include, but are not limited to, tablets, powders, granules, solutions, capsules, emulsions, suspensions, and oils.

[0038] Preferably, the non-gastrointestinal dosage forms include, but are not limited to, injection dosage forms, respiratory tract dosage forms, skin dosage forms, mucosal dosage forms and cavity dosage forms.

[0039] Specifically, the anti-hepatocellular carcinoma drug further comprises one or more pharmaceutically acceptable excipients.

[0040] Preferably, the pharmaceutically acceptable excipients include, but are not limited to, solvents, diluents, disintegrants, precipitation inhibitors, surfactants, glidants, adhesives, lubricants, dispersants, suspending agents, isotonic agents, thickeners, emulsifiers, preservatives, stabilizers, hydrating agents, emulsification accelerators, buffers, absorbents, colorants, flavoring agents, sweeteners, ion exchangers, release agents, coating agents, flavoring agents or antioxidants.

[0041] Preferably, the therapeutic target of the anti-hepatocellular carcinoma drug is one or more of the genera Candida and Meyerozyma.

[0042] The beneficial effects of the present invention are:

[0043] (1) Based on ITS2 data, the present invention established two fungal hepatocellular carcinoma types, namely C type and M type, with Candida and Meyerozyma as the driving fungi, respectively. It was also found that the tumor diameter of C type hepatocellular carcinoma was significantly larger than that of M type. This discovery can provide a new basis for the clinical treatment of hepatocellular carcinoma or the development of therapeutic drugs.

[0044] (2) The present invention found that the most important species of C-type, Candida boidinii, can promote the progression of mouse hepatocellular carcinoma and is likely to be a risk factor for poor prognosis of hepatocellular carcinoma. At the same time, a 18S rRNA fluorescent in situ hybridization probe with the highest coverage and best specificity for C. boidinii was designed and applied to the identification and detection of C. boidinii in clinical samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1Clustering of fungal hepatocellular carcinoma typing based on genus data from ITS2 sequencing; A in the figure is the optimal number of clusters determined by the CH index within the four distance matrices; B is the clustering results of fungal liver types visualized by principal coordinate analysis.

[0046] Figure 2 The ROC curve of the main driving fungal genus for liver type distinguishing the two types; A in the figure is the main driving genus for C type; B is the main driving genus for M type.

[0047] Figure 3 Comparison of the maximum diameter of tumors in patients with two types of liver types.

[0048] Figure 4 Analysis of differential fungi in the two hepatic types for LEfSe.

[0049] Figure 5 C. boidinii promotes the progression of HCC in mice; A in the figure is a photo of the liver appearance; B is the weight of the mouse; C is the weight of the mouse liver; and D is the ratio of liver weight to body weight.

[0050] Figure 6 Fluorescence in situ hybridization (FISH) was used to detect C. boidinii in liver cancer tissues. DETAILED DESCRIPTION

[0051] The present invention will be further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0052] Example 1 Fungal markers and cancer tissue typing

[0053] Based on the ITS2 sequence database, the Partitioning Around Medoids (PAM) clustering method was used. Specifically, liver cancer tissue samples were divided into groups based on the Bray-Curtis distance between samples calculated at the genus level. Three other widely used distance matrices, including Jaccard distance, Kulczynski distance, and Jensen-Shannon distance (JSD), were considered to verify the robustness of fungal liver types. The optimal number of clusters was determined by the Calinski-Harabasz Index (CH-index).

[0054] Figure 1To cluster fungal hepatocellular carcinoma typing based on genus data from ITS2 sequencing, the results showed that within the four distance matrices, the optimal number of clusters determined by the CH index was 2. The clustering results of fungal liver types were visualized by principal coordinate analysis (PCoA), and the two types were labeled as Type M and Type C, respectively.

[0055] Figure 2 The ROC curve of the main driving fungal genus for liver type distinguishing the two types. The main driving genus of each liver type is defined as the genus with the highest relative abundance in the liver type. The results show that the main driving genus of M type is Meyerozyma, and its AUC value as a marker for diagnosing M type is 0.814; the main driving genus of C type is Candida, and its AUC value as a marker for diagnosing C type is 0.922.

[0056] Example 2 Clinical liver cancer tissue sample verification

[0057] Cancer tissue samples from 52 patients with hepatocellular carcinoma were collected, including 16 C-type and 36 T-type, for subsequent experiments.

[0058] Comparison of the maximum diameter of the tumor between type C and type M patients showed Figure 3 As shown, the results showed that the maximum diameter of the tumor in type C patients was significantly larger than that in type M patients.

[0059] From the cancer tissue samples of patients with hepatocellular carcinoma, DNA was extracted using a DNA extraction kit (purchased from Tiangen Biochemical Technology Co., Ltd., catalog number DP302-02), and ITS2 was amplified and sequenced. The primers used for amplification were: ITS1FI2 (upstream primer, SEQ ID NO. 3) and ITS2 (downstream primer, SEQ ID NO. 4).

[0060] SEQ ID NO. 3 (5' end → 3' end): GTGARTCATCGAATCTTTG.

[0061] SEQ ID NO. 4 (5' end→3' end): TCCTCCGCTTATTGATATGC.

[0062] The amplification reaction conditions were as follows: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 10 seconds, annealing at 52°C for 30 seconds, and extension at 72°C for 45 seconds, for 32 cycles; and finally extension at 72°C for 10 minutes.

[0063] Figure 4 The results showed that the abundance of Candida boidinii (C. boidinii) in C type was significantly higher than that in M ​​type.

[0064] Example 3 C. boidinii promotes HCC progression

[0065] 1. Construction of mouse primary hepatocellular carcinoma (HCC) model by hydrodynamic tail vein injection of plasmid

[0066] Three plasmids, 15 μg c-myc-PT3EF1a (Addgene 92046), 15 μg PX330-p53 (Addgene59910) and 5 μg pCMV(CAT)T7-SB100 (Addgene 34879), were fully dissolved in 2 mL of 0.9% NaCl solution, and the mixed solution (2 mL) was injected into 7-week-old C57BL / 6 male mice through the tail vein within 7 s.

[0067] 2. Establishment of fungal liver cancer model by inoculation of C. boidinii

[0068] Two weeks after plasmid injection, mice in the C. boidinii group were inoculated with approximately 10 8 cfu of C. boidiniii were inoculated once every 3 days, and the mice in the PBS group were inoculated with the same amount of PBS. After continuous intervention with C. boidiniii or PBS for 3 weeks, the body weight of the mice was measured. The mice were killed, the livers were collected, and the liver weight was observed and counted.

[0069] The results are as follows Figure 5 As shown in the figure, it was observed with the naked eye that the tumor progression of mice in the C.boidinii intervention group was obvious compared with that in the PBS group. There was no difference in the body weight of the two groups of mice, but the liver weight and liver weight to body weight ratio of mice in the C.boidinii intervention group were greater than those in the PBS group.

[0070] Example 4 Design of C. boidinii-specific probe

[0071] Fluorescence in situ hybridization (FISH) is a type of nucleic acid molecular hybridization technology. Based on the principle of base complementarity, a known fluorescently labeled single-stranded nucleic acid is used as a probe. After denaturation, annealing, and renaturation, it specifically binds to an unknown single-stranded nucleic acid in the material to be tested to form a detectable hybrid double-stranded nucleic acid. Microbial FISH detection uses the relatively stable rRNA in microorganisms as the target of analysis, and designs probes based on rRNA sequences for hybridization. It identifies and quantitatively analyzes the distribution of microorganisms to be detected and characteristic microorganisms, and provides information such as microbial morphology, spatial distribution, and cell number of organisms.

[0072] The probe design of this embodiment adopts the database of silva138.1 (released on August 27, 2020, currently the latest version). The entire database contains 58,790 representative sequences of eukaryotic 18S, which is one of the most complete databases of fungal 18S sequences. The name of the target species is: Candida boidinii, and there are 4 representative sequences of 18S belonging to the target species (hereinafter referred to as the target 18S sequence library), 224 species of Pichiaceae, and 510,504 representative sequences belonging to non-target species (hereinafter referred to as non-target sequence library). According to all common sequences in the target 18S sequence library, the non-specific regions therein are excluded, and all possible FISH probe sequences are listed, and the probe with the highest coverage rate with the target 18S sequence library and the least matching with the non-target sequence library, i.e., the probe with the highest specificity, is selected. The final C.boidinii probe sequence is shown in SEQ ID NO.1. This embodiment verifies the specificity of the C.boidinii probe using MY1574 as a positive probe. The positive probe has a sequence as shown in SEQ ID NO.2.

[0073] SEQ ID NO.1 (5' end→3' end): GTTCACCAAAAGGTTAGCCAGAAGGA, double-end labeled with Texas Red.

[0074] SEQ ID NO.2 (5' end→3' end): TCCTCGTTGAAGAGC, double-end labeled with FITC.

[0075] The process of this embodiment includes: baking - dewaxing and hydration - digestion - dehydration - hybridization - washing after hybridization - DAPI nuclear staining - microscopic examination and photography. Specific steps:

[0076] The paraffin blocks of liver cancer tissue were cut into 3 μm thick gel-coated sections and baked at 65℃ for 2 hours. At room temperature, the sections were immersed in xylene solution twice, 10 minutes each time; immersed in 100% ethanol twice, 5 minutes each time; immersed in 95% ethanol and 75% ethanol for 2 minutes each; immersed in distilled water for 3 minutes; and dried. The Termo Brite hybridization instrument was immersed in a humidifying strip and the instrument was preheated to 37℃; according to the thickness of each section, the digestion time (about 12 minutes) and the required amount (about 50 μL) of 200 μg / mL lytic enzyme were determined, and the sections were placed in the preheated hybridization instrument, and program "1" was started: 37℃, 15 minutes; the sections were taken out on time and immediately placed in distilled water to remove the lytic enzyme activity; at room temperature, 2×SSC was washed twice, 5 minutes each time; the sections were dried at room temperature, and 10 μL DAPI was added; 2×SSC was washed twice, 5 minutes each time. At room temperature, the sections were immersed in 75% ethanol, 95% ethanol and 100% ethanol for 2 min each and then dried naturally.

[0077] Vortex and mix 2 μL of specific probe (SEQ ID NO.1), 1 μL of positive probe and 37 μL of hybridization solution thoroughly, take about 10 μL of probe mixture to the hybridization area of ​​the slice, cover with siliconized coverslip, pay attention to prevent bubbles, and seal the four sides of the coverslip with rubber glue; place the slice in the hybridizer and start program "2": denaturation at 73℃ for 8 minutes, hybridization at 37℃ for 16-24 hours. Carefully remove the rubber glue, wash the tissue slice in 2×SSC for 5 minutes, and remove the siliconized coverslip; wash the tissue slice in 25% formamide / 2×SSC preheated at 53℃ twice, 5 minutes each time; wash 0.1% NP-40 / 2×SSC preheated at 42℃ twice, 5 minutes each time; wash 0.5×SSC preheated at 42℃ once, 5 minutes; wash 0.2×SSC preheated at 42℃ once, 5 minutes. At room temperature, the sections were dried naturally in the dark, 20 μL DAPI was added for staining for 10 min, and then washed twice with 1× PBS for 5 min each time; 50 μL 30% glycerol buffer was added, and the sections were sealed with a large coverslip. The hybridized tissue sections were placed on an Olympus upright fluorescence microscope for observation and image acquisition.

[0078] Figure 6 Using the C.boidinii probe to specifically label C.boidinii (red) and the MY1574 probe to label fungi (green) in human liver cancer tissues can clearly show that C.boidinii does exist in liver cancer tissues, indicating that the C.boidinii probe can specifically label C.boidinii in tissues and can be used for the identification and detection of C.boidinii in liver cancer tissue samples.

[0079] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. Use of a fungal marker or a reagent for detecting a fungal marker in the preparation of a hepatocellular carcinoma assessment product, characterized in that: The fungal markers include one or more of the genera Candida and Meyerozyma.

2. The use according to claim 1, characterized in that: The functions of the hepatocellular carcinoma assessment product include at least one of the following: (1) Diagnosis of hepatocellular carcinoma; (2) Classification of hepatocellular carcinoma; (3) Hepatocellular carcinoma treatment evaluation; (4) Prognosis assessment of hepatocellular carcinoma; (5) predict the risk of recurrence of hepatocellular carcinoma; (6) Screening of anti-hepatocellular carcinoma drugs; (7) Customized medication regimen for hepatocellular carcinoma.

3. The use according to claim 2, characterized in that: The hepatocellular carcinoma assessment product functions by detecting the expression level of fungal markers in a test sample.

4. The use according to claim 3, characterized in that: The sample to be tested includes: one or more of serum, plasma, urine, cell culture supernatant, and tissue sample.

5. The use according to claim 4, characterized in that: The sample to be tested is a liver tissue sample.

6. The use according to claim 3, characterized in that: The detection method includes: one or more of traditional culture detection, microscopic detection, immunological detection, and molecular biological detection.

7. The use according to claim 1, characterized in that: The hepatocellular carcinoma assessment product includes: reagents, test kits, test strips or chips.

8. The use according to claim 1, characterized in that: The fungal marker is Candida boidinii.

9. The use according to claim 1, characterized in that: The reagent for detecting fungal markers includes a probe of Candida boidinii, and the probe has a nucleotide sequence as shown in SEQ ID NO.

1.

10. The use according to claim 9, characterized in that: The probe is labeled with fluorescent groups at the 5' end and the 3' end.

11. The use according to claim 10, characterized in that: The fluorescent group includes one or more of Texas Red, FAM, VIC, TET, CAL Gold 540, JOE, HEX, TAMRA, ROX, CY3, and CY5.

12. The use according to claim 1, characterized in that: The fungal marker screening method comprises: S1. Based on the ITS2 sequence database, the Partitioning Around Medoids clustering method was used to determine the optimal number of clusters using the Calinski-Harabasz Index; S2. Visualization through principal coordinate analysis to clarify the classification of hepatocellular carcinoma; S3. Use ROC curve to perform sensitivity and specificity analysis to verify the fungal markers for HCC typing.

13. Use of a fungal marker inhibitor in the preparation of an anti-hepatocellular carcinoma drug, characterized in that: The fungal markers include one or more of the genera Candida and Meyerozyma.

14. The use according to claim 13, characterized in that The anti-hepatocellular carcinoma drug includes one or more of chemically synthesized drugs, plant extracts, microbial metabolites, and biological preparations.

15. The use according to claim 13, characterized in that: The dosage form of the anti-hepatocellular carcinoma drug includes a dosage form for gastrointestinal administration or a dosage form for parenteral administration.

16. The use according to claim 13, characterized in that: The anti-hepatocellular carcinoma drug also includes one or more pharmaceutically acceptable excipients.

17. The use according to claim 13, characterized in that: The therapeutic targets of the anti-hepatocellular carcinoma drug are one or more of the genera Candida and Meyerozyma.

Images