Establishment and application of sheep mycoplasma Mo, Mccp and Mmc triple PCR detection method

Abstract

The invention discloses establishment and application of a sheep mycoplasma Mo, Mccp and Mmc triple PCR (Polymerase Chain Reaction) detection method, specific difference sections among three sheep mycoplasma genomes are analyzed by adopting high-throughput Mauve genome collinearity, specific primers capable of identifying and diagnosing three sheep mycoplasmas are designed and screened out, and the three sheep mycoplasma Mo, Mccp and Mmc triple PCR detection method is established through primer sequence amplification and sequencing. According to the method, three new target molecules for identifying and diagnosing the mycoplasma sheep are identified, namely, a target molecule DprA for identifying and diagnosing Mo, a target molecule MCCPF3800240 for identifying and diagnosing Mccp, and a target molecule reset endonuclease subunit S for identifying and diagnosing Mmc, which are respectively a target molecule DprA for identifying and diagnosing Mo, a target molecule MCCPF3800240 for identifying and diagnosing Mccp, and a target molecule reset endonuclease subunit S for identifying and diagnosing Mmc. A triple PCR method capable of synchronously identifying and diagnosing three sheep mycoplasmas (Mo, Mccp and Mmc) is established by utilizing a new target specific segment. The PCR method disclosed by the invention has the characteristics of clinical convenience and rapid diagnosis, can be widely used in clinical diagnosis of the sheep mycoplasma, and has better market prospect and economic value.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to the establishment and application of a multiplex PCR rapid diagnosis method for mixed infection of sheep mycoplasma disease. Background Art

[0002] Mycoplasma pneumonia in sheep has become one of the important diseases affecting goat and sheep farming in my country. The disease causes fever, coughing, weight loss in sheep, and pregnant ewes may experience serious symptoms such as miscarriage, posing a threat to the health of the flock and causing economic losses to the farming industry. The main pathogens causing mycoplasma pneumonia in sheep include Mycoplasma ovipneumoniae (Mo), Mycoplasma capricolum subsp. capripneumoniae (Mccp) and Mycoplasma mycoides subsp. capricolum (Mmc). It is also the main pathogen causing symptoms of pneumonia in sheep.

[0003] Mycoplasma ovipneumoniae (Mo) can cause mycoplasma pneumonia in goats or sheep, and the incidence of infection in sheep is higher than that in goats. The clinical manifestations are characterized by coughing, weight loss, and interstitial and proliferative pleuropneumonia. After sheep are infected with Mo, there will be a long-term infection that cannot be cleared. Mo is mainly present in the respiratory tract, lesion tissue and pleural effusion of diseased sheep. It is mainly transmitted through the air. Sick sheep that survive can also spread pathogens, and their secretions can continue to excrete bacteria for months or even years. In addition, infected sheep are prone to secondary infection with other pathogens, which is extremely harmful to the flock and causes significant economic losses to the sheep farming industry.

[0004] Mycoplasma caprico-pneumoniae (Mccp) mainly infects goats. The main clinical symptoms of infected goats are fever, cough and dyspnea. Histopathological manifestations are interstitial pneumonia, congestion and thickening of the pulmonary septa accompanied by pulmonary edema. The autopsy changes are characterized by fibrinous pneumonia and pleurisy. It is the main pathogen causing contagious caprine pleuropneumonia (CCPP) in goats. CCPP has been listed as a Class II animal epidemic in my country. The morbidity and mortality rates are both high, which seriously harms the goat breeding industry.

[0005] Mycoplasma mycoides subspecies caprine (Mmc) can naturally infect goats, sheep and cattle, and goats under 3 years old are most susceptible to infection. It causes pathological lung changes similar to Mccp in goats, and can also cause pneumonia, mastitis, arthritis, keratitis and sepsis in goats. Although the mortality rate of Mmc is not high, the quality of semen or dairy products of infected sheep is reduced, and the disease is transmitted through semen and milk. Severely infected sheep may even suffer miscarriage.

[0006] There are two main problems in the existing sheep mycoplasma disease prevention and control technology:

[0007] 1. Clinically, the three pathogens Mo, Mccp, and Mmc often cause mixed infections. Because the three pathogens cause similar clinical diagnosis and pathological changes, it is often impossible to accurately diagnose the infection of the pathogens in gross autopsy or pathological analysis, which causes great trouble and trouble in the diagnosis and accurate treatment of sheep mycoplasma pneumonia in clinical practice.

[0008] 2. There is no effective technical means to effectively and accurately distinguish the three pathogens of sheep mycoplasma disease, nor is there a diagnostic target that can be used to establish differential diagnosis of mixed infection of three pathogens of sheep mycoplasma. The existing ELISA and indirect hemagglutination and hemagglutination inhibition tests can only detect Mo or Mccp, mainly to detect antibody levels, and cannot detect pathogens. At the same time, whether there is cross-reactivity between them cannot be evaluated. At the same time, its specificity and sensitivity cannot currently meet clinical needs. The PCR technology for pathogen nucleic acid detection can quickly detect the corresponding mycoplasma from culture medium or clinical samples, and is widely used in the detection of pathogens of sheep mycoplasma pneumonia.

[0009] The above-mentioned key scientific issues of mixed infection of mycoplasma pathogens in the sheep farming industry and the two bottleneck technical problems that cause this actual production scientific problem have led to the backward diagnosis of sheep mycoplasma disease, resulting in the widespread prevalence and incidence of sheep mycoplasma disease at this stage. The current diagnostic technology cannot meet clinical needs, which ultimately leads to significant economic losses to the sheep farming industry caused by sheep mycoplasma disease at this stage. Summary of the invention

[0010] Aiming at the key issues of mycoplasma mixed infection in sheep breeding industry and the actual bottleneck technical difficulties, the present invention takes Mo, Mccp and Mmc as the research objects, and involves screening and identifying new sheep mycoplasma pathogen differential diagnosis targets, and on this basis, establishes a sheep mycoplasma triple PCR detection method, which can quickly and synchronously differentially diagnose the mixed infection and single infection of Mo, Mccp and Mmc in clinical practice.

[0011] The present invention is achieved by screening and identifying new differential diagnosis targets of mycoplasma ovis pathogens Mo, Mccp and Mmc, and establishing and applying a triple PCR detection method of Mo, Mccp and Mmc, including the following steps:

[0012] Step 1: To screen new molecular markers for differential diagnosis of Mo, Mccp and Mmc, high-throughput Mauve genome colinearity analysis was used to analyze the specific difference segments among the three mycoplasma genomes;

[0013] Step 2. According to the results of high-throughput difference interval analysis of the genome, specific primers that can simultaneously distinguish the three mycoplasmas were designed and synthesized using primer design software; a total of 87 available PCR primer sequences were designed and synthesized, and according to the specificity of the PCR products, primers that can be used for Mo differential diagnosis (Mo.multP.p80 / Mo.multP.p81), Mcp differential diagnosis primers (multP.p31 / Mccp.multP.p32) and Mmc differential diagnosis primers (Mmc.multP.p9 / Mmc.multP.p10) were screened out. After amplifying and sequencing the PCR products amplified by the primers, it was found that the target molecule for Mo differential diagnosis was DNA-processing protein (DprA), the target molecule for Mcp differential diagnosis was MCCPF38_00240, and the target molecule for Mmc differential diagnosis was restriction endonuclease subunit S. At the same time, it was found that the new target could amplify specific bands with the source mycoplasma strain, but had no specific bands with other different types of ovine mycoplasma and other important ovine bacterial pathogens, which proved that the three new mycoplasma differential diagnosis targets discovered by the present invention had good specificity and could be used to establish a PCR method for mycoplasma differential diagnosis;

[0014] Step 3: To verify the sensitivity of the three mycoplasma differential diagnosis targets in the present invention, the above target fragments were constructed on the PUC18-T vector, plasmid standards were prepared, and the gene copy number was calculated. Then, a 10-fold dilution was performed and 1×10 7 , ~1×10 0The positive plasmid with 100 copies / μL was used for subsequent tests. The sensitivity of the three mycoplasma-specific primers was analyzed according to the PCR system and reaction conditions described in step 2. The sensitivity of the detection primers designed for the DprA gene of Mo (Mo.multP.p80 / Mo.multP.p81) was 102 copies / μL, the sensitivity of the detection primers designed for the MCCPF38_00240 gene of Mccp (Mccp.multP.p3 / Mccp.multP.p32) was 101 copies / μL, and the sensitivity of the detection primers designed for the restriction endonuclease subunit S gene of Mmc (Mmc.multP.p9 / Mmc.multP.p10) was 102 copies / μL. The results showed that the sensitivity of the identified new mycoplasma targets and their specific primers was 10-100 copies / μL, which had high sensitivity and could be used for the detection of mycoplasma pathogens.

[0015] Step 4, in order to establish a triple PCR method for mixed infection of mycoplasma Mo, Mccp and Mmc, the effects of the concentration of three mycoplasma-specific identification primers, extension time and annealing temperature on the triple PCR detection method were explored. In order to explore the effects of primer concentration, extension time and annealing temperature on the established triple PCR detection method, other conditions were relaxed, and the variables were only primer concentration, extension time and annealing temperature; the optimized triple PCR method for mixed infection of Mo, Mccp and Mmc in the present invention determined the optimal PCR system as follows: total volume 20 μL (10 μL 2×PCRMix, primer mixture (Mccp:Mo:Mmc=4:3:2) 9 μL, template 1 μL), the optimal PCR reaction program is: 95°C, 3min; 95°C, 15s, 53°C, 30s, 72°C, 10s, 35 cycles; 72°C, 5min. Primer mixture sequence: Mo detection primer (Mo.multP.p80: 5'-GGATTCTTAAAGACCCGCCAT-3'; Mo.multP.p81: 5'-AATTTCCTTGCCAAGATCGAG-3'), Mcp detection primer (Mccp.multP.p31: 5'-CTTCCATAATCACTCCACGAT-3'Mccp.multP.p32: 5'-AGGACGTTGAATAACTCATGC-3'), Mmc detection primer (Mmc.multP.p9: 5'-ACAATTCCCTCGTTATGTGT-3'Mmc.multP.p10: 5'-AAGTTCCGTTTGAAATACCTG-3'). The entire PCR reaction process does not exceed 1 hour, and has good practical value for clinical detection.

[0016] Step 5, using the established triple PCR method for detecting mixed mycoplasma infection, clinical disease materials and samples (Mo and Mccp) that tested positive for sheep mycoplasma infection were tested for compliance, and the results were consistent with the test results of the known positive samples tested, indicating that the new molecular targets of mycoplasma screened by the patent of the present invention and the established triple detection PCR method have good detection effects.

[0017] Aiming at the problems existing in the prior art, some creative technical effects are brought about after solving the problems. The specific description is as follows:

[0018] First, the present invention performs colinearity analysis on the genomes of Mo, Mccp, and Mmc, analyzes the difference intervals between the genomes of the three sheep mycoplasma pathogens, designs a large number of possible specific primers, defines the difference in the size of the amplified fragments of different mycoplasmas, and the specificity and sensitivity of PCR amplification. From a large number of primers, creatively screen out differential diagnostic primers that can be used for mixed infection of sheep mycoplasma, reversely amplify the corresponding three mycoplasma differential diagnostic targets, and confirm through specificity and sensitivity experiments that DprA is a new differential diagnostic marker molecule for Mo, MCCPF38_00240 is a new differential diagnostic marker molecule for Mccp, and restriction endonuclease subunit S is a new differential diagnostic marker molecule for Mmc. These three mycoplasma differential diagnostic markers have not been reported at home and abroad, confirming the creativity of the invention patent.

[0019] In addition, the patent of the present invention uses the new mycoplasma differential diagnosis marker molecules screened and identified above, and optimizes the reaction conditions such as primer concentration, extension time, and annealing temperature. For the first time, a triple PCR detection method for three mycoplasma pathogens has been established at home and abroad, and sensitivity, specificity, and repeatability tests have been carried out. The triple PCR detection method established in this study has the advantages of strong specificity, good sensitivity, and timeliness in clinical use. It can be used for rapid differential diagnosis and epidemiological investigation of Mo, Mccp, and Mmc infections, which is of great significance.

[0020] Second, the expected benefits and commercial value after the technical solution of the present invention is transformed as follows: Mycoplasma pneumonia in sheep caused by Mo, Mmc and Mccp is one of the important diseases affecting the sheep farming industry in various countries and regions in the world. The disease causes fever, coughing, and weight loss in sheep, and pregnant ewes may experience serious symptoms such as miscarriage, posing a threat to the health of the flock and causing economic losses to the breeding industry. At present, sheep mycoplasma disease has occurred in many sheep breeding provinces in my country, and the infection has become more and more serious, causing huge losses. It is also the most important disease of the respiratory system of sheep in my country. However, there is currently no clinical rapid test method that can simultaneously detect three types of sheep mycoplasma diseases, which will fill the long-term technical gap in the prevention and control of sheep mycoplasma pneumonia. According to current demand, it has a large market prospect, and the expected benefits and commercial value after transformation are large.

[0021] The technical solution of the present invention fills the technical gap in the industry at home and abroad: the patent of the present invention screened and identified for the first time at home and abroad a new molecular marker that can be used for the differential diagnosis of three pathogens of sheep mycoplasma disease, and at the same time established a triple PCR method that can simultaneously identify and detect Mo, Mccp, and Mmc using the new marker molecules, filling the gap in the lack of molecular markers and methods for simultaneous differential diagnosis of three types of sheep mycoplasma Mo, Mccp, and Mmc at home and abroad.

[0022] The technical solution of the present invention solves a technical problem that people have been eager to solve but have never been successful: clinically, mixed infections of multiple mycoplasmas such as Mo, Mccp, and Mmc are not uncommon. PCR technology can quickly detect the corresponding mycoplasma from culture media or clinical samples, and is widely used in the detection of pathogens of sheep mycoplasma pneumonia. The traditional PCR molecular detection method for detecting sheep mycoplasma pneumonia has low sensitivity, and each reaction can only detect one pathogen. This patent screens and identifies three new differential diagnostic markers for sheep mycoplasma pathogens. These new markers can be used to establish other nucleic acid identification detection methods for sheep mycoplasma disease. At the same time, the triple PCR method established by the patent of the present invention using new marker molecules can simultaneously identify and detect Mo, Mccp, and Mmc, providing technical support for the clinical diagnosis, epidemiological investigation and scientific prevention and control of the above-mentioned pathogenic infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The technical solution of the present invention will be further described below in conjunction with the accompanying drawings:

[0024] Figure 1 It is a flow chart of the establishment and application of the triple PCR detection method of Mycoplasma ovis Mo, Mccp, and Mmc provided in an embodiment of the present invention;

[0025] Figure 2 This is a result diagram of the specific difference segments between the three types of Mycoplasma ovis genomes analyzed by high-throughput Mauve genome colinearity;

[0026] Figure 3 It is a result diagram of using the primer library obtained by colinearity analysis to screen out primer sequences that can be used for differential diagnosis and diagnosis of new targets;

[0027] Figure 4 This is the result diagram of specific identification of new diagnostic targets for Mycoplasma ovis Mo, Mccp, and Mmc;

[0028] Figure 5 This is the result diagram of the sensitivity identification of new diagnostic targets for Mycoplasma ovis Mo, Mccp, and Mmc;

[0029] Figure 6 This is the result diagram of the combined optimization of triple PCR detection methods for Mycoplasma ovis Mo, Mccp, and Mmc;

[0030] Figure 7 This is the clinical sample test results of the triple PCR detection method for sheep Mycoplasma Mo, Mccp, and Mmc. DETAILED DESCRIPTION

[0031] The technical scheme of the present invention will be clearly and completely described below in conjunction with specific embodiments, but those skilled in the art should understand that the embodiments described below are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] The Mycoplasma ovipneumoniae (Mo) used in the present invention is the standard strain Y98 strain (ATCC 29419), the Mycoplasma capricoposterior pneumoniae (Mccp) is the standard strain F38 strain (NCTC 10192T), and the Mycoplasma mycoides subspecies capricoposterior pneumoniae (Mmc) is the standard strain PG3 strain.

[0033] The triple PCR detection method of the ovine mycoplasma pathogens Mycoplasma ovipneumoniae, Mycoplasma capricolum subspecies capricolum and Mycoplasma mycoides subspecies capricolum provided by the present invention comprises the following steps:

[0034] Step 1: Use high-throughput Mauve genome colinearity to analyze the specific difference segments of the three mycoplasma genomes. Since there is currently no PCR method for the simultaneous detection of the three main pathogens of ovine mycoplasma disease (Mo, Mccp and Mmc) at home and abroad, it is necessary to screen and identify new PCR molecular targets to meet the single or joint detection of the three pathogens. According to NCBI ( https: / / www.ncbi.nlm.nih.gov / ) website for the genomes of three Mycoplasmas of sheep (Mo) https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_028885435.1 / ), Mccp(https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_000953375.1 / ), Mmc (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_018389705.1 / ), and the complete genome sequence was downloaded and saved. The genome sequences of the three pathogens were analyzed for genome colinearity using Mauve (Ver20150226) software. According to the results of colinearity analysis, it was found that the genomic difference segments of Mmc specific to Mccp and Mo were (188k-201k, 355k-365k, 658k-664k and 861k-867k), the genomic difference segments of Mccp specific to Mmc and Mo were (253k-268k, 352k-383k, 431k-444k and 883k-890k), and the genomic difference segments of Mo specific to Mccp and Mmc were (110k-120k, 370k-380k, 610k-620k and 850k-860k), see Appendix Figure 2 shown.

[0035] Step 2: Based on the results of high-throughput genome difference interval analysis, specific primers that can simultaneously distinguish the three mycoplasmas were designed and synthesized using primer design software; a total of 87 available PCR primer sequences were designed and synthesized, including Mmc (p1-p30), Mccp (p31-p58) and Mo (p59-p87); primer information is shown in Table 1. The positive genomes of Mo, Mccp and Mmc were extracted respectively by using a bacterial genomic DNA extraction kit, and diluted to 0.1 ng / μ respectively, and used as templates for single PCR amplification of Mo, Mccp and Mmc respectively, and the PCR products were subjected to 1% agarose gel electrophoresis respectively to observe the specificity and sensitivity of each sheep mycoplasma detection primer. After the primers with good sensitivity and clear extended bands were preliminarily screened out, the specificity analysis between the three sheep mycoplasmas Mo, Mccp and Mmc was performed respectively (that is, the detection primers of one of the mycoplasmas could not amplify the gene fragments of the other two mycoplasmas); the PCR amplification system was: 1 μL template, 10 μL 2×PCR Mix, 7 μL ddH2O, 1 μL of each of the designed upstream and downstream primers (10 μL mol·L-1), totaling 20 μL. The reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 5 min. Amplification results are attached. Figure 3By analyzing the PCR gel results, the detection primers for detecting Mo (Mo.multP.p80: 5'-GGATTCTTAAAGACCCGCCAT-3' SEQ ID NO.1; Mo.multP.p81: 5'-AATTTCCTTGCCAAGATCGAG-3' SEQ ID NO.2); the detection primers for Mcp (Mccp.multP.p31: 5'-CTTCCATAATCACTCCACGAT-3' SEQ ID NO.3Mccp.multP.p32: 5'-AGGACGTTGAATAACTCATGC-3' SEQ ID NO.4). The detection primers for Mmc (Mmc.multP.p9: 5'-ACAATTCCCTCGTTATGTGT-3' SEQ ID NO.5Mmc.multP.p10: 5'-AAGTTCCGTTTGAAATACCTG-3' SEQ ID NO.6). By using the detection primers to amplify the target gene molecules corresponding to the Mo, Mccp and Mmc detection primers, and using the gel recovery kit to recover the amplified products and sequence them, we obtained a new target molecule for Mo differential diagnosis, DNA-processing protein (DprA), located at 851991bp-852457bp in the Mo genome, with a fragment size of 467bp, GenBank (CP118522.1). The DprA gene sequence is:

[0036] GGATTCTTAAAGACCCGCCATAGTGATATTTTATAGCGGCAATATCGAAGCTTTAAATGACCTGCATCCAAAAGCTTCACTAATTGGTGAAAATTACATCCCTCAAATTCAAAGTTTTTTTAATCGTTCACTTGATCAAATAATAAAAAGACACGTTTTAGTAACAAACGGCTACAAAGGAGTGGAACAAAAAGTAATGGAATTTTTCCGTTTACATGAAATACCAATTATT GGCGTCTCAGTAAATGGGGTTGAAAATCCTTGAATGTTTGAAAATTTTAAAGATTATGACAAATTATTGATAATTTCTGAATACCCTAAGGGGGCTAACATTAATAAAAAACGGCTAATCCAACGGAATCGATTAGTTGCTGCCCTTAGTAATTTTTTAGTGGTTTATTCACTCAGGCAAAAAGGTGGATCACAAAATCTAGTTAATTTTTTTCTCGATCTTGGCAAGGAAATT SEQ ID NO.7

[0037] A new target molecule for Mccp differential diagnosis, MCCPF38_00240, was obtained, located at 258130bp-258797bp of the Mccp genome, with a fragment size of 628bp, GenBank (LN515398.1). The gene sequence of MCCPF38_00240 is:

[0038] CTTCCATAATCACTCCACGATCTAAATCATTTTCATCATTATGAGGGGCAAATAATGTTTTAGTTCTTGGTGGTAAGTTTGTTATTTCATAGTATTTTTTTTCATCACCATAAATACTATTAATAATTCAAGGATTATGAGTATTAAAATCAAATCATATTAATTCTTTTTTAGTTCCAGTATTTGGATCTATTTTAGGATCATATTTAGGATTTTTAATAGGTTTTCCAGTTTTATCTCTTTTAGTTTTTCCTTTTTCATCTTTTTGAAATTCCTCTATTAATTCTCTTTGATGAGCATAAGTTTTAGGATCTCAAGCGTATCATTTAAAATCCATTTCAGATGATCTCGACTCAATAACTAATGTTTTTGTCCAAGTATATTCAATATCTTTATTACCTGTTTTAGGTTTGTATTTAGTTATTTCTATGTTATATTCATTTTTTAAATGAGAGTTCTTTTCATCTTTTTTTTTATTTTCTTTTGGTTGATAACCGTGATTAAACTCTCTTTCATTATCACTTGAGTTTTTACGATTATCATTTAGATTTGTTTCAAATCTTTGATTTAAAACATCAACTCTTTGTCCATTAATCTTTAAAACTTCAGTTTCATCTTTTAAGGCATTAAAACTTACTTTTAAAGGAGCATGAGTTATTCAACGTCCT SEQ IDNO.8

[0039] A new target molecule for the differential diagnosis of Mmc, restriction endonuclease subunit S, is located at 363418bp - 363727bp of the Mmc genome, and the size of the differential fragment is 310bp, GenBank(CP065581.1). The gene sequence of restriction endonuclease subunit S is:

[0040] ACAATTCCCTCGTTATGTGTACAATTTATTTTAGCAATTGATGTTCTTCCTATAGTTAATTTAAAACTCATAAGCAATGTTTCTTTTTCTACAAGATAATTTTTAAAAATAACCTCTAATGCTTTGTGAGTTATAAACTGTGAAGATTGAAAAAGTTCTTTATTGTTTTTCATGTCAGCTATTGTTATTCATGGAATTTCACCATTTCAAAATATTTTATTTCCTCTTGGCGGTGTCTTTCCTAAATTAAAATTTAATATACTCTTAAGTCATACCCATACTCAATTATCAGGTATTTCAAACGGAACTT

[0041] SEQ ID NO.9

[0042] Through the above research, the inventors obtained new molecular diagnostic targets and specific diagnostic gene fragments of Mo (DprA), Mccp (MCCPF38_00240) and Mmc (restriction endonuclease subunit S), which can mutually differentiate and diagnose three mycoplasmas. This is the first time that these molecules have been excavated and found to be new discoveries as mycoplasma differential diagnostic markers. At the same time, the inventors further tested the specificity of these three new molecular markers and the primers they designed, and found that the detection primers designed based on the DprA gene of Mo (Mo.multP.p80: 5'-GGATTCTTAAAGACCCGCCAT-3'; Mo.multP.p81: 5'-AATTTCCTTGCCAAGATCGAG-3') can only amplify the Mo genome sample, and cannot amplify specific bands for other sheep mycoplasmas (Mccp and Mmc) and other important bacterial diseases of sheep. The detection primers designed based on the MCCPF38_00240 gene of Mccp (Mccp.multP.p31: 5'-CTTCCATAATCACTCCACGAT-3'Mccp.multP.p32: 5'-AGGACGTTGAATAACTCATGC-3') can only amplify the Mccp genome sample, but cannot amplify specific bands for other ovine mycoplasmas (Mo and Mmc) and other important bacterial diseases of sheep. At the same time, based on the restriction of Mmc The detection primers designed for the endonuclease subunit S gene (Mmc.multP.p9: 5'-ACAATTCCCTCGTTATGTGT-3'Mmc.multP.p10: 5'-AAGTTCCGTTTGAAATACCTG-3') can only amplify the Mmc genome sample, but cannot amplify specific bands for other ovine mycoplasmas (Mccp and Mo) and other important bacterial diseases of sheep. The above results show that the inventors screened and identified three ovine mycoplasma identification molecular targets and obtained effective specific primers, see Appendix. Figure 4 shown.

[0043] Step three, sensitivity is the key link of PCR technology. In order to verify the sensitivity of the new targets screened and identified and their specific primers, according to the instruction manual of Tiangen DNA extraction kit, Mo, Mccp, and Mmc genomic DNA were extracted respectively; the extracted DNA was used as a template, and the target sequence was amplified using the designed primers respectively; the amplified products were recovered and purified, and then connected to the T vector. The three ligation products were transformed into DH5-α competent cells, and the positive clones were screened and expanded after coating the plates, and the target plasmids were extracted for amplification and sequencing identification. After the recombinant plasmid standards were successfully constructed, the original copy numbers of the three recombinant plasmid standards can be obtained according to the copy number calculation formula, and then diluted to 1×10 8 copies / μL, and then dilute them 10 times, taking 1×10 7 , ~1×10 0 The sensitivity of the three mycoplasma-specific primers was analyzed according to the PCR system and reaction conditions described in step 2. It was found that the sensitivity of the detection primers designed for the DprA gene of Mo (Mo.multP.p80 / Mo.multP.p81) was 10 2 copies / μL, and the sensitivity of the detection primers (Mccp.multP.p3 / Mccp.multP.p32) designed for the Mccp MCCPF38_00240 gene was 10 1 copies / μL, and the detection primers designed for the restriction endonuclease subunit S gene of Mmc (Mmc.multP.p9 / Mmc.multP.p10) have a sensitivity of 10 2 The above results show that the sensitivity of the screened new mycoplasma target and its specific primers is 10-100 copies / μL, indicating that the PCR method established by the new mycoplasma target and its primers has high sensitivity and can be used for the detection of mycoplasma pathogens. See the attached Figure 5 shown.

[0044] Step 4: The new targets and specific primers screened by the present invention are mainly used for the simultaneous and rapid detection of mixed infection of mycoplasma. Therefore, in order to establish a triple PCR method for mixed infection of mycoplasma Mo, Mccp and Mmc, the effects of primer concentration, extension time and annealing temperature on the triple PCR detection method are explored. The specific scheme is implemented as follows:

[0045] 1. Screening of optimal primer concentration

[0046] pm_mix_1: 1μL each of p31, p32, p80, p81, p9, p10, 3μL ddH2O

[0047] pm_mix_5: 1.2 μL each of p31 and p32; 1 μL each of p80 and p81; 0.8 μL each of p9 and p10; 3 μL ddH2O

[0048] pm_mix_6: 1 μL each of p31 and p32; 0.8 μL each of p80 and p81; 0.6 μL each of p9 and p10; 4.2 μL ddH2O

[0049] pm_mix_7: 0.8 μL each of p31 and p32; 0.6 μL each of p80 and p81; 0.4 μL each of p9 and p10; 5.4 μL ddH2O

[0050] The PCR amplification system was: 10 μL 2×PCR Mix, 9 μL of the primer mixture, and 1 μL of sample 7 (three replicate wells). The reaction conditions were: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 53°C annealing for 30 s, 72°C extension for 15 s, 35 cycles; 72°C extension for 5 min.

[0051] 2. Screening of PCR amplification extension time

[0052] The PCR amplification system was: 10 μL 2×PCR Mix, 9 μL of the above pm_mix_7 primer mixture, and 1 μL of each of the above sample1, sample2, sample3, and sample 7 as templates. The reaction conditions were: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 53°C annealing for 30 s, 72°C extension for 30 s, 20 s, and 10 s, respectively, for 35 cycles; 72°C extension for 5 min.

[0053] 3. Optimal annealing temperature for PCR amplification

[0054] The PCR amplification system was: 10 μL 2×PCR Mix, 9 μL of the above pm_mix_7 primer mixture, and 1 μL of each of the above sample1, sample2, sample3, and sample 7 as templates. The reaction conditions were: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, annealing at 52°C, 56°C, and 62°C for 30 s, and extension at 72°C for 10 s, for 35 cycles; 72°C extension for 5 min. 98°C pre-denaturation for 10 min; 98°C denaturation for 10 s, 60°C annealing for 30 s, and 72°C extension for 1 min, for a total of 30 cycles; 72°C extension for 10 min; BspE gene upstream homology arm amplification system was 25 μL: Primer StarMax Premix: 12.5 μL; Template: 3 μL; BspE-up-F: 1 μL; BspE-down-R: 1 μL; ddH2O: 7.5 μL.

[0055] Through the above research, the technical conditions of the present invention were optimized, and the optimal PCR system was determined to be: total volume 20 μL (10 μL 2×PCR Mix, primer mixture (Mccp:Mo:Mmc=4:3:2) 9 μL, template 1 μL), the optimal PCR reaction program is: 95℃, 3min; 95℃, 15s, 53℃, 30s, 72℃, 10s, 35 cycles; 72℃, 5min. The entire PCR reaction process does not exceed 1 hour, and has good practical value for clinical detection. See attached Figure 6 shown.

[0056] Step 5: Using the established mycoplasma triple PCR detection method, the clinical disease materials and samples (Mo and Mccp) that tested positive for sheep mycoplasma infection were tested for compliance. From the test results, it can be seen that 4 sheep mycoplasma Mccp infection samples (Mccp positive, Mo / Mmc negative) (sample numbers 1-4), 1 mixed sample of three sheep mycoplasma infection (Mccp, Mo, Mmc are all positive) (sample number 5) and 2 samples of two sheep mycoplasma Mo infection (Mo positive, Mccp / Mmc are all negative) (sample numbers 7-8) can be accurately detected, which is consistent with expectations. This shows that the triple sheep mycoplasma PCR technology established by the present invention can be used for the diagnosis and detection of clinical sheep mycoplasma disease with good results. See attached Figure 7 shown.

[0057] Table 1 Primer information

[0058]

[0059]

[0060]

[0061]

[0062] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A triple PCR detection primer for Mycoplasma ovis Mo, Mccp, and Mmc, characterized in that: The primers for detecting Mo are shown in SEQ ID NOs. 1 to 2, the primers for detecting Mccp are shown in SEQ ID NOs. 3 to 4, and the primers for detecting Mmc are shown in SEQ ID NOs. 5 to 6.

2. Use of the triple PCR detection primers according to claim 1 in the preparation of a product for simultaneously detecting Mo, Mccp and Mmc.

3. Use of the triple PCR detection primers according to claim 1 in the preparation of products for diagnosing diseases caused by Mo, Mccp and / or Mmc infections.

4. The use according to claim 2 or claim 3, characterized in that: The product is a test kit.

5. A triple PCR detection method for detecting Mo, Mccp, and Mmc using the primers described in claim 1, characterized in that: Using the primer combination described in claim 1 to simultaneously perform PCR detection on Mo, Mccp, and Mmc; The PCR system was as follows: total volume 20 μL (10 μL 2×PCR Mix, primer mixture (Mccp:Mo:Mmc=4:3:2) 9 μL, template 1 μL), PCR reaction program was: 95°C, 3 min; 95°C, 15 s, 53°C, 30 s, 72°C, 10 s, 35 cycles; 72°C, 5 min; the entire PCR reaction process did not exceed 1 hour.

6. A diagnostic target for differential diagnosis of three mycoplasmas, Mo, Mccp and Mmc, and its specific diagnostic gene fragment, characterized in that: The nucleotide sequence of the Mo differential diagnostic target DprA is shown in SEQ ID NO.7; The nucleotide sequence of the target MCCPF38_00240 for Mccp differential diagnosis is shown in SEQ ID NO.8; The nucleotide sequence of restriction endonuclease subunit S, the target of Mmc differential diagnosis, is shown in SEQ ID NO.

9.

7. A method for establishing a triple PCR detection method for Mo, Mccp, and Mmc, characterized in that: The following steps are involved: Step 1: Use high-throughput Mauve genome colinearity analysis to identify specific differential segments among the three mycoplasma genomes; Step 2: design available PCR primer sequences based on the differential fragments; and screen out primer sequences that can be used for differential diagnosis through a primer library; Step 3: obtain differential diagnostic marker molecules through primer sequence amplification and sequencing, and verify the new diagnostic marker through specificity and sensitivity; Step 4: Using the new diagnostic marker for mycoplasma, a triple PCR method for differential diagnosis of mycoplasma ovis was established and optimized; Step 5: Use triple PCR method to conduct compliance test on clinical materials and samples positive for sheep Mycoplasma infection.

8. The method for establishing the Mo, Mccp, Mmc triple PCR detection method according to claim 7, characterized in that: The step three is specifically as follows: The target fragments were constructed on the PUC18-T vector, and plasmid standards were prepared. After calculating the gene copy number, 10-fold dilution was performed, and 1×107, 1×100 copies / μL of positive plasmids were taken for subsequent tests; The sensitivity of the three mycoplasma-specific primers was analyzed according to the PCR system and reaction conditions described in step 2.

9. The method for establishing the Mo, Mccp, Mmc triple PCR detection method according to claim 7, characterized in that: The step 4 is specifically as follows: To explore the effects of three mycoplasma specific identification primer concentrations, extension time and annealing temperature on the triple PCR detection method; The optimized triple PCR method for mixed infection of Mo, Mcp and Mmc determined the optimal PCR system as follows: total volume 20 μL (10 μL 2×PCR Mix, primer mixture (Mccp:Mo:Mmc=4:3:2) 9 μL, template 1 μL), the optimal PCR reaction program was: 95°C, 3 min; 95°C, 15 s, 53°C, 30 s, 72°C, 10 s, 35 cycles; 72°C, 5 min; Primer mixture sequences: Mo detection primer (Mo.multP.p80: 5'-GGATTCTTAAAGACCCGCCAT-3'; Mo.multP.p81: 5'-AATTTCCTTGCCAAGATCGAG-3'), Mcp detection primer (Mccp.multP.p31: 5'-CTTCCATAATCACTCCACGAT-3'Mccp.multP.p32: 5'-AGGACGTTGAATAACTCATGC-3'), Mmc detection primer (Mmc.multP.p9: 5'-ACAATTCCCTCGTTATGTGT-3'Mmc.multP.p10: 5'-AAGTTCCGTTTGAAATACCTG-3'); The entire PCR reaction process takes no more than 1 hour.

Images