Identification and application of watermelon seed aging process molecular marker

Abstract

The invention provides a molecular marker for identifying the aging process of watermelon seeds, the molecular marker comprises Cla97C04G070560 and Cla97C03G062270, and the sequences of the molecular marker and the Cla97C03G062270 are as shown in SEQ ID NO: 1 and SEQ ID NO: 2; the Cla97C04G070560 is used for coding cytochrome c oxidase, is an important protein in a mitochondrial respiratory chain, participates in an oxidative phosphorylation process, and has high conservative property in biotaxonomy; the Cla97C03G062270 is used for coding ribosomal protein, plays an important role in a protein synthesis process, and participates in assembly and stabilization of ribosomes. The invention further provides an identification method and application of the molecular marker. The application comprises the step of applying the molecular marker to watermelon seed aging detection. Through the molecular marker for the aging process of the watermelon seeds, the aging degree of the seeds can be evaluated by detecting the expression level of the aging gene marker, so that people can be helped to quickly detect and screen out the batches of the aged seeds, and the molecular marker has important significance for ensuring high-quality seed production and brings a more convenient means for subsequent breeding.

Description

Technical Field

[0001] The invention relates to the technical field of seed aging, and in particular to the identification and application of a molecular marker of the aging process of watermelon seeds. Background Art

[0002] Watermelon (Citrullus lanatus) is an important economic crop, and its seed germination rate and seedling growth directly affect the yield and quality of watermelon. However, watermelon seeds are prone to aging during storage, resulting in a decrease in germination rate, slow seedling growth, and even death, which seriously affects the production efficiency of watermelon. Therefore, studying the molecular mechanism of watermelon seed aging and screening and identifying aging gene markers can help us quickly detect and screen out aging seed batches, which is of great significance for ensuring high-quality seed production.

[0003] Seed aging refers to the phenomenon that seeds lose vitality, germination rate, and seedling growth due to the effects of various factors (such as oxygen, moisture, temperature, light, microorganisms, etc.) during storage. Seed aging is common in various crops, including watermelon, rice, corn, wheat, etc. Aged seeds not only have a reduced germination rate, but also slow seedling growth, reduced stress resistance, and are susceptible to infection by pests and diseases, ultimately leading to a decrease in yield and quality. The aging of watermelon seeds manifests itself in various forms, including: decreased germination rate, slow seedling growth, decreased stress resistance, and decreased fruit quality of seedlings germinated from aged seeds, such as smaller fruits, reduced sugar content, and uneven color.

[0004] Aging gene markers refer to genes whose expression changes significantly during seed aging and can be used to reflect the extent and progress of seed aging.

[0005] At present, there is no mature research on the molecular markers of the aging process of watermelon seeds, nor is there a mature method for identifying aged watermelon seeds. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a molecular marker for the aging process of watermelon seeds, so as to solve the problem that there is no mature research on the molecular marker for the aging process of watermelon seeds in the current prior art, and to provide a molecular marker that can identify the aging of watermelon seeds.

[0007] In order to solve the above problems, the present invention provides a molecular marker for the aging process of watermelon seeds, wherein the molecular marker includes Cla97C04G070560 and Cla97C03G062270, and the sequences are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0008] The two aging up-regulated indicator genes prepared by the present invention are Cla97C04G070560 and Cla97C03G062270, respectively. Cla97C04G070560 encodes cytochrome c oxidase, which is an important protein in the mitochondrial respiratory chain, participates in the oxidative phosphorylation process, and is highly conserved in biological taxonomy.

[0009] Cla97C03G062270 encodes a ribosomal protein, which plays an important role in protein synthesis and is mainly involved in the assembly and stabilization of ribosomes. The above-mentioned molecular markers can be used to better identify aged watermelon seeds, filling the gap in this field in the existing technology.

[0010] In one possible embodiment, the Cla97C04G070560 is used to encode cytochrome c oxidase, which is an important protein in the mitochondrial respiratory chain, participates in the oxidative phosphorylation process, and is highly conserved in biological taxonomy; the Cla97C03G062270 is used to encode ribosomal protein, which plays an important role in protein synthesis and is involved in the assembly and stabilization of ribosomes.

[0011] In a possible embodiment, the primers of Cla97C04G070560 include a forward primer F and a reverse primer R, and the base sequences thereof are:

[0012] Cla97C04G070560-F: GGAGGGGGAGACCCCATATT;

[0013] Cla97C04G070560-R:TGATACCGGATCAGGCAGA.

[0014] In a possible embodiment, the primers of Cla97C03G062270 include a forward primer F and a reverse primer R, and the base sequences thereof are:

[0015] Cla97C03G062270-F: CAGCCGAACAAGTAAGGGA;

[0016] Cla97C03G062270-R:GATTGCCATGTCTGCTCCGT.

[0017] The present invention can prepare watermelon seed aging process molecular markers through the primers.

[0018] The second technical problem to be solved by the present invention is to provide an identification method for the molecular markers of the aging process of watermelon seeds, so as to solve the problem that there is no mature research on the identification method for the molecular markers of the aging process of watermelon seeds in the existing technology, and to provide an identification method for the molecular markers that can identify the aging of watermelon seeds.

[0019] In order to solve the above technical problems, the present invention provides a method for identifying molecular markers of the aging process of watermelon seeds, comprising the following steps:

[0020] S1: collecting aging samples: placing watermelon seeds in an aging environment to age them, and collecting seed samples at different stages of the aging;

[0021] S2: Germination vitality test: The seed samples collected at different stages in step S1 are subjected to swelling treatment in clean water, and are placed in a germination box, and a seed germination experiment is carried out in a constant temperature incubator;

[0022] S3: transcriptome sequencing: extracting the total RNA of the seed samples collected at different stages in step S2, constructing a cDNA library, sequencing the library using RNA sequencing, and obtaining a gene expression profile;

[0023] S4: Data analysis: performing differential expression analysis on the gene expression profile data obtained in step S3 to screen genes with significant expression changes during the aging process;

[0024] S5: Verify candidate genes: Perform qPCR detection on candidate genes to verify their expression changes in different aging stages;

[0025] S6: Confirm the reliability of the marker: Repeat the validation experiment under the same experimental conditions to ensure the consistency of the results and obtain the molecular marker of the aging process of watermelon seeds.

[0026] The molecular markers prepared by the above preparation method can better evaluate the aging degree of seeds, and the preparation method is simple, which solves the problems existing in the prior art.

[0027] In a possible embodiment, in step S1, the aging environment is: temperature 40-45°C, humidity 90% RH; the seed samples collected at different stages include fresh seeds aged 0 days, early aged seeds aged 2 days and 6 days, and late aged seeds aged 12 days.

[0028] In a possible implementation, in step S2, the duration of the swelling treatment is 8-10 hours, and the temperature of the constant temperature incubator is 25-35°C.

[0029] Another technical problem to be solved by the present invention is to provide an application of the watermelon seed aging process molecular marker to solve the problem that there is no mature method for identifying aged watermelon seeds in the prior art. The application includes using the molecular marker to detect the aging of watermelon seeds, including the following steps:

[0030] A1: RNA extraction: freeze the aged seeds in liquid nitrogen for 5 minutes, grind the seeds into powder using a crusher, transfer the ground powder into a 2 ml centrifuge tube, extract total RNA, determine its concentration, and store at -80°C;

[0031] A2: cDNA synthesis: The total RNA extracted in step A1 is used as a template to synthesize the first strand of cDNA, and the product is used for qPCR reaction or stored at -20°C;

[0032] A3: Quantitative expression analysis of gene transcription markers: A fluorescent quantitative PCR reaction was performed using the first strand of cDNA obtained in A2 as a template, and the watermelon Actin gene ClACT was used as an internal reference gene for amplification reaction. The primers of ClACT included ClACT-F and ClACT-R, and their base sequences were:

[0033] ClACT-F:CCATGTATGTTGCCATCCAG;

[0034] CIACT-R:GGATAGCATGGGGTAGAGCA;

[0035] The fluorescence signal was monitored using a fluorescence quantitative PCR instrument. -ΔΔCt The formula calculates the expression changes of related genes;

[0036] A4: Relationship between expression level and seed germination rate: Absolute quantitative analysis of RNA is performed based on the expression changes obtained in step A3, thereby evaluating the degree of seed aging;

[0037] The step A4 comprises: preparation of a standard curve: extracting total RNA from a sample, obtaining a cDNA product by reverse transcription, amplifying a target gene fragment using a sequence containing a 5′-T7 promoter, performing in vitro transcription using T7 RNA polymerase to obtain a positive chain mRNA, treating with DNase enzyme, determining the concentration of mRNA after purification, and performing a continuous gradient dilution to obtain a series of samples with a concentration difference of 10 times, namely 4, 0.4, 0.04, 0.004, and 0.0004 (ng / μl), using this as a template for qRT-PCR amplification, and drawing a standard curve with the negative logarithm of the Ct value of each standard concentration sample relative to the concentration of the target gene mRNA, Ct=1.1277x+15.722.

[0038] Taking the transcriptional marker Cla97C04G070560 gene as an example, the aging of watermelon seeds aged for 2d and 12d was evaluated by absolute quantitative expression analysis. The relationship between the expression of Cla97C04G070560 gene and the germination rate of seeds was as follows: when 1μg of total RNA was used as the reverse transcription template, when Cq≥25.31 (expression≤5.26*10^7mRNA copies), the germination rate was not affected; when 20.22≤Cq<21.19 (6.69*10^8mRNA copies≤expression<1.19*10^9mRNA copies), the germination rate and uniformity began to decrease, but the germination rate remained unchanged, indicating the beginning of aging; when the expression level was in the range of Cq≤20.22 (expression≥1.19*10^9mRNA copies), the germination rate decreased, indicating the acceleration of aging.

[0039] By using the above molecular markers of the present invention in the detection of watermelon seed aging, based on the molecular biological screening method, RNA sequencing is used to analyze the gene expression profiles of seeds at different aging stages, and differentially expressed genes are screened. Further, qPCR detection is performed on the candidate genes to verify their expression changes at different stages, confirm the reliability and consistency of the markers, and the operation of the application is relatively simple, cheap, and has low labor, which can help us quickly detect and screen out aging seed batches, which is of great significance for ensuring high-quality seed production, ensuring the production quality of seeds, and also helps to study the molecular mechanism of watermelon seed aging. By detecting the expression level of aging gene markers, the aging degree of seeds can be evaluated.

[0040] In a possible embodiment, in step A2, the reaction system and steps for cDNA synthesis include: reaction system: 12-xμl RNase free ddH2O, 4μl 4×gDNAwiper Mix, xμl template RNA, and the total amount of RNA added is 1μg, mixed by pipetting, reacted at 42°C for 2 minutes, and genomic DNA was removed; after the reaction, 4μl 5×HiScript ll qRT SuperMix ll was added, gently flicked to mix, reacted at 50°C for 15 minutes, and then reacted at 85°C for 5s.

[0041] In a possible embodiment, in step A3, the fluorescent quantitative PCR reaction system is: 10μl SYBR Mix, 4μl ddH2O, 0.5μl F Primer, 0.5μl R Primer, 5μl cDNA, and the cDNA is a product obtained by diluting 10 times the original template; the reaction procedure is: pre-denaturation at 95°C for 5min, denaturation at 95°C for 10s, annealing at 60°C for 30s, and 40 cycles.

[0042] The application of a watermelon seed aging process molecular marker in the present invention further improves the accuracy of seed aging degree assessment by controlling the above-mentioned fluorescence quantitative PCR reaction system and cDNA synthesis reaction system and step conditions and reaction process. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is a graph showing the effect of artificial accelerated aging on watermelon seed germination;

[0044] Figure 2 The diagrams are relative expression diagrams of genes, wherein the left diagram is the relative expression diagram of Cla97C04G07056 gene, and the right diagram is the relative expression diagram of Cla97C03G062270 gene.

[0045] Figure 3 Make a graph for the standard curve of the Cla97C04G070560 gene;

[0046] Figure 4 Schematic diagram of the expression Cq value of the Cla97C04G070560 gene. DETAILED DESCRIPTION

[0047] First, those skilled in the art should understand that these implementations are only used to explain the technical principles of the embodiments of the present application, and are not intended to limit the protection scope of the embodiments of the present application. Those skilled in the art can make adjustments to them as needed to adapt to specific application scenarios.

[0048] The present invention provides a molecular marker for the aging process of watermelon seeds, and the molecular marker comprises

[0049] Cla97C04G070560 and Cla97C03G062270, and the sequences are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0050] As a preferred solution, the Cla97C04G070560 is used to encode cytochrome c oxidase, which is an important protein in the mitochondrial respiratory chain, participates in the oxidative phosphorylation process, and is highly conserved in biological taxonomy; the Cla97C03G062270 is used to encode ribosomal protein, which plays an important role in protein synthesis and participates in the assembly and stabilization of ribosomes.

[0051] As a preferred solution, the primers of Cla97C04G070560 include a forward primer F and a reverse primer R, and the base sequences thereof are:

[0052] Cla97C04G070560-F: GGAGGGGGAGACCCCATATT;

[0053] Cla97C04G070560-R:TGATACCGGATCAGGCAGA.

[0054] As a preferred solution, the primers of Cla97C03G062270 include a forward primer F and a reverse primer R, and the base sequences thereof are:

[0055] Cla97C03G062270-F: CAGCCGAACAAGTAAGGGA;

[0056] Cla97C03G062270-R:GATTGCCATGTCTGCTCCGT.

[0057] The present invention also provides a method for identifying the molecular markers of the aging process of watermelon seeds, comprising the following steps:

[0058] S1: collecting aging samples: placing watermelon seeds in an aging environment to age them, and collecting seed samples at different stages of the aging;

[0059] S2: Germination vitality test: The seed samples collected at different stages in step S1 are subjected to swelling treatment in clean water, and are placed in a germination box, and a seed germination experiment is carried out in a constant temperature incubator;

[0060] S3: transcriptome sequencing: extracting the total RNA of the seed samples collected at different stages in step S2, constructing a cDNA library, sequencing the library using RNA sequencing, and obtaining a gene expression profile;

[0061] S4: Data analysis: performing differential expression analysis on the gene expression profile data obtained in step S3 to screen genes with significant expression changes during the aging process;

[0062] S5: Verify candidate genes: Perform qPCR detection on candidate genes to verify their expression changes in different aging stages;

[0063] S6: Confirm the reliability of the marker: Repeat the validation experiment under the same experimental conditions to ensure the consistency of the results and obtain the molecular marker of the aging process of watermelon seeds.

[0064] As a preferred solution, in step S1, the aging environment is: temperature 40-45°C, humidity 90% RH; the seed samples collected at different stages include fresh seeds aged 0 days, early aged seeds aged 2 days and 6 days, and late aged seeds aged 12 days.

[0065] As a preferred solution, in step S2, the time of the swelling treatment is 8-10 hours, and the temperature of the constant temperature incubator is 25-35°C.

[0066] The present invention also provides an application of the watermelon seed aging process molecular marker, which includes using the molecular marker to detect watermelon seed aging, including the following steps:

[0067] A1: RNA extraction: freeze the aged seeds in liquid nitrogen for 5 minutes, grind the seeds into powder using a crusher, transfer the ground powder into a 2 ml centrifuge tube, extract total RNA, determine its concentration, and store at -80°C;

[0068] A2: cDNA synthesis: The total RNA extracted in step A1 is used as a template to synthesize the first strand of cDNA, and the product is used for qPCR reaction or stored at -20°C;

[0069] A3: Quantitative expression analysis of gene transcription markers: A fluorescent quantitative PCR reaction was performed using the first strand of cDNA obtained in A2 as a template, and the watermelon Actin gene ClACT was used as an internal reference gene for amplification reaction. The primers of ClACT included ClACT-F and ClACT-R, and their base sequences were:

[0070] ClACT-F:CCATGTATGTTGCCATCCAG;

[0071] CIACT-R:GGATAGCATGGGGTAGAGCA;

[0072] The fluorescence signal was monitored using a fluorescence quantitative PCR instrument. -ΔΔCt The formula calculates the expression changes of related genes;

[0073] A4: Relationship between expression level and seed germination rate: The expression changes obtained in step A3 are used to perform absolute quantitative analysis on RNA, thereby evaluating the degree of seed aging.

[0074] The step A4 comprises: preparation of a standard curve: extracting total RNA from a sample, obtaining a cDNA product by reverse transcription, amplifying a target gene fragment using a sequence containing a 5′-T7 promoter, performing in vitro transcription using T7 RNA polymerase to obtain a positive chain mRNA, treating with DNase enzyme, determining the concentration of mRNA after purification, and performing a continuous gradient dilution to obtain a series of samples with a concentration difference of 10 times, namely 4, 0.4, 0.04, 0.004, and 0.0004 (ng / μl), using this as a template for qRT-PCR amplification, and drawing a standard curve with the negative logarithm of the Ct value of each standard concentration sample relative to the concentration of the target gene mRNA, Ct=1.1277x+15.722.

[0075] Taking the transcriptional marker Cla97C04G070560 gene as an example, the aging of watermelon seeds aged for 2d and 12d was evaluated by absolute quantitative expression analysis. The relationship between the expression of the Cla97C04G070560 gene and the germination rate of seeds was as follows: when 1000ng of total RNA was used as the reverse transcription template, when Cq≥25.31 (expression≤5.26*10^7mRNA copies), the germination rate was not affected; when 20.22≤Cq<21.19 (6.69*10^8mRNA copies≤expression<1.19*10^9mRNA copies), the germination rate and uniformity began to decrease, but the germination rate remained unchanged, indicating the beginning of aging; when the expression level was in the range of Cq≤20.22 (expression≥1.19*10^9mRNA copies), the germination rate decreased, indicating the acceleration of aging.

[0076] The sequence information of CIACT, Cla97C04G070560 and Cla97C03G062270 is shown in the following table:

[0077] Table 1: Sequence information of CIACT, Cla97C04G070560 and Cla97C03G062270

[0078]

[0079] As a preferred solution, in step A2, the reaction system and steps for cDNA synthesis include: reaction system: 12-xμl RNase free ddH2O, 4μl 4×gDNAwiper Mix, xμl template RNA, and the total amount of RNA added is 1μg, mixed by pipetting, reacted at 42°C for 2 minutes, and genomic DNA was removed; after the reaction, 4μl 5×HiScript ll qRT SuperMix ll was added, gently flicked to mix, reacted at 50°C for 15 minutes, and then reacted at 85°C for 5s.

[0080] As a preferred solution, in step A3, the fluorescent quantitative PCR reaction system is: 10μl SYBR Mix, 4μl ddH2O, 0.5μl F Primer, 0.5μl R Primer, 5μl cDNA, and the cDNA is a product obtained by diluting 10 times the original template; the reaction procedure is: pre-denaturation at 95°C for 5min, denaturation at 95°C for 10s, annealing at 60°C for 30s, and 40 cycles.

[0081] The following is a specific example of the above-mentioned technical solution of the present invention, in combination with the above-mentioned data range:

[0082] Embodiment 1:

[0083] This embodiment provides an identification and application of molecular markers of watermelon seed aging process, including:

[0084] A molecular marker for the aging process of watermelon seeds, comprising Cla97C04G070560 and

[0085] Cla97C03G062270, and the sequences are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0086] The Cla97C04G070560 is used to encode cytochrome c oxidase, which is an important protein in the mitochondrial respiratory chain, participates in the oxidative phosphorylation process, and is highly conserved in biological taxonomy; the Cla97C03G062270 is used to encode ribosomal protein, which plays an important role in the protein synthesis process and participates in the assembly and stability of ribosomes.

[0087] The primers of Cla97C04G070560 include a forward primer F and a reverse primer R, and the base sequences thereof are:

[0088] Cla97C04G070560-F: GGAGGGGGAGACCCCATATT;

[0089] Cla97C04G070560-R:TGATACCGGATCAGGCAGA.

[0090] The primers of Cla97C03G062270 include a forward primer F and a reverse primer R, and the base sequences thereof are:

[0091] Cla97C03G062270-F: CAGCCGAACAAGTAAGGGA;

[0092] Cla97C03G062270-R:GATTGCCATGTCTGCTCCGT.

[0093] S1: Collecting aging samples: Watermelon seeds were placed in 42°C and 90% (RH) conditions to accelerate aging. Seed samples were collected at different stages of aging, including fresh seeds (0 days of aging), early aged seeds (2 days of aging and 6 days of aging), and late aged seeds (12 days of aging);

[0094] S2: Germination vitality test: seeds at different aging stages were imbibed in clean water for 8 h, neatly placed in a germination box, and subjected to a seed germination experiment in a 30°C constant temperature incubator, and compared with the control treatment aged for 0 d (CK);

[0095] like Figure 1As shown in the figure, with the increase of aging time, the maximum germination rate of aging treatment at 2d and 6d was not significantly different from that of the control group (P>0.05). From the 12th day of aging, the maximum germination rate showed a downward trend (P<0.05) ( Figure 1 -AB). The seed germination uniformity and T50 (the time taken for the seed germination rate to reach 50% of the final maximum germination rate, negatively correlated with the germination rate) began to increase significantly from 2 days of aging (P < 0.05), and further increased significantly after 6 and 12 days of aging (P < 0.05) ( Figure 1 -CD).

[0096] Figure 2 The left figure is a relative expression diagram of Cla97C03G062270 and Cla97C04G070560, wherein the left figure is a relative expression diagram of Cla97C04G07056 gene, and the right figure is a relative expression diagram of Cla97C03G062270 gene; Figure 4 Schematic diagram of the expression Cq value of the Cla97C04G070560 gene.

[0097] S3: Transcriptome sequencing: Extract total RNA from seed samples at different aging stages, construct cDNA libraries, and sequence the libraries using RNA sequencing to obtain gene expression profiles.

[0098] S4: Data analysis: Differential expression analysis was performed on the gene expression data to screen for genes whose expression significantly changed during the aging process.

[0099] S5: Verify candidate genes: Perform qPCR detection on candidate genes to verify their expression changes in different aging stages.

[0100] S6: Confirm the reliability of the marker: Repeat the validation experiment under the same experimental conditions to ensure the consistency of the results and obtain the molecular marker.

[0101] This embodiment also provides an application of the watermelon seed aging process molecular marker, which includes using the molecular marker to detect watermelon seed aging, including the following steps:

[0102] A1: RNA extraction: prepare samples in advance, freeze aged seeds in liquid nitrogen for 5 minutes, grind the seeds into powder with a crusher, transfer the ground powder to a 2 ml centrifuge tube, extract RNA according to the Tiangen RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Kit method, determine its concentration with Nanodrop, and store at -80°C.

[0103] A2: cDNA synthesis: The reaction system was 12-xμl RNase free ddH2O, 4μl 4×gDNAwiper Mix, and xμl template RNA (the total amount of RNA added was 1μg). The mixture was mixed by pipetting and reacted at 42°C for 2 minutes to remove genomic DNA. After the reaction, 4μl 5×HiScript ll qRT SuperMix ll was added and gently flicked to mix. The mixture was reacted at 50°C for 15 minutes and then at 85°C for 5s. The product was used for qPCR reaction or stored at -20°C. The HiScript ll Q RT SuperMix kit was purchased from Nanjing Novozymes Biotech Co., Ltd.

[0104] A3: Quantitative expression analysis of gene transcription markers: The fluorescence quantitative PCR reaction system was 10 μl SYBR Mix, 4 μl ddH2O, 0.5 μl F Primer, 0.5 μl R Primer, 5 μl cDNA (the product obtained by diluting 10 times based on the original template); the reaction procedure was pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 10 s, annealing at 60℃ for 30 s, and 40 cycles. The watermelon Actin gene ClACT was used as the internal reference gene, and the changes in fluorescence signals were monitored using a Bio-Rad CFX96 fluorescence quantitative PCR instrument. 2 -ΔΔCt The expression changes of related genes were calculated by formula; and the primers of ClACT include ClACT-F and ClACT-R, and their base sequences are:

[0105] ClACT-F:CCATGTATGTTGCCATCCAG;

[0106] CIACT-R:GGATAGCATGGGGTAGAGCA;

[0107] like Figure 2 As shown, the expression levels of genes encoding cytochrome c oxidase Cla97C04G070560 and ribosomal protein Cla97C03G062270 showed an upward trend from 2 days of aging (P < 0.05), and were further significantly upregulated after 6 and 12 days of aging (P < 0.05).

[0108] A4: Relationship between expression level and seed germination rate:

[0109] Preparation of standard curve: Figure 3As shown, total RNA of the sample was extracted, and cDNA products were obtained by reverse transcription. The target gene fragment was amplified using a sequence containing a 5′-T7 promoter, and T7 RNA polymerase was used for in vitro transcription to obtain positive chain mRNA. The mRNA concentration was determined after DNase treatment and purification, and a series of samples with a concentration difference of 10 times were obtained, namely 4, 0.4, 0.04, 0.004, and 0.0004 (ng / μl), which were used as templates for qRT-PCR amplification. The standard curve was drawn with the negative logarithm of the Ct value of each standard concentration sample relative to the concentration of the target gene mRNA, Ct=1.1277x+15.722.

[0110] like Figure 3 , Figure 4 As shown in the figure, taking the transcription marker Cla97C04G070560 gene as an example, the aging of watermelon seeds aged for 2d and 12d was evaluated by absolute quantitative expression analysis. The relationship between the expression of Cla97C04G070560 gene and the germination rate of seeds is that when 1000ng of total RNA is used as the reverse transcription template, when Cq≥25.31 (expression≤5.26*10^7mRNA copies (copies)), the germination rate is not affected; when 20.22≤Cq<21.19 (6.69*10^8mRNA copies≤expression<1.19*10^9mRNA copies), the germination rate and uniformity begin to decrease, but the germination rate remains unchanged, indicating the beginning of aging; when the expression level is in the range of Cq≤20.22 (expression≥1.19*10^9mRNA copies), the germination rate decreases, indicating the acceleration of aging.

[0111] Embodiment 2:

[0112] This embodiment provides an identification and application of molecular markers of watermelon seed aging process, including:

[0113] A molecular marker for the aging process of watermelon seeds, comprising Cla97C04G070560 and

[0114] Cla97C03G062270, and the sequences are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0115] The Cla97C04G070560 is used to encode cytochrome c oxidase, which is an important protein in the mitochondrial respiratory chain, participates in the oxidative phosphorylation process, and is highly conserved in biological taxonomy; the Cla97C03G062270 is used to encode ribosomal protein, which plays an important role in the protein synthesis process and participates in the assembly and stability of ribosomes.

[0116] The primers of Cla97C04G070560 include a forward primer F and a reverse primer R, and the base sequences thereof are:

[0117] Cla97C04G070560-F: GGAGGGGGAGACCCCATATT;

[0118] Cla97C04G070560-R:TGATACCGGATCAGGCAGA.

[0119] The primers of Cla97C03G062270 include a forward primer F and a reverse primer R, and the base sequences thereof are:

[0120] Cla97C03G062270-F: CAGCCGAACAAGTAAGGGA;

[0121] Cla97C03G062270-R:GATTGCCATGTCTGCTCCGT.

[0122] S1: Collection of aging samples: Watermelon seeds were placed in 40°C and 90% (RH) conditions to accelerate aging. Seed samples were collected at different stages of aging, including fresh seeds (0 days of aging), early aged seeds (2 days of aging and 6 days of aging), and late aged seeds (12 days of aging).

[0123] S2: Germination vitality test: seeds at different aging stages were imbibed in clean water for 8 h, neatly placed in a germination box, and subjected to a seed germination experiment in a constant temperature incubator at 25°C, and compared with the control treatment aged 0 days (CK).

[0124] S3: Transcriptome sequencing: Extract total RNA from seed samples at different aging stages, construct cDNA libraries, and sequence the libraries using RNA sequencing to obtain gene expression profiles.

[0125] S4: Data analysis: Differential expression analysis was performed on the gene expression data to screen for genes whose expression significantly changed during the aging process.

[0126] S5: Verify candidate genes: Perform qPCR detection on candidate genes to verify their expression changes in different aging stages.

[0127] S6: Confirm the reliability of the marker: Repeat the validation experiment under the same experimental conditions to ensure the consistency of the results and obtain the molecular marker.

[0128] This embodiment also provides an application of the watermelon seed aging process molecular marker, which includes using the molecular marker to detect watermelon seed aging, including the following steps:

[0129] A1: RNA extraction: prepare samples in advance, freeze aged seeds in liquid nitrogen for 5 minutes, grind the seeds into powder with a crusher, transfer the ground powder to a 2 ml centrifuge tube, extract RNA according to the Tiangen RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Kit method, determine its concentration with Nanodrop, and store at -80°C.

[0130] A2: cDNA synthesis: The reaction system was 12-xμl RNase free ddH2O, 4μl 4×gDNAwiper Mix, and xμl template RNA (the total amount of RNA added was 1μg). The mixture was mixed by pipetting and reacted at 42°C for 2 minutes to remove genomic DNA. After the reaction, 4μl 5×HiScript ll qRT SuperMix ll was added and gently flicked to mix. The mixture was reacted at 50°C for 15 minutes and then at 85°C for 5s. The product was used for qPCR reaction or stored at -20°C. The HiScript ll Q RT SuperMix kit was purchased from Nanjing Novozymes Biotech Co., Ltd.

[0131] A3: Quantitative expression analysis of gene transcription markers: The fluorescence quantitative PCR reaction system was 10 μl SYBR Mix, 4 μl ddH2O, 0.5 μl F Primer, 0.5 μl R Primer, 5 μl cDNA (the product obtained by diluting 10 times based on the original template); the reaction procedure was pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 10 s, annealing at 60℃ for 30 s, and 40 cycles. The watermelon Actin gene ClACT was used as the internal reference gene, and the changes in fluorescence signals were monitored using a Bio-Rad CFX96 fluorescence quantitative PCR instrument. 2 -ΔΔCt The expression changes of related genes were calculated by formula; and the primers of ClACT include ClACT-F and ClACT-R, and their base sequences are:

[0132] ClACT-F:CCATGTATGTTGCCATCCAG;

[0133] CIACT-R:GGATAGCATGGGGTAGAGCA;

[0134] A4: Relationship between expression level and seed germination rate: Relationship between expression level and seed germination rate: Absolute quantitative analysis of RNA is performed based on the expression changes obtained in step A3, thereby evaluating the degree of seed aging.

[0135] Embodiment 3:

[0136] This embodiment provides an identification and application of molecular markers of watermelon seed aging process, including:

[0137] A molecular marker for the aging process of watermelon seeds, comprising Cla97C04G070560 and

[0138] Cla97C03G062270, and the sequences are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0139] The Cla97C04G070560 is used to encode cytochrome c oxidase, which is an important protein in the mitochondrial respiratory chain, participates in the oxidative phosphorylation process, and is highly conserved in biological taxonomy; the Cla97C03G062270 is used to encode ribosomal protein, which plays an important role in the protein synthesis process and participates in the assembly and stability of ribosomes.

[0140] The primers of Cla97C04G070560 include a forward primer F and a reverse primer R, and the base sequences thereof are:

[0141] Cla97C04G070560-F: GGAGGGGGAGACCCCATATT;

[0142] Cla97C04G070560-R:TGATACCGGATCAGGCAGA.

[0143] The primers of Cla97C03G062270 include a forward primer F and a reverse primer R, and the base sequences thereof are:

[0144] Cla97C03G062270-F: CAGCCGAACAAGTAAGGGA;

[0145] Cla97C03G062270-R:GATTGCCATGTCTGCTCCGT.

[0146] S1: Collection of aging samples: Watermelon seeds were placed in 45°C and 90% (RH) conditions to accelerate aging. Seed samples were collected at different stages of aging, including fresh seeds (0 days of aging), early aged seeds (2 days of aging and 6 days of aging), and late aged seeds (12 days of aging).

[0147] S2: Germination vitality test: seeds at different aging stages were imbibed in clean water for 10 h, neatly placed in a germination box, and subjected to a seed germination experiment in a 35°C constant temperature incubator, and compared with the control treatment aged 0 d (CK).

[0148] S3: Transcriptome sequencing: Extract total RNA from seed samples at different aging stages, construct cDNA libraries, and sequence the libraries using RNA sequencing to obtain gene expression profiles.

[0149] S4: Data analysis: Differential expression analysis was performed on the gene expression data to screen for genes whose expression significantly changed during the aging process.

[0150] S5: Verify candidate genes: Perform qPCR detection on candidate genes to verify their expression changes in different aging stages.

[0151] S6: Confirm the reliability of the marker: Repeat the validation experiment under the same experimental conditions to ensure the consistency of the results and obtain the molecular marker.

[0152] This embodiment also provides an application of the watermelon seed aging process molecular marker, which includes using the molecular marker to detect watermelon seed aging, including the following steps:

[0153] A1: RNA extraction: prepare samples in advance, freeze aged seeds in liquid nitrogen for 5 minutes, grind the seeds into powder with a crusher, transfer the ground powder to a 2 ml centrifuge tube, extract RNA according to the Tiangen RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Kit method, determine its concentration with Nanodrop, and store at -80°C.

[0154] A2: cDNA synthesis: The reaction system was 12-xμl RNase free ddH2O, 4μl 4×gDNAwiper Mix, and xμl template RNA (the total amount of RNA added was 1μg). The mixture was mixed by pipetting and reacted at 42°C for 2 minutes to remove genomic DNA. After the reaction, 4μl 5×HiScript ll qRT SuperMix ll was added and gently flicked to mix. The mixture was reacted at 50°C for 15 minutes and then at 85°C for 5s. The product was used for qPCR reaction or stored at -20°C. The HiScript ll Q RT SuperMix kit was purchased from Nanjing Novozymes Biotech Co., Ltd.

[0155] A3: Quantitative expression analysis of gene transcription markers: The fluorescence quantitative PCR reaction system was 10 μl SYBR Mix, 4 μl ddH2O, 0.5 μl F Primer, 0.5 μl R Primer, 5 μl cDNA (the product obtained by diluting 10 times based on the original template); the reaction procedure was pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 10 s, annealing at 60℃ for 30 s, and 40 cycles. The watermelon Actin gene ClACT was used as the internal reference gene, and the changes in fluorescence signals were monitored using a Bio-Rad CFX96 fluorescence quantitative PCR instrument. 2 -ΔΔCt The expression changes of related genes were calculated by formula; and the primers of ClACT include ClACT-F and ClACT-R, and their base sequences are:

[0156] ClACT-F:CCATGTATGTTGCCATCCAG;

[0157] CIACT-R:GGATAGCATGGGGTAGAGCA;

[0158] A4: Relationship between expression level and seed germination rate:

[0159] Relationship between expression level and seed germination rate: The expression changes obtained in step A3 are used to perform absolute quantitative analysis on RNA, thereby evaluating the degree of seed aging.

[0160] In the description of the present application, the description with reference to the terms "one embodiment", "some embodiments", "in the present embodiment", "specific example", or "some examples" etc. means that the specific features, mechanisms, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, mechanisms, materials or characteristics described may be combined in a suitable manner in any one or more embodiments or examples. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0161] The above is only a specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed in the present application should be included in the protection scope of the present application. Therefore, the protection scope of the present application shall be based on the protection scope of the claims.

Claims

1. A molecular marker for the aging process of watermelon seeds, characterized in that: The molecular markers include Cla97C04G070560 and Cla97C03G062270, and the sequences are shown in SEQ ID NO:1 and SEQ ID NO:

2.

2. The watermelon seed aging process molecular marker according to claim 1, characterized in that: The Cla97C04G070560 is used to encode cytochrome c oxidase, which is an important protein in the mitochondrial respiratory chain, participates in the oxidative phosphorylation process, and is highly conserved in biological taxonomy; the Cla97C03G062270 is used to encode ribosomal protein, which plays an important role in the protein synthesis process and participates in the assembly and stability of ribosomes.

3. The watermelon seed aging process molecular marker according to claim 1, characterized in that: The primers of Cla97C04G070560 include a forward primer F and a reverse primer R, and the base sequences thereof are: Cla97C04G070560-F: GGAGGGGGAGACCCCATATT; Cla97C04G070560-R:TGATACCGGATCAGGCAGA.

4. The watermelon seed aging process molecular marker according to claim 1, characterized in that: The primers of Cla97C03G062270 include a forward primer F and a reverse primer R, and the base sequences thereof are: Cla97C03G062270-F: CAGCCGAACAAGTAAGGGA; Cla97C03G062270-R:GATTGCCATGTCTGCTCCGT.

5. A method for identifying molecular markers of watermelon seed aging process according to any one of claims 1 to 4, characterized in that: The following steps are involved: S1: collecting aging samples: placing watermelon seeds in an aging environment to age them, and collecting seed samples at different stages of the aging; S2: Germination vitality test: The seed samples collected at different stages in step S1 are subjected to swelling treatment in clean water, and are placed in a germination box, and a seed germination experiment is carried out in a constant temperature incubator; S3: transcriptome sequencing: extracting the total RNA of the seed samples collected at different stages in step S2, constructing a cDNA library, and sequencing the library using RNA sequencing to obtain a gene expression profile; S4: Data analysis: performing differential expression analysis on the gene expression profile data obtained in step S3 to screen genes with significant expression changes during the aging process; S5: Verify candidate genes: Perform qPCR detection on candidate genes to verify their expression changes in different aging stages; S6: Confirm the reliability of the marker: Repeat the validation experiment under the same experimental conditions to ensure the consistency of the results and obtain the molecular marker of the aging process of watermelon seeds.

6. The method for identifying molecular markers of watermelon seed aging process according to claim 5, characterized in that: In step S1, the aging environment is: temperature 40-45°C, humidity 90%RH; the seed samples collected at different stages include fresh seeds aged 0 days, early aged seeds aged 2 days and 6 days, and late aged seeds aged 12 days.

7. The method for identifying molecular markers of watermelon seed aging process according to claim 5, characterized in that: In the step S2, the duration of the swelling treatment is 8-10 hours, and the temperature of the constant temperature incubator is 25-35°C.

8. An application of the molecular marker of watermelon seed aging process according to claims 1-4, characterized in that: The application includes using the molecular marker to detect watermelon seed aging, including the following steps: A1: RNA extraction: freeze the aged seeds in liquid nitrogen for 5 minutes, grind the seeds into powder using a crusher, transfer the ground powder into a 2 ml centrifuge tube, extract total RNA, determine its concentration, and store at -80°C; A2: cDNA synthesis: The total RNA extracted in step A1 is used as a template to synthesize the first strand of cDNA, and the product is used for qPCR reaction or stored at -20°C; A3: Quantitative expression analysis of gene transcription markers: A fluorescent quantitative PCR reaction was performed using the first strand of cDNA obtained in A2 as a template, and the watermelon Actin gene ClACT was used as an internal reference gene for amplification reaction. The primers of ClACT included ClACT-F and ClACT-R, and their base sequences were: ClACT-F:CCATGTATGTTGCCATCCAG; CIACT-R:GGATAGCATGGGGTAGAGCA; The fluorescence signal was monitored using a fluorescence quantitative PCR instrument. -ΔΔCt The formula calculates the expression changes of related genes; A4: Relationship between expression level and seed germination rate: The expression changes obtained in step A3 are used to perform absolute quantitative analysis on RNA to evaluate the degree of seed aging, and a standard curve is drawn based on the obtained data to obtain the relationship between the Ct value and the RNA starting concentration: Ct=1.1277x+15.722, where x is the negative logarithm of the concentration of the target gene mRNA.

9. The use of the molecular marker of watermelon seed aging process according to claim 8, characterized in that: In the step A2, the reaction system and steps for cDNA synthesis include: reaction system: 12-xμl RNase free ddH2O, 4μl 4×gDNAwiper Mix, xμl template RNA, and the total amount of RNA added is 1μg, mixed by pipetting, reacted at 42°C for 2 minutes, and genomic DNA was removed; after the reaction, 4μl 5×HiScript ll qRT SuperMix ll was added, gently flicked to mix, reacted at 50°C for 15 minutes, and then reacted at 85°C for 5s.

10. The use of the molecular marker of watermelon seed aging process according to claim 8, characterized in that: In step A3, the fluorescent quantitative PCR reaction system is: 10 μl SYBR Mix, 4 μl ddH2O, 0.5 μl F Primer, 0.5 μl R Primer, 5 μl cDNA, and the cDNA is a product obtained by diluting 10 times the original template; the reaction procedure is: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing at 60°C for 30 s, and 40 cycles.

Images