SNP (Single Nucleotide Polymorphism) molecular marker related to florescence of chrysanthemum and application of SNP molecular marker

Abstract

The invention belongs to the technical field of gene molecular markers, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker related to florescence of chrysanthemum and application of the SNP molecular marker. The SNP molecular marker obviously related to the florescence of the chrysanthemum is found on the florescence control gene BBX24 of the chrysanthemum, and a molecular marker database of the florescence of the chrysanthemum is enriched. Research finds that BBX24 gene detection can be performed on chrysanthemum varieties of different flowering ecotypes based on the SNP molecular marker on the chrysanthemum flowering phase control gene BBX24, and then the flowering phase control gene BBX24 can be rapidly and accurately detected in different germplasm resources such as summer chrysanthemum, autumn chrysanthemum and summer autumn chrysanthemum, so that identification of ecological chrysanthemums of different flowering phases is realized. The SNP molecular marker can be used for foreground selection in the early stage of molecular marker-assisted breeding, the scale of breeding populations is reduced, the breeding process is accelerated, and the BBX24 gene can be favorably and efficiently applied to biological breeding for improving the flowering phase of chrysanthemum.

Description

Technical Field

[0001] The invention belongs to the technical field of gene molecular markers, and particularly relates to a SNP molecular marker associated with the flowering period of chrysanthemum and an application thereof. Background Art

[0002] Chrysanthemum is a precious ornamental flower cultivated through long-term artificial selection. It is known as one of the "Four Gentlemen" among flowers and has a cultivation history of more than 3,000 years in my country. The flowering time of chrysanthemum varies depending on the variety and season. It can be divided into summer chrysanthemum, summer-autumn chrysanthemum, autumn chrysanthemum and winter chrysanthemum. Among them, summer chrysanthemum: also known as Wujiu chrysanthemum, it blooms once in June; summer-autumn chrysanthemum type blooms once in June and September; autumn chrysanthemum: this is the most common chrysanthemum category, the flowering period is from September to October, and it has a certain cold resistance; winter chrysanthemum: also known as cold chrysanthemum, usually blooms in November, named because it can bloom in a cold environment.

[0003] Chrysanthemum is a short-day plant. The short-day conditions in autumn will stimulate the differentiation of flower buds and flowering, which is one of the reasons why chrysanthemums bloom in autumn. The flowering of chrysanthemums is mainly induced by short-day signals. In the long-term evolution, chrysanthemums have evolved a variety of adaptation types that are sensitive to light or temperature. The flowering of some types of chrysanthemums is more sensitive to photoperiods, while some types are more sensitive to temperature changes, which is related to the differences in their flowering regulatory genes.

[0004] In order to better explore the flowering pathway of chrysanthemum, discover the excellent genes that control the flowering ecotype of chrysanthemum, and cultivate more chrysanthemum varieties with different flowering types, gene screening methods are now often used to explore the regulatory genes related to the flowering time of chrysanthemum. However, traditional gene screening methods often require a lot of time and plant resources, and the identification and screening of chrysanthemum flowering ecotype genes becomes particularly difficult due to the high heterozygosity and high ploidy of chrysanthemum. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to the flowering period of chrysanthemum and its application. The SNP molecular marker is significantly correlated with the chrysanthemum flowering period controlling gene BBX24 and the chrysanthemum flowering period, and can be used to identify the genotype of the chrysanthemum flowering period controlling gene BBX24 and the chrysanthemum flowering period, distinguish chrysanthemum varieties, and enrich the chrysanthemum flowering period molecular marker database.

[0006] The invention provides a SNP molecular marker related to the flowering period of chrysanthemum. The SNP molecular marker is located at the 153rd site of the coding region of the BBX24 gene, and the polymorphism is A / G. The accession number of the BBX24 gene in GenBank is KF385866.1.

[0007] Preferably, the nucleotide sequence comprising the SNP molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0008] The present invention also provides a primer set for detecting the SNP molecular marker described in the above technical solution, including a degenerate primer and a universal primer, the universal primer includes BBX24-C1F, the nucleotide sequence of the BBX24-C1F is shown in SEQ ID NO.3; the nucleotide sequence of the degenerate primer BBX24-C1R is shown in SEQ ID NO.4.

[0009] The present invention also provides a kit, which comprises the primer set and PCR amplification reagent described in the above technical solution.

[0010] Preferably, the kit also includes reagents related to DNA extraction.

[0011] The present invention also provides the use of the SNP molecular marker described in the above technical solution, the primer set described in the above technical solution, or the kit described in the above technical solution in identifying the genotype of the BBX24 gene.

[0012] The present invention also provides the use of the SNP molecular marker described in the above technical solution, the primer set described in the above technical solution, or the kit described in the above technical solution in identifying the flowering period of chrysanthemum.

[0013] Preferably, the identification of the flowering period of chrysanthemum includes distinguishing chrysanthemum varieties; the chrysanthemum varieties include summer chrysanthemum, autumn chrysanthemum and summer-autumn chrysanthemum.

[0014] The present invention also provides a method for identifying the flowering period of chrysanthemum and / or distinguishing chrysanthemum varieties, comprising the following steps:

[0015] Extracting genomic DNA from the chrysanthemum to be tested;

[0016] Using the genomic DNA as a template, PCR amplification is performed using the primer set described in the above technical solution to obtain a PCR amplification product;

[0017] Sequencing the PCR amplification product to obtain a sequencing sequence;

[0018] The flowering period of the chrysanthemum to be tested is predicted according to the sequencing sequence: when the base at the 153rd position of the BBX24 gene coding region is A, the flowering period of the chrysanthemum to be tested is mid-June to mid-July, and it is a summer chrysanthemum; when the base at the 153rd position of the BBX24 gene coding region is G, the flowering period of the chrysanthemum to be tested is mid-September to late October, and it is an autumn chrysanthemum; when the bases A and G at the 153rd position of the BBX24 gene coding region are both present, the flowering period of the chrysanthemum to be tested is mid-June to early August or late September to early October, and it is a summer-autumn chrysanthemum.

[0019] The present invention also provides the use of the SNP molecular marker described in the above technical solution, or the primer set described in the above technical solution, or the kit described in the above technical solution, or the method described in the above technical solution in molecular marker-assisted breeding for improving the flowering period of chrysanthemum.

[0020] Beneficial effects:

[0021] The present invention provides a SNP molecular marker related to the flowering period of chrysanthemum, wherein the SNP molecular marker is located at the 153rd site of the coding region of the BBX24 gene, and the polymorphism is A / G; the accession number of the BBX24 gene in GenBank is KF385866.1. The present invention finds a SNP molecular marker significantly related to the flowering period of chrysanthemum on the chrysanthemum flowering period control gene BBX24, enriching the chrysanthemum flowering period molecular marker database. Through research, it is found that based on the SNP molecular marker on the chrysanthemum flowering period control gene BBX24, the chrysanthemum varieties of different flowering ecotypes can be tested for the BBX24 gene, and then the flowering control gene BBX24 can be quickly and accurately detected in different germplasm resources such as summer chrysanthemum, autumn chrysanthemum and summer and autumn chrysanthemum, so as to realize the identification of chrysanthemums with different flowering periods and distinguish chrysanthemum varieties. The SNP molecular marker can be used for prospect selection in the early stage of molecular marker-assisted breeding, reduce the scale of the breeding population, speed up the breeding process, and is conducive to the efficient application of the BBX24 gene in biological breeding for improving the flowering period of chrysanthemum. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0023] Figure 1 The cloning comparison results of the BBX24 gene in different flowering types of chrysanthemums in Example 1; wherein CmBBX24a and CmBBX24b represent genes when the base at the 153rd position of the coding region of the BBX24 gene is A and G respectively. DETAILED DESCRIPTION

[0024] The invention provides a SNP molecular marker related to the flowering period of chrysanthemum. The SNP molecular marker is located at the 153rd site of the coding region of the BBX24 gene, and the polymorphism is A / G. The accession number of the BBX24 gene in GenBank is KF385866.1.

[0025] In the present invention, as an embodiment, the nucleotide sequence (1 to 155 bp) comprising the SNP molecular marker is as shown in SEQ ID NO.1 or SEQ ID NO.2.

[0026] The nucleotide sequence shown in SEQ ID NO. 1 is as follows: 5′-ATGAAGATTCAGTGTGATGTG TGTGAAAAAGCTCCAGCAACATTGATATGTTGTGCAGATGAAGCTGCTTTG TGTGCAAGATGTGATGTGGAAGTTCATGCAGCCAATAAGCTTGCTAGCAAA CATCAAAGGCTTTTGTTGCAGCAATCTTTATC-3′;

[0027] The nucleotide sequence shown in SEQ ID NO. 2 is as follows: 5′-ATGAAGATTCAGTGTGATGT GTGTGAAAAAGCTCCAGCAACATTGATATGTTGTGCAGATGAAGCTGCTTT GTGTGCAAGATGTGATGTGGAAGTTCATGCAGCCAATAAGCTTGCTAGCAA ACATCAAAGGCTTTTGTTGCAGCAATCTTTGTC-3′.

[0028] In the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, the bold italic bases are the positions of the above-mentioned SNP molecular markers.

[0029] The present invention also provides a primer set for detecting the SNP molecular markers described in the above technical solution, including a universal primer and a degenerate primer BBX24-C1R, wherein the universal primer includes BBX24-C1F, and the nucleotide sequence of the BBX24-C1F is shown in SEQ ID NO.3; the nucleotide sequence of the degenerate primer BBX24-C1R is shown in SEQ ID NO.4. The BBX24-C1R of the present invention is used to amplify the BBX24 gene sequence of the SNP molecular markers A and G (R is degenerate base amplification A / G).

[0030] The nucleotide sequences shown in SEQ ID NO.3 to SEQ ID NO.4 are as follows:

[0031] SEQ ID NO.3: 5'-ATGAAGATTCAGTGTGATGTGTGTGAA-3';

[0032] SEQ ID NO. 4: 5'-GARAAAGATTGCTGCAACAAAAGCCTT-3'.

[0033] The present invention also provides a kit, which includes the primer set and PCR amplification reagent described in the above technical solution. As an embodiment, the kit of the present invention may also include DNA extraction related reagents. The present invention does not specifically limit the source and specifications of the PCR amplification reagent and the DNA extraction related reagent, and the related reagents obtained from conventional commercial channels in the field can be used.

[0034] The present invention also provides the use of the SNP molecular marker described in the above technical solution, the primer set described in the above technical solution, or the kit described in the above technical solution in identifying the genotype of the BBX24 gene.

[0035] The present invention also provides the use of the SNP molecular marker described in the above technical solution, the primer set described in the above technical solution, or the kit described in the above technical solution in identifying the flowering period of chrysanthemum. As an embodiment, the identification of the flowering period of chrysanthemum in the present invention can be used to distinguish chrysanthemum varieties; the chrysanthemum varieties are summer chrysanthemum, autumn chrysanthemum, and summer and autumn chrysanthemum.

[0036] The present invention also provides a method for identifying the flowering period of chrysanthemum and / or distinguishing chrysanthemum varieties, comprising the following steps:

[0037] Extracting genomic DNA from the chrysanthemum to be tested;

[0038] Using the genomic DNA as a template, PCR amplification is performed using the primer set described in the above technical solution to obtain a PCR amplification product;

[0039] Sequencing the PCR amplification product to obtain a sequencing sequence;

[0040] The flowering period of the chrysanthemum to be tested is predicted according to the sequencing sequence: when the base at the 153rd position of the BBX24 gene coding region is A, the flowering period of the chrysanthemum to be tested is mid-June to mid-July, and it is a summer chrysanthemum; when the base at the 153rd position of the BBX24 gene coding region is G, the flowering period of the chrysanthemum to be tested is mid-September to late October, and it is an autumn chrysanthemum; when the bases A and G at the 153rd position of the BBX24 gene coding region are both present, the flowering period of the chrysanthemum to be tested is mid-June to early August or late September to early October, and it is a summer-autumn chrysanthemum.

[0041] The present invention discovered a SNP molecular marker significantly associated with the flowering period of chrysanthemum on the chrysanthemum flowering period control gene BBX24, enriching the chrysanthemum flowering period molecular marker database. Through research, it was found that based on the SNP molecular marker on the chrysanthemum flowering period control gene BBX24, chrysanthemum varieties with different flowering ecotypes can be tested for BBX24 gene, and then the flowering control gene BBX24 can be quickly and accurately detected in different germplasm resources such as summer chrysanthemum, autumn chrysanthemum and summer and autumn chrysanthemum, so as to achieve the identification of chrysanthemums with different flowering periods and distinguish chrysanthemum varieties. The SNP molecular marker can be used for prospect selection in the early stage of molecular marker-assisted breeding, reduce the scale of the breeding population, speed up the breeding process, and is conducive to the efficient application of the BBX24 gene in biological breeding for improving the flowering period of chrysanthemum.

[0042] Based on the above advantages, the present invention also provides the use of the SNP molecular marker described in the above technical solution, the primer set described in the above technical solution, the kit described in the above technical solution, or the method described in the above technical solution in molecular marker-assisted breeding for improving the flowering period of chrysanthemum.

[0043] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0044] Example 1

[0045] Discovery of SNP molecular markers on the chrysanthemum flowering period control gene BBX24:

[0046] 1. Clone the target gene BBX24 sequence in chrysanthemum varieties with different flowering ecotypes and extract SNP sites. The specific steps are as follows:

[0047] 1) Based on the coding region sequence of the target gene BBX24 (GenBank accession number is KF385866.1), amplification was performed using the primer sequences shown in SEQ ID NO.3 to SEQ ID NO.4.

[0048] 2) RNA was extracted from chrysanthemum varieties 'Xingfang', 'Xiahuang' and 'Yeju', with 3 biological replicates for each variety, and the obtained RNA was reversed into cDNA.

[0049] 3) Using the cloning primers in step 1), PCR amplification was performed on cDNA of different chrysanthemum varieties to obtain the target gene BBX24 sequence. The PCR amplification system is shown in Table 1.

[0050] Table 1 PCR amplification system

[0051] Element volume 2×PhantaMaxBuffer 25μL Forward Primer 2μL Reverse primer 2μL cDNA 2μL Deionized water 17μL dNTP 1μL PhantaMaxSuper-FidelityDNAPolymerase 1μL

[0052] The reaction program of PCR amplification was as follows: 95°C, 3 min, 1 cycle; 95°C, 15 s, 58°C, 15 s, 72°C, 1 min / kb, 35 cycles; 72°C, 5 min, 1 cycle.

[0053] 4) The obtained target gene BBX24 sequence was used to construct a vector plasmid, transformed into E. coli, and positive clones were picked and sequenced to obtain the target gene BBX24 sequences cloned from 'Xingfang', 'Xiahuang' and 'Yeju' respectively.

[0054] 5) Sequence alignment of the target gene BBX24 cloned from 'Xingfang', 'Xiahuang' and 'Yeju' was performed. The results are as follows Figure 1 shown.

[0055] Depend on Figure 1 It can be concluded that a total of 1 SNP molecular marker site BBX24-C that can identify BBX24 was found. The BBX24-C site is located at the 153rd base in the coding region of the BBX24 gene, and the base sequence is A or G; after verification in chrysanthemums of different flowering types, BBX24-C1 was selected as the SNP molecular marker of the chrysanthemum flowering control gene BBX24.

[0056] Example 2

[0057] The flowering type of chrysanthemum varieties is detected using the SNP molecular markers in Example 1, and the steps are as follows:

[0058] Based on the SNP molecular markers obtained in Example 1, a primer set was designed for detecting the flowering type of chrysanthemum varieties. The primer sequences are as follows:

[0059] SEQ ID NO.3 (BBX24-C1F): 5'-ATGAAGATTCAGTGTGATGTGTGTGA A-3';

[0060] SEQ ID NO. 4 (BBX24-C1R): 5'-GARAAAGATTGCTGCAACAAAGCC TT-3'.

[0061] Chrysanthemum varieties are shown in Table 3 , and three biological replicates were set for each variety;

[0062] The detection steps are as follows:

[0063] 1) DNA extraction: Genomic DNA was extracted from chrysanthemum leaves using the CTAB method;

[0064] 2) PCR reaction system: The genomic DNA extracted in step 1) is subjected to PCR amplification detection using the above-mentioned amplification primers, and the amplified product is sequenced.

[0065] The PCR amplification reaction system was a 50 μL PCR reaction system, and the reaction system was the same as Table 1. The PCR amplification program was: 95°C, 3 min, 1 cycle; 95°C, 15 s, 58°C, 15 s, 72°C, 1 min / kb, 35 cycles; 72°C, 5 min, 1 cycle.

[0066] 3) The amplification sequencing results are shown in Table 3:

[0067] Table 3 Chrysanthemum varieties and amplification sequencing results in Example 2

[0068]

[0069]

[0070] Note: The bold italic bases in Table 3 are the bases at 152bp in the coding region of the BBX24 gene, and the test results of the three biological replicates of each variety in Table 3 are consistent.

[0071] As can be seen from Table 3, the varieties carrying the BBX24 gene detected base A at the BBX24-C1(153)SNP site are early-flowering BBX24 types, such as the summer chrysanthemum variety 'Xiahuang'; the varieties carrying the BBX24 gene detected base A and G at the BBX24-C1(153)SNP site are summer-autumn BBX24 types, such as the summer-autumn chrysanthemum variety 'Xingfang'; and the varieties carrying the BBX24 gene detected base G at the BBX24-C1(153)SNP site are late-flowering BBX24 types, such as Yeju. BBX24-C1 can be used for the efficient detection of the flowering control gene BBX24 in chrysanthemum.

[0072] From the above results, it can be concluded that the SNP site (153) developed from the chrysanthemum BBX24 gene can be used to quickly detect the flowering period of chrysanthemum.

[0073] The SNP molecular marker is significantly correlated with the chrysanthemum flowering period controlling gene BBX24 and the chrysanthemum flowering period, and can be used to identify the genotype of the chrysanthemum flowering period controlling gene BBX24 and the chrysanthemum flowering period, thereby enriching the chrysanthemum flowering period molecular marker database.

[0074] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with chrysanthemum flowering period, characterized in that: The SNP molecular marker is located at the 153rd site in the coding region of the BBX24 gene, and the polymorphism is A / G; the accession number of the BBX24 gene in GenBank is KF385866.

1.

2. The SNP molecular marker according to claim 1, characterized in that: The nucleotide sequence containing the SNP molecular marker is shown as SEQ ID NO.1 or SEQ ID NO.

2.

3. A primer set for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: It comprises a degenerate primer and a universal primer, wherein the universal primer comprises BBX24-C1F, and the nucleotide sequence of the BBX24-C1F is shown in SEQ ID NO.3; the nucleotide sequence of the degenerate primer BBX24-C1R is shown in SEQ ID NO.

4.

4. A kit, characterized in that: The kit comprises the primer set according to claim 3 and a PCR amplification reagent.

5. The kit according to claim 4, characterized in that The kit also includes reagents related to DNA extraction.

6. Use of the SNP molecular marker according to claim 1 or 2, the primer set according to claim 3, or the kit according to claim 4 or 5 in identifying the genotype of the BBX24 gene.

7. Use of the SNP molecular marker according to claim 1 or 2, the primer set according to claim 3, or the kit according to claim 4 or 5 in identifying the flowering period of chrysanthemum.

8. The use according to claim 7, characterized in that: The identification of chrysanthemum flowering period includes distinguishing chrysanthemum varieties; the chrysanthemum variety types include summer chrysanthemum, autumn chrysanthemum and summer and autumn chrysanthemum flowering types.

9. A method for identifying the flowering period of chrysanthemum and / or distinguishing chrysanthemum varieties, characterized in that: The steps include: Extracting genomic DNA from the chrysanthemum to be tested; Using the genomic DNA as a template, and using the primer set of claim 3 to perform PCR amplification to obtain a PCR amplification product; Sequencing the PCR amplification product to obtain a sequencing sequence; The flowering period of the chrysanthemum to be tested is predicted according to the sequencing sequence: when the base at the 153rd position of the BBX24 gene coding region is A, the flowering period of the chrysanthemum to be tested is mid-June to mid-July, and it is a summer chrysanthemum; when the base at the 153rd position of the BBX24 gene coding region is G, the flowering period of the chrysanthemum to be tested is mid-September to late October, and it is an autumn chrysanthemum; when the bases A and G at the 153rd position of the BBX24 gene coding region are both present, the flowering period of the chrysanthemum to be tested is mid-June to early August or late September to early October, and it is a summer-autumn chrysanthemum.

10. Use of the SNP molecular marker according to claim 1 or 2, the primer set according to claim 3, the kit according to claim 4 or 5, or the method according to claim 9 in molecular marker-assisted breeding for improving the flowering period of chrysanthemum.

Images