Molecular marker co-segregated with watermelon fruit size gene and application thereof

Abstract

The invention discloses a molecular marker co-separated from a watermelon fruit size gene Cllf and application of the molecular marker, and belongs to the field of molecular breeding. The molecular marker can be directly used for molecular marker-assisted breeding of watermelon small fruit traits, the breeding selection efficiency is improved, and the breeding process is accelerated. When the marker is applied to molecular marker-assisted selective breeding, directional genetic improvement of the watermelon fruit size can be quickly and accurately realized, and a quick, simple and convenient identification technology is provided for molecular detection of watermelon small fruit traits. Meanwhile, a theoretical foundation can be laid for finally realizing cloning of the watermelon fruit size gene Cllf and analyzing a molecular regulation network of the fruit size.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a dCAPS marker co-segregated with a watermelon fruit size trait and an application thereof. Background Art

[0002] The selection of genotypes is one of the most important links in breeding. It refers to the selection of genotypes that meet the requirements in a group for subsequent cultivation. In the traditional breeding process, the basis for selection is often determined by the appearance phenotype of the plant. This selection is time-consuming and may deviate from the required genotype when the trait is ambiguous, resulting in wrong selection and low efficiency. Molecular marker-assisted breeding can quickly detect the target gene or the site co-segregated with the target trait from the seedling stage to achieve the purpose of selecting the target trait. It has the advantages of being fast, accurate, and not affected by environmental conditions.

[0003] The dCAPS (derivative amplified polymorphic sequence) marker is an improvement on the CAPS (enzyme-assisted amplified polymorphic sequence) marker. The basic principle is: when designing the proposed amplification primer, mismatched bases are introduced to generate new restriction endonuclease action sites, and then the primer is used for PCR amplification. The obtained amplified product is digested with a specific restriction endonuclease, and finally polyacrylamide gel electrophoresis is used to detect the digested fragments. The polymorphism between samples is determined based on whether the fragments are cut. The dCAPS marker is a co-dominant marker that can distinguish between heterozygous and homozygous genotypes. It can be directly analyzed by polyacrylamide gel electrophoresis, and the operation is simple and fast. Compared with the CAPS marker, the dCAPS marker does not need to consider whether the SNP is on the restriction endonuclease site. It can maximize the conversion of SNPs into markers, making the utilization rate of SNPs on the genome higher.

[0004] Watermelon (Citrullus lanatus) is an annual vine herbaceous plant belonging to the genus Citrullus of the Cucurbitaceae family. It is widely planted around the world. With the development of the watermelon industry, the market share of small-fruited gift watermelons suitable for facility cultivation is increasing, and people have put forward new requirements for new varieties of high-quality small-fruited watermelons. Therefore, it is particularly urgent to discover and screen excellent genes that control fruit size with important application value in watermelon and analyze their mechanism of action and regulatory network.

[0005] Fruit size is an important agronomic trait and an important indicator affecting the economic value of horticultural crops. At present, a series of progress has been made in the study of fruit size in horticultural crops such as citrus, apple, loquat, and tomato. In citrus, Li found that the R2R3-MYB transcription factor CsMYB77 negatively regulates the ripening of citrus and tomatoes, and also plays a role in regulating the size of citrus fruit; in loquat, Su first found that cell size is the main factor affecting loquat fruit size, and analyzed the mechanism by which EjBZR1 regulates loquat cell expansion and fruit size by affecting the brassinolide biosynthesis pathway; in apple, Wang et al. found a MdAP2-like transcription factor that can regulate both fruit softening and fruit size, providing valuable genetic resources for breeding new large-fruited apple varieties that are resistant to storage and transportation; in watermelon, Li constructed three segregating populations from a new germplasm with a small fruit and different inbred lines with medium, large and giant fruits, and genome-wide QTL mapping revealed a significant QTL (fs-chr8) on chromosome 8 related to fruit size. Compared with other crops, the study of fruit size genes in watermelon is relatively weak, and this field is still in its infancy. Discovering more fruit size genes and verifying their functions will be crucial to creating excellent small-fruit watermelons and their application in the breeding of new varieties.

[0006] In recent years, research on molecular breeding of watermelon has developed rapidly. Many excellent traits have been genetically located, and some co-segregating markers with regulatory trait genes have also begun to be used in the molecular marker-assisted breeding process. Through the study of the small fruit trait of watermelon, molecular markers that co-segregate with the small fruit trait of watermelon have been developed. This can not only provide effective assistance for the molecular marker-assisted selection of small-fruit watermelon new varieties, but also greatly shorten the breeding process and improve the accuracy of selection. Summary of the invention

[0007] One of the objects of the present invention is to provide a pair of dCAPS markers co-segregating with watermelon fruit size gene.

[0008] The second object of the present invention is to provide the application of the above molecular markers in watermelon molecular breeding.

[0009] The third object of the present invention is to provide a method for identifying the size trait / genotype of watermelon fruit.

[0010] To achieve the above object, the present invention provides the following technical solutions:

[0011] A pair of molecular markers co-segregated with the watermelon fruit size gene Cllf are dCAPS molecular markers, named lf-dCAPS markers. The polymorphic molecular markers co-segregated with the watermelon fruit size trait are developed based on the fruit size gene Cllf. The upstream primer sequence of the primer pair for amplifying the lf-dCAPS marker is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2.

[0012] The present invention also discloses the application of a molecular marker co-segregating with a watermelon fruit size gene Cllf in watermelon molecular breeding. The molecular marker co-segregates with the watermelon fruit size trait, and can assist in identifying whether a watermelon plant has a small fruit phenotype at the molecular level, and can determine the watermelon plant trait at the seed or seedling stage, thereby improving the selection efficiency and accelerating the breeding process. Those skilled in the art can understand that, for example, small-fruit watermelon materials can be screened by detecting the presence of the molecular marker of the present invention. The detection can be a PCR detection method, specifically, the primer pair of the molecular marker of the present invention can be used, and the detection can also be performed by a sequencing method.

[0013] The present invention also discloses a method for determining the size trait / genotype of watermelon fruit, which is detected by a method of PCR amplification followed by enzyme cutting. The method comprises the following steps:

[0014] (1) Extract DNA from watermelon tissue;

[0015] (2) PCR amplification: using a primer pair with an upstream primer sequence as shown in SEQ ID NO.1 and a downstream primer sequence as shown in SEQ ID NO.2, PCR amplification is performed on the sample extracted in step (1);

[0016] (3) digesting the amplified product in step (2) with enzymes, followed by electrophoresis detection;

[0017] (4) Determine according to the electrophoresis band results of step (3), the specific criteria are:

[0018] If the PCR amplification product is a characteristic band of 120 bp in length, the plant to be tested is a homozygous small-fruit watermelon material; if the PCR amplification product is a characteristic band of 95 bp, the plant to be tested is a homozygous large-fruit watermelon material; if the PCR amplification product is two characteristic bands of 95 bp and 120 bp in length, the plant to be tested is a heterozygous large-fruit watermelon material;

[0019] Or, expressed as follows:

[0020] If the PCR amplification product has only one characteristic band with a length of 120 bp as shown in SEQ ID NO.3, then the watermelon to be tested is a watermelon material / genotype with a homozygous small fruit trait; if the PCR amplification product has only one characteristic band with a length of 120 bp as shown in SEQ ID NO.4, then the watermelon to be tested is a watermelon material / genotype with a homozygous large fruit trait; if the PCR amplification product has both a characteristic band with a length of 95 bp as shown in SEQ ID NO.3 and a characteristic band with a length of 120 bp as shown in SEQ ID NO.4, then the watermelon to be tested is a watermelon material / genotype with a heterozygous large fruit trait.

[0021] Specifically, the reaction system of the PCR amplification is: DNA 1μL, 2×PCR Mix 5μL, upstream primer 0.5μL, downstream primer 0.5μL, sterile distilled water 3μL, total volume 10μL. PCR amplification conditions are: 95°C, 5min; 94°C, 30s, 56°C, 30s, 72°C, 50s, a total of 35 cycles; 72°C, 10min; 4°C storage.

[0022] The enzyme digestion reaction system was: 5uL of PCR product, 1ul of 10x buffer, 0.5uL of TaqI restriction endonuclease, 3.5ul of sterile distilled water, a total volume of 10ul, and the enzyme digestion conditions were 37°C for 4h.

[0023] In addition, the kit containing the above primer pair can be used to identify whether the watermelon material is a small-fruit watermelon. In specific applications, the kit containing the primer pair can be selected.

[0024] Here, the molecular markers of the present invention can also be used to locate the watermelon fruit size gene Cllf, and the above applications can be carried out according to conventional methods.

[0025] The present invention also protects vectors containing the above-mentioned molecular markers. The recombinant vector may be an expression vector or a cloning vector into which the molecular marker of the present invention is inserted. After obtaining the above-mentioned recombinant vector, those skilled in the art can transform the recombinant vector into suitable cells according to different needs to obtain recombinant cells containing the recombinant vector. Therefore, the present invention also protects recombinant cells containing the recombinant vector.

[0026] Advantages of the present invention:

[0027] The molecular marker of the present invention can finally realize the cloning of Cllf gene, and then lay a foundation for the molecular mechanism research of watermelon fruit size. At the same time, the molecular marker can be directly used for molecular marker-assisted breeding of small fruit materials of watermelon. In the process of watermelon selection breeding, a large number of separation groups are often produced. By using the molecular marker, the required plants can be identified in the seedling stage, which not only reduces the floor space in the breeding process, but also reduces the manpower and material resources required for identification after the plants grow up, greatly improves the efficiency of breeding, and shortens the selection period. Therefore, the molecular marker provided by the present invention has good application value in the cultivation of new varieties.

[0028] This application has conducted a detailed study on genes related to fruit size in watermelon plants, and finally determined a dCAPS molecular marker that is co-segregated with the watermelon fruit size gene Cllf using relevant research methods such as BSA-seq and molecular markers. The lf-dCAPS molecular marker is co-segregated with the watermelon fruit size trait within the interval. This discovery lays the foundation for the final cloning of the Cllf gene and the establishment of a molecular marker-assisted breeding system, and also helps to lay the foundation for the final research on the regulatory network of watermelon fruit size. In short, since molecular markers are of great significance for the final functional gene positioning, and molecular markers have the advantages of simplicity, rapidity, and high throughput in the establishment of a molecular marker breeding system, this application has very important application value and is also of very important protective significance for the cultivation of new watermelon varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Phenotypic photos (Figures A and B) of normal watermelon material G42 and small-fruit watermelon material G42lf and statistical graphs of related traits (Figures C, D, E, and F) (Figures A and B, G42 on the left and G42lf on the right, scale bar in Figure A is 5 mm, scale bar in Figure B is 5 cm);

[0030] Figure 2 A fine mapping of the gene Cllf for the fruit size trait in watermelon;

[0031] Figure 3 The gel electrophoresis diagram of the co-segregation marker lf-dCAPS in the parental and F2 generation populations;

[0032] In the figure, M is DL2000 Marker, and the bands shown in the figure are 100bp and 250bp; P1 represents the normal watermelon material G42, and P2 represents the small-fruit watermelon material G42lf;

[0033] Figure 4The gel electrophoresis diagram of the co-segregation marker lf-dCAPS in the parents and 30 natural populations; M in the figure is DL2000 Marker, and the 100bp and 250bp bands are shown in the figure; P1 represents the normal watermelon material G42, and P2 represents the small-fruit watermelon material G42lf. DETAILED DESCRIPTION

[0034] The following is a further explanation in conjunction with the application. Before introducing the specific embodiments, the biological materials, experimental reagents and related experimental background in the following embodiments are briefly introduced as follows.

[0035] Biomaterials:

[0036] Watermelon material G42 (male parent) is a homozygous inbred line that has been selected for many generations. This material is a normal watermelon fruit material and can be stably inherited ( Figure 1 A left), the fruit showed large size, which is referred to as normal phenotype below.

[0037] The watermelon small fruit material G42lf (female parent) was obtained by EMS mutagenesis of G42. Its ovary size is ( Figure 1 C) Fruit size ( Figure 1 A right, Figure 1 D) Fruit weight ( Figure 1 E) is significantly lower than G42, and the sugar content of the fruit is not affected ( Figure 1 F); The small fruit phenotype is relative to the large fruit of normal materials, and the obtained G42lf material can be stably inherited during the later planting process.

[0038] The above-mentioned watermelon material G42 is consistent with the normal common material G42 used in the Chinese invention patent "Watermelon male sterility gene ClMS1 and its application" with publication number CN115385994B.

[0039] G42lf is derived from the seeds of the M1 generation watermelon mutant of the G42 material mutation (the seeds were donated by Deng Yun of the Modern Agricultural Research Institute of Peking University, where the seeds of the M1 generation watermelon mutant were obtained by EMS mutagenesis, and the specific method is referred to the publicly published article "A telomere-to-telomere gap-free reference genome of watermelon and its mutation library provide important resources for gene discovery and breeding"). After several generations of planting and screening and identification, we identified homozygous mutants in the M2 and M3 generation seeds, among which the material phenotypically showed that the fruit was smaller than the normal watermelon material G42, and had excellent traits for breeding watermelon materials in production. Therefore, the material was studied for gene positioning, and molecular markers were developed accordingly. The material is stored in the melon crop genetic breeding research group of Henan Agricultural University.

[0040] The above materials are all kept in the applicant's laboratory (Henan Agricultural University, Melon Crop Genetic Breeding Project). They can be distributed to the public for verification tests within 20 years from the date of application, or the public can purchase them.

[0041] During the experiment, the watermelon materials were planted in the solar greenhouse of Maozhuang Science and Education Park of Henan Agricultural University. During the planting process, plug tray seedlings were raised after germination, and normal watermelon cultivation and management methods were adopted. After transplanting, the relevant phenotypic traits were preliminarily investigated and counted when the female flowers opened, and the relevant phenotypic traits were investigated and confirmed again 30 days after pollination.

[0042] The primers for PCR amplification and gene sequencing were provided by Beijing Nosai Genome Research Center Co., Ltd.

[0043] Experimental reagents:

[0044] PCR 2x 3G Taq Master Mix for PCR amplification was purchased from Nanjing Novozyme Biotech Co., Ltd.;

[0045] Restriction endonuclease TaqI was purchased from Guangzhou Yisheng Biotechnology Co., Ltd.;

[0046] Electrophoresis and silver staining related reagents such as acrylamide, methylene acrylamide, AgNO3, NaOH, and formaldehyde were purchased from Beijing Solebow Technology Co., Ltd.;

[0047] Experimental equipment:

[0048] PCR instrument, Hema9600 gene amplification instrument from Zhuhai Heima Medical Instrument Co., Ltd.;

[0049] JY300HC universal electrophoresis apparatus, produced by Beijing Junyi Dongfang Electrophoresis Equipment Co., Ltd.;

[0050] HT-SCZ04A high-throughput vertical electrophoresis tank is produced by Beijing Hongtao Jiye Technology Development Co., Ltd.

[0051] Example

[0052] This example mainly introduces the fine positioning process of the watermelon fruit size gene Cllf, including the construction of genetic segregation populations, preliminary positioning and other processes. This process involves the development, design and testing of the lf-dCAPS molecular marker that is ultimately co-segregated with the small fruit trait of watermelon. The relevant experimental process is briefly introduced as follows.

[0053] 1. Construction of genetically isolated populations

[0054] The watermelon small fruit material G42lf ( Figure 1 A right) as the female parent, with normal watermelon fruit material G42 ( Figure 1 A left) as the male parent (it should be explained that during the experiment, considering the availability of materials and the convenience of operation, the inventors used G42 as the male parent. When other homozygous normal materials are used, related experiments can also be carried out). A hybrid combination was configured using these two parents. The results showed that the F1 generation obtained had normal fruit size.

[0055] Ten individual plants were selected from the F1 generation and self-pollinated to obtain F2 generation seeds for genetic analysis and gene positioning. The phenotypes of these F2 generation individuals were identified and verified using the chi-square test.

[0056] The results show that:

[0057] The F2 population of 308 plants was planted, including 250 normal phenotype plants, 67 watermelon small fruit phenotype plants, and χ 2 =0.216<3.84, which is consistent with the segregation ratio of 3:1. Analysis shows that the small fruit trait in G42lf is controlled by the same pair of recessive genes, which are named Cllf. The normal phenotype (LF) is completely dominant over the small fruit phenotype (lf).

[0058] 2. Preliminary location of the gene

[0059] The mutmap method for localizing EMS-induced mutants was used for preliminary localization. The specific experimental process is as follows:

[0060] (1) First, two fruit-sized pools are mixed, specifically:

[0061] Randomly select 20 normal phenotype plants and 20 small fruit phenotype plants from the F2 generation population in the above step 1, collect relatively tender leaves from each plant 30 days after pollination, extract their genomic DNA using the CTAB method, and mix them to make a normal gene pool and a small fruit gene pool (normal phenotypes are mixed with normal phenotypes, and small fruit phenotypes are mixed with small fruit phenotypes).

[0062] (2) Whole genome resequencing of parents and pools, specifically:

[0063] The normal fruit gene pool, small fruit gene pool and the genomes of the parents constructed in (1) were subjected to >40x whole genome resequencing using the Illumina Hi-seq2000 high-throughput sequencing platform. The process mainly consists of the following four steps: (i) Library construction: Physical fragmentation (ultrasonic vibration) was used to fragment qualified genomic DNA into target fragments (350 bp), and then end repair, A addition, linker addition, target fragment selection and PCR were performed to construct a small fragment sequencing library; (ii) Library quality control: Qseq400 and Qubit were used to detect the library fragment size and library quantification to determine whether the library met the sequencing standards; (iii) Chip fixation: The library was fixed to the sequencing chip by bridge PCR; (iv) On-machine sequencing: The library was subjected to double-end 150 bp (PE 150) sequencing using an Illumina sequencer, and the data generated by the sequencing was used for the next information analysis after quality control.

[0064] (3) Mutmap analysis, specifically:

[0065] First, trim_galore was used to remove the sequencing adapters from the sequencing data, and the data without adapters was analyzed by mutmap software. The watermelon T2T reference genome G42 (http: / / www.watermelondb.cn / # / geneInfo?group=G42.nogap.v4) was used as the reference genome, the G42 resequencing data was the wild-type sequence, and the small fruit gene pool sequencing data was the mutant mixed pool data.

[0066] According to the analysis results of mutmap software, a significant peak appeared on chromosome 8. According to the SNP-index value, the gene was initially located in the 2.7Mb candidate interval at the end of chromosome 8 ( Figure 2 ).

[0067] 3. Development of co-segregating molecular markers and linkage verification

[0068] Based on the preliminary positioning in step 2, the inventors further developed and verified the linkage of co-segregating molecular markers with the watermelon fruit size gene Cllf. The specific process is briefly described as follows.

[0069] (1) Development of molecular markers:

[0070] The sequences in the 2.7Mb candidate interval in the preliminary positioning were used as reference sequences, and the resequencing sequences of the two parents and the candidate segment were compared using the free software package BWA (http: / / bio-bwa.sourceforge.net / ) available online to find the difference sites between the two parents in the candidate segment. Subsequently, the SNPs in the candidate interval were screened out, and the appropriate restriction enzymes were selected by dCAPSFinder 2.0 software and the SNP sites were converted into dCAPS markers.

[0071] (2) Linkage verification of co-segregating molecular markers:

[0072] The designed dCAPS markers were used to analyze the genotypes of 308 strains in the F2 population. The strains with the same band shape as the normal parent G42 were recorded as "1", the strains with the same band shape as the small-fruited parent G42lf were recorded as "2", and the strains with heterozygous band shape were recorded as "3".

[0073] The typing results of the above molecular markers were analyzed. The results showed that a C to G SNP site mutation in the small fruit material G42lf within the candidate interval led to a mutation from arginine to tryptophan. The dCAPS marker developed based on this site co-segregated with the small fruit trait in the F2 population ( Figure 3 ) and named it lf-dCAPS.

[0074] The molecular marker lf-dCAPS is shown in SEQ ID NO.3 or SEQ ID NO.4, and the upstream primer (lf-dCAPS-F) and the downstream primer (lf-dCAPS-R) of the primer pair for amplifying the molecular marker are respectively:

[0075] lf-dCAPS-F: 5'-TTCATTTTTCCTTGCTCTCACA-3' (SEQ ID NO. 1);

[0076] lf-dCAPS-R: 5'-CTGGTGTTTCTGCCTTGTGCTC-3' (SEQ ID NO. 2);

[0077] The size of the amplified product of this primer in the male parent (normal material) is 95bp, and the size of the amplified product in the female parent (small fruit material) is 120bp. Specifically:

[0078] A characteristic band of 120 bp was obtained by PCR amplification. The specific base sequence of the characteristic band of 120 bp is as follows:

[0079] TTCATTTTTCCTTGCTCTCACAGTCTTTTAACTCTTGCTCTTGATATCAGTTGTACCGTATGACATTCTTGCACTTGCTTTTTATTTCTCAGATTCGAGCACAAGGCAGAAACACCAGGG (SEQ ID NO. 3).

[0080] A 95 bp characteristic band was obtained by PCR amplification, and the specific base sequence of the 95 bp characteristic band is as follows:

[0081] TTCATTTTTCCTTGCTCTCACAGTCTTTTAACTCTTGCTCTTGATATCAGTTGTACCGTATGACATTCTTGCACTTGCTTTTTATTTCTCAGATT (SEQ ID NO. 4).

[0082] PCR reaction system The PCR reaction procedure was carried out according to the standard process. The PCR reaction system is shown in Table 1.

[0083] Table 1 PCR reaction system

[0084]

[0085] The PCR amplification program was: 94°C, 5 min; 94°C, 30 s, 55°C, 30 s, 72°C, 30 s, 35 cycles; 72°C, 5 min.

[0086] The enzyme digestion reaction system is shown in Table 2:

[0087] Table 2 Enzyme digestion reaction system

[0088]

[0089] The enzyme digestion conditions were 37°C and 4h.

[0090] Perform 8% non-denaturing polyacrylamide gel electrophoresis. During electrophoresis, the polyacrylamide gel electrophoresis buffer is 0.6×TBE, and the electrophoresis is performed at a constant voltage of 200V for 1 to 1.5 hours. After the electrophoresis, silver staining is performed for observation and detection. The silver staining method is as follows:

[0091] A. Place the glass plate with glue in the fixing solution and shake it gently on a shaker until the indicator loses its color. The fixing solution consists of glacial acetic acid: anhydrous ethanol: distilled water in a volume ratio of 0.5:10:100.

[0092] B. Wash with ultrapure water for 1 to 3 minutes;

[0093] C. Place the washed plastic plate in the staining solution and shake for 10 minutes. The staining solution is 0.2% silver nitrate aqueous solution.

[0094] D. Rinse the stained plastic plate in ultrapure water for 30 seconds, place it in a plastic box containing developer, and shake it gently until the bands are clearly visible. The developer is prepared by adding 15g NaOH and 3mL formaldehyde to 1L distilled water;

[0095] E. Finally, rinse repeatedly in tap water several times;

[0096] F. Dry at room temperature and then take photos.

[0097] IV. Application of Molecular Markers

[0098] (1) DNA extraction, PCR amplification and electrophoresis detection

[0099] The conventional CTAB method was used for DNA extraction, and the PCR reaction procedure and polyacrylamide gel electrophoresis process referred to Yang Huihui's master's thesis: Fine positioning and functional verification of the watermelon lateral branch gene Clbl, Henan Agricultural University, 2021.

[0100] (2) Watermelon small fruit material / genotype detection

[0101] PCR amplification was performed on the watermelon samples to be tested (parents and F2 population) using the primers. The results showed that if the product after enzyme cleavage was a characteristic band of 120 bp in length, the plant to be tested was a homozygous watermelon small-fruit material; if the product after enzyme cleavage was a characteristic band of 95 bp, the plant to be tested was a homozygous watermelon large-fruit material; if the product after enzyme cleavage was two characteristic bands of 95 bp and 120 bp in length, respectively, the plant to be tested was a heterozygous watermelon large-fruit material.

[0102] Therefore, the material / genotype / trait of a single plant can be quickly distinguished according to the amplified bands. Furthermore, the inventors used lf-dCAPS molecular markers to perform PCR amplification gel electrophoresis detection on the two parents and the natural population (30 watermelon materials were randomly selected) ( Figure 4 ). Combined with the phenotypic data, it was found that the phenotypes of the parents and 30 randomly selected watermelon materials were consistent with the actual measurement results (Table 3), indicating that the auxiliary selection rate of the lf-dCAPS marker of the present invention for small fruit molecular markers in the natural population of watermelon was 100%. Based on this result, it is shown that the molecular marker lf-dCAPS of the present invention can effectively distinguish whether the watermelon plant is a small fruit material.

[0103] Table 3 Numbers and phenotypes of 30 natural watermelon materials used for verification

[0104]

[0105]

[0106] In summary, the derived real enzyme-cut amplified sequence polymorphism marker of the present invention can be used for large-scale identification of small fruit traits of watermelon. It is not only fast and effective, but also can be identified at the seedling stage, which greatly shortens the breeding cycle and can be used on a large scale in production.

[0107] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A molecular marker co-segregating with a watermelon fruit size gene, characterized in that: The molecular marker is shown as SEQ ID NO.3 or SEQ ID NO.4, the upstream primer sequence of the primer pair for amplifying the molecular marker is shown as SEQ ID NO.1, and the downstream primer sequence is shown as SEQ ID NO.

2.

2. The molecular marker co-segregating with the watermelon fruit size gene according to claim 1, characterized in that: The molecular marker is a dCAPS marker.

3. Application of the molecular marker co-segregated with the watermelon fruit size gene as described in claim 1 in watermelon molecular breeding.

4. The use according to claim 3, characterized in that: The molecular marker is used for identifying or assisting in identifying the small fruit trait / genotype of watermelon.

5. A method for determining the size trait / genotype of watermelon fruit, characterized in that: The method comprises the following steps: (1) extracting genomic DNA of watermelon samples to be tested; (2) using the genomic DNA extracted in step (1) as a template and the primer pair described in claim 1 to perform PCR amplification on the sample extracted in step (1); (3) digesting the amplified product in step (2) with enzymes, and then detecting it by polyacrylamide gel electrophoresis; (4) Determine according to the electrophoresis band results of step (3), the specific criteria are: If the enzyme cleavage product has only one characteristic band with a length of 120 bp as shown in SEQ ID NO.3, the watermelon to be tested is a homozygous small-fruit watermelon material / genotype; if the enzyme cleavage product has only one characteristic band with a length of 95 bp as shown in SEQ ID NO.4, the watermelon to be tested is a homozygous large-fruit watermelon material / genotype; if the PCR amplification product has both a characteristic band with a length of 95 bp as shown in SEQ ID NO.3 and a characteristic band with a length of 120 bp as shown in SEQ ID NO.4, the watermelon to be tested is a heterozygous large-fruit watermelon material / genotype.

6. The method according to claim 5, characterized in that The DNA of the test materials was extracted using the CTAB method.

7. The method according to claim 5, characterized in that The enzyme digestion reaction system described in step (3) is: 5uL of PCR product, 1ul of 10X buffer, 0.5uL of TaqI restriction endonuclease, 3.5ul of sterile distilled water, total volume 10ul, and the enzyme digestion conditions are 37°C and 4h.

8. A kit for identifying the size traits of watermelon fruit, characterized in that: Comprising the primer pair described in claim 1.

9. Use of a reagent for detecting the presence of a dCAPS marker in localizing a watermelon fruit size gene Cllf, characterized in that: The upstream primer sequence of the primer pair for amplifying the dCAPS marker is shown in SEQ ID NO.1, and the downstream primer sequence is shown in SEQ ID NO.2.

Images