InDel marker related to flag leaf width trait of foxtail millet, primer set and application thereof

By developing the InDel marker Seita.5G1346005UTR277 in the chromosome 5 region of millet, the problem of insufficient research on the flag leaf width trait of millet was solved, enabling the genotyping and breeding-assisted selection of the flag leaf width trait, improving photosynthesis and lodging resistance, and increasing yield per unit area.

CN119824124BActive Publication Date: 2025-11-21MILLET RES INST OF SHANXI AGRI UNIV (MILLET RES INST OF SHANXI ACAD OF AGRI SCI)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411980693.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-31
Publication Date
2025-11-21
Estimated Expiration
2044-12-31

AI Technical Summary

Technical Problem

In existing technologies, there are few studies on the flag leaf width trait of millet, and the QTL loci have low effect values ​​and few overlapping loci, which limits the progress of molecular marker-assisted breeding. Moreover, under high-density planting, the flag leaf width trait has a significant impact on photosynthesis and lodging resistance.

Method used

An InDel marker and primer set associated with the broad flag leaf trait of millet were developed. Through QTL mapping analysis, the InDel marker Seita.5G1346005UTR277 was developed in the interval 11731400–11731900 of millet chromosome 5 for selection and typing.

Benefits of technology

This study enabled effective typing and breeding-assisted selection of the broad flag leaf trait in millet, improving photosynthetic efficiency and lodging resistance, and enhancing yield potential per unit area.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119824124B_ABST
    Figure CN119824124B_ABST
Patent Text Reader

Abstract

The application belongs to the millet breeding technical field, and particularly relates to an InDel marker related to a flag leaf width trait of millet, a primer set and application. The InDel marker is located at a position of -66 bp upstream of a start codon ATG of a Seita.5G134600 gene, a 277 bp DNA fragment indicates that the flag leaf of the millet is wide, and a 277 bp DNA fragment indicates that the flag leaf of the millet is narrow. Experiments prove that the InDel marker in the application can accurately, reliably and effectively distinguish whether the flag leaf of the millet is wide or narrow, is not affected by environmental factors, and can be used for breeding of the flag leaf wide trait of the millet.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of millet breeding, and particularly relates to an InDel marker related to a flag leaf width trait of millet, a primer set and application. BACKGROUND

[0002] In the face of the dual challenges of global population growth and decreasing arable land, more and more breeders aim to increase crop yield per unit area by increasing planting density. However, higher planting density often hinders leaf growth, significantly reduces photosynthetic efficiency, and reduces lodging resistance. Good leaf traits can alleviate the problems caused by increased planting density.

[0003] The flag leaf in wheat is the main photosynthetic organ, providing the main source of carbohydrates for grain filling in the late growth stage of crops. Flag leaf length, flag leaf width, and flag leaf area are crucial for determining the amount of light captured by photosynthesis. Cultivating grains with optimal-sized flag leaves is an effective strategy to improve the potential of grain yield. Numerous studies have shown that flag leaf size is positively correlated with 1000-grain weight and yield per plant in cereals, including rice and wheat. Flag leaf length and flag leaf width together determine flag leaf area. If the flag leaf is too long, it may droop, leading to reduced photosynthetic efficiency, especially under high-density planting.

[0004] Therefore, improving flag leaf area by increasing flag leaf width is an effective approach. However, there is less research on the flag leaf width trait of millet, and the effect value of the located QTL site is low, and there are fewer overlapping sites, which limits the progress of molecular marker-assisted breeding of this trait. SUMMARY

[0005] To solve the above technical problems, the application provides an InDel marker related to a flag leaf width trait of millet, a primer set and application, which can genotype the flag leaf width of millet, and the InDel marker can be used for assisted selection in millet flag leaf breeding.

[0006] The technical scheme of the application is as follows.

[0007] The first aspect of the application provides an InDel marker related to a flag leaf width trait of millet, wherein the InDel marker is a gene fragment with a nucleotide sequence as shown in SEQ ID NO. 1.

[0008] The application takes the RIL population derived from the hybridization of Hezhuigou with long and narrow leaves and Changnong No. 35 with short and wide leaves as experimental materials, carries out QTL positioning analysis on the flag leaf width (FLW) traits of Hezhuigou, Changnong No. 35 and the RIL population under three planting densities, obtains a stable QTL site qFLW5-2 located on chromosome 5, develops InDel marker Seita.5G134600 in the interval of 11731400-11731900 on the site 5UTR277 , which is closely linked to the flag leaf width of millet. In the RIL population, the flag leaf width of the strains with Seita.5G134600 5UTR277+ and Seita.5G134600 5UTR277- is significantly different, the leaf width of the variant germplasm material with Seita.5G134600 5UTR277+ is significantly wider than that of the variant germplasm material carrying Seita.5G134600 5UTR277- .

[0009] The second aspect of the application provides a primer set for amplifying the InDel marker related to the flag leaf width trait of millet, which is composed of an upstream primer with a nucleotide sequence as SEQ ID NO. 2 and a downstream primer with a nucleotide sequence as SEQ ID NO. 3.

[0010] The third aspect of the application provides a kit, which comprises the primer set.

[0011] In another preferred embodiment, the kit further comprises reagents for PCR amplification.

[0012] The fourth aspect of the application provides the application of the kit in identifying the flag leaf trait of millet.

[0013] The fifth aspect of the application provides a method for identifying the flag leaf width trait of millet, which comprises the following steps:

[0014] Taking the DNA of the millet gene to be identified as a template, the PCR primer is used for PCR amplification, and it is detected whether the amplified product contains a gene fragment with a sequence as SEQ ID NO. 1, so as to determine whether the flag leaf of millet is wide or narrow;

[0015] If the amplified product of the millet to be identified contains the gene fragment shown in SEQ ID NO. 1, the flag leaf of millet is wide;

[0016] If the amplified product of the millet to be identified does not contain the gene fragment of SEQ ID NO. 1, the flag leaf of millet is narrow.

[0017] The sixth aspect of the present application provides application of the InDel marker in the prediction of flag leaf width traits of millet or molecular assisted screening and breeding of millet.

[0018] The seventh aspect of the present application provides application of the primer set in the prediction of flag leaf width traits of millet or molecular assisted screening and breeding of millet.

[0019] Compared with the prior art, the present application has the following beneficial effects:

[0020] The present application discloses an InDel marker related to flag leaf width under specific planting density of millet and application thereof. A RIL population derived from a cross between Heizhu millet with long and narrow leaves and Changnong No. 35 with short and wide leaves is used as experimental material. Based on a high-density genetic map constructed by whole genome resequencing, QTL positioning analysis is performed on the flag leaf width (FLW) traits of millet under three planting densities, and a stable QTL site qFLW5-2 located on chromosome 5 is obtained. An InDel marker Seita.5G134600 is developed in the interval of 11731400-11731900 of the site. 5UTR277 (F: AGTGACCCGTGACCGTGAG, R: GAGGTCTTGGCGAAGTAGGC), which is closely linked to the flag leaf width of millet. In the RIL population, the flag leaf width of the strain carrying Seita.5G134600 5UTR277+ and Seita.5G134600 5UTR277- is significantly different, and in 680 natural populations of germplasm under two environmental conditions of Shunyi, Beijing and Changzhi, Shanxi, the leaf width of the germplasm carrying Seita.5G134600 5UTR277+ variant is significantly wider than that of the germplasm carrying Seita.5G134600 5UTR277- variant.

[0021] The primer of the molecular marker Seita.5G134600 5UTR277 of the present application can be used for typing the flag leaf width of millet, and the marker can be used for assisted selection of millet flag leaf breeding. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1Figure 1 is a leaf width phenotype of HZG and CN35 under different planting densities and a frequency distribution of flag leaf width of RIL population under different planting densities; wherein, A is a flag leaf photo of HZG and CN35; B is a flag leaf width phenotype of HZG and CN35 under different planting densities, C is a frequency distribution of flag leaf width of RIL population under different planting densities, c1 indicates a frequency distribution of flag leaf width under E1 density in 2021, c2 indicates a frequency distribution of flag leaf width under E1 density in 2022, c3 indicates a frequency distribution of flag leaf width under E2 density in 2022, c4 indicates a frequency distribution of flag leaf width under E3 density in 2022, c5 indicates a frequency distribution of flag leaf width under E2 density in 2023, and c6 indicates a frequency distribution of flag leaf width under E3 density in 2023.

[0023] Figure 2 Figure 2 is a change of flag leaf width of parent HZG and CN35 and RILs under different planting densities.

[0024] Figure 3 Figure 3 is a result of parent sequence alignment in the interval of 11731400-1731900 of qFLW5-2 locus.

[0025] Figure 4 Figure 4 is an InDel marker Seita.5G134600 5UTR277 Genotyping in parents and part of RIL population, wherein, 1-5 are five narrow leaf phenotype strains (FLW=2.00±0.15cm) randomly selected from RIL population, and 6-10 are five wide leaf phenotype strains (FLW=3.30±0.38cm) randomly selected from RIL population.

[0026] Figure 5 Figure 4 is an InDel marker Seita.5G134600 5UTR277 Figure 5 is a result of correlation analysis of genotyping and leaf width traits of different local natural germplasm; wherein, A indicates a result of correlation analysis of leaf width traits in Shunyi, Beijing, B indicates a result of correlation analysis of leaf width traits in Anyang, Henan, C indicates a result of correlation analysis of leaf width traits in Chaoyang, Liaoning, and D indicates a result of correlation analysis of leaf width traits in Changzhi, Shaanxi. DETAILED DESCRIPTION

[0027] In order to enable a person skilled in the art to better understand the technical solutions of the present application and implement the same, the present application will be further described below in conjunction with specific embodiments and drawings.

[0028] In the description of the present application, if not specially stated, the reagents used are commercially available, and the methods used are conventional techniques in the art.

[0029] The present application takes Heizhuigu (long and narrow leaf) and Changnong No. 35 (short and wide leaf) as the parent hybridization to derive the RIL population as the experimental material. Based on the high-density genetic map constructed by whole genome resequencing, QTL positioning analysis is carried out on the flag leaf width (FLW) trait of millet under three planting densities, and a stable QTL site qFLW5-2 located on chromosome 5 is obtained, and InDel marker Seita.5G134600 is developed in the interval of 11731400-11731900 of the site 5UTR277 . The marker is closely linked to the flag leaf width of millet. In the RIL population, the flag leaf width of the strains of Seita.5G134600 5UTR277+ and Seita.5G134600 5UTR277- is significantly different, and in the natural population of 680 germplasms under the conditions of Beijing Shunyi and Changzhi, Shanxi, the leaf width of the germplasm materials carrying Seita.5G134600 5UTR277+ variation is wider than that of the germplasm materials carrying Seita.5G134600 5UTR277- variation. The primer of the molecular marker Seita.5G134600 5UTR277 of the present application can be used for the genotyping of the flag leaf width of millet, and the marker can be used for the assisted selection of the flag leaf breeding of millet.

[0030] The nucleotide sequence of the InDel marker of the present application is shown as SEQ ID NO. 1:

[0031] TTGGGCCATGTTTAGTTACTCCCAACTCCTAACTTTGACACTATGCAAAAAGAAGATTCCCCATCACATCAAACTTGCGGTACATGCATGGAGTACTAAATGTAGATGAAATTAAAAACTAATTGCACAGTTTTGTTGTACTTTGCGAGACGAATCTTTTGAGCCTAATTAGTCAATATTTGGACAATAATTCACAAATACAAACGAAACGCTACAGTGTGCTACAGTGCTGTAACAGTAATTTGGCACCTCCCAAATTCCCCAACTAAACAAGGCC.

[0032] The nucleotide sequence of the Heizhuigu Seita.5G134600 gene is shown as SEQ ID NO. 4:

[0033] TGCTTGTGTGAGTGACCCGTGACCGTGAGCTTCCTTCTGTTGGTGAGCTTGCTCTGCACGGCCTGAGCCCTGAGGTGAGGGAGAGAGATACTAGGGCGGTGACCATGGCATGGCGGGGCCGGCTCGGGGAGACCGCGGACAGCGGCCTCGAGCTCAGCCTTGGCCTCCCGGCCTACTTCGCCAAGACCTCATCAGGTTAGTTTGCCAAGAACTGCTTCTTGTTT.

[0034] The nucleotide sequence of the Changnong No. 35 Seita. 5G134600 gene is shown as SEQ ID NO. 5:

[0035] TGCTTGTGTGAGTGACCCGTGACCGTGAGCTTCCTTCTGTTGGTGAGCTTGCTCTGCACGGCCTGAGCCCTGAGGTGAGGGAGAGAGATACTAGGGCGGTGACCATGGCATGGCGGGGCCGGCTCGGGGAGACCGCGGACAGCGGCCTCGAGCTCAGCCTTGGCCTCCCGGCCTACTTCGCCAAGACCTCATCAGGTTAGTTTGCCAAGAACTGCTTCTTGTTT.

[0036] The following specifically describes an InDel marker related to the flag leaf width trait of foxtail millet, a primer set, and an application.

[0037] I. Experimental process

[0038] 1. Construction of genetic population

[0039] The millet varieties Heizhu Gu and Changnong 35 with significant differences in flag leaf traits were selected as parents, and A was observed. Figure 1 The F1 generation was obtained by hybridization, and the F2 generation was obtained by selfing the F1 generation. The recombinant inbred line population containing 122 strains was obtained by continuous selfing of the F2 generation using single-seed transmission method, and was recorded as RIL-F7.

[0040] 2. Field planting, trait investigation and data analysis

[0041] The parents and RIL population were planted in the experimental field of the Millet Institute of Shanxi Agricultural University in 2021, 2022 and 2023, two rows per strain, row length 3m, row spacing 33cm, three planting densities treated according to plant spacing 6cm (505,000 plants / hm 2 , E1), 9cm (337,000 plants / hm 2 , E2), 12cm (262,000 plants / hm 2 , E3). According to the normal standard of field production management, management and pest control were carried out. After the millet headed and the stable length of the lower node, 3 plants with consistent growth vigor were selected for each strain to investigate the flag leaf width. Flag leaf width (FLW): the distance at the widest position of the flag leaf (cm). The phenotypic data of RIL population in three years were arranged and analyzed by using Office Excel 2021 and IBM SPSS Statistics 27 for descriptive statistical analysis, homogeneity of variance, significance detection, etc. The frequency distribution histogram and correlation analysis graph were drawn by using Origin 2021.

[0042] 3. Field sampling and leaf DNA extraction

[0043] In the experimental field, 3 plants of parents and each strain of RIL population were mixed and placed in the corresponding numbered centrifuge tubes, which were stored in liquid nitrogen. DNA was extracted by using the modified SDS method.

[0044] 4. 8% non-denaturing polyacrylamide gel electrophoresis

[0045] The specific steps are as follows:

[0046] Wash the clean glass flat plate and ear plate in turn, wipe clean with anhydrous ethanol. After drying, align the two plates and fix them with a clamp, then place them on the table to observe whether the plates are horizontal.

[0047] Prepare the working solution: prepare the polyacrylamide gel working solution according to the ratio of 40% acrylamide (Acr:Bis=39:1):5×TBE:deionized water=1:1:3.

[0048] Seal the bottom: In the fume hood, add 35 mL of working solution, 350 μL of 10% APS, and 20 μL of TEMED into a conical flask, shake well, then pour it into the foam plate groove, put the fixed plate vertically into the groove, and wait for 3 seconds for the liquid to soak into the bottom between the two plates, then take it out, and wait for solidification.

[0049] Pour the glue: In the fume hood, add 90 mL of working solution, 900 μL of 10% APS, and 70 μL of TEMED into a conical flask, shake well, then pour the glue, immediately insert the appropriate comb after the glue is poured, check if there are bubbles in the middle of the two plates, if there are, put the plate vertically on the table, and gently tap it up and down a few times to make the bubbles float out. After completion, place it on the table until the glue solidifies.

[0050] Plate loading: Remove the comb and clamps, clean the impurities on the plate, then put it into the electrophoresis tank and fix it.

[0051] Sample loading: Add enough 1 × TBE electrode buffer to the electrophoresis tank, and then add the Marker and 2 μL of PCR amplification product to the sample loading hole in sequence.

[0052] Electrophoresis: Adjust the voltage of the electrophoresis instrument to 120 v, the current to 100 mA, and the power to 50 W, and the time to about 1.5 h, until the bromophenol blue approaches the bottom of the plate.

[0053] After the PCR amplification product is separated by electrophoresis, silver staining is used for detection:

[0054] After the electrophoresis is completed, remove the gel plate, pry open the two plates, and put the glue into a basin containing deionized water and rinse quickly for about 8-10 s. Then, dye the glue in 0.1 wt% silver nitrate solution for 10 min; after silver staining, rinse quickly with deionized water for about 8-10 s. Add the developing solution prepared by 1 L of deionized water, 20 g of NaOH, 5 g of Na2CO3, and 750 μL of formaldehyde, and place it on a shaker in the fume hood, and constantly shake until the DNA bands are clearly visible. After the staining is completed, rinse the glue block with deionized water again twice, then take it out and take a photo.

[0055] 5. Whole genome resequencing and construction of high-density genetic map

[0056] After the DNA of each strain of the parents and RIL population is extracted, quality detection is performed. After passing the quality detection, send it to Shijiazhuang Borui Di Biological Technology Co., Ltd. to complete the subsequent library construction and high-throughput sequencing, etc. The genetic map is constructed using the mstmap function in the R package ASMap.

[0057] 6. QTL positioning analysis

[0058] The composite interval mapping (CIM) in the software Windows QTL Cartographer V2.5 was used to locate and analyze the four flag leaf traits of the RIL population. The parameter settings: select Model 6: Standard Model model and Forward & Backward Method regression method, the number of permutations is 1000 times, the number of markers and window size are set to 5 and 10 cM, the LOD threshold is set to 2.5, and the rest is unchanged. When the LOD value is greater than or equal to 2.5, it is considered that there may be a QTL in this interval.

[0059] 7、Single marker analysis

[0060] Single marker analysis refers to statistical analysis of the average value of a certain quantitative trait under different genotypes of the same molecular marker. If there is a significant difference between the average values, it indicates that there is a QTL tightly linked to the molecular marker. The tighter the linkage between the marker and the QTL, the greater the difference in quantitative traits between genotypes, and the higher the significance. According to the millet reference genome sequence and the whole genome resequencing results of the parents, the difference sites between the parents in the QTL positioning interval of flag leaf width were searched, and the sites with a difference of more than 10 bp were preferentially selected. The upstream and downstream 300 bp sequences of the corresponding sites were searched using the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), and the primers were designed using the Primer3.0 online website (http: / / primer3.ut.ee / ).

[0061] 8、Genotype detection of RIL population

[0062] Whether the newly designed primers have polymorphism between Heizhuigu and Changnong 35 was screened, and the polymorphic primers obtained were used to detect the genotypes of each strain of the RIL population (F9 generation in 2023). Five single plants of each strain were randomly selected and mixed, and the super lightning mix (LP800) of Beijing Jinbaitie Biotechnology Co., Ltd. was used for amplification and detection by 8% non-denaturing polyacrylamide gel electrophoresis. The super lightning mix (LP800) contains three components: nucleic acid release agent (lysis solution), lightning mix (2x PCR mix), and ddH2O. The product does not need to extract genomic DNA, and the lysis solution can quickly lyse animal and plant tissue cell samples to release DNA as a template for PCR amplification. The specific operation steps are as follows:

[0063] DNA extraction: mixed leaves were placed in 2.0 ml centrifuge tube and added with steel beads, frozen in liquid nitrogen and ground into powder state using a grinder; the steel beads in the tube were poured out and 30 μL nucleic acid release agent was added, centrifuged at 12000 rpm for 1-3 min, and if the nucleic acid release agent appeared to be precipitated, it was dissolved and clarified at 37℃, then used, and the amount can also be adjusted according to the needs; the centrifuge tube with the nucleic acid release agent was placed in boiling water for boiling treatment for 3-5 min; after boiling, the centrifuge tube was placed in the centrifuge at 12000 rpm for 3 min; then the liquid in the tube was all sucked into a new 1.5 ml centrifuge tube, the new 1.5 ml centrifuge tube was again placed in the centrifuge at 12000 rpm for 5 min, and the supernatant was sucked into a PCR plate, 50 μL ddH2O was added for dilution, and stored at -20℃. When the template was taken out again, 12000 rpm centrifugation for 8 min could take 2 μL of supernatant for PCR template. The PCR reaction system (operated on ice) is shown in Table 1.

[0064] Table 1 PCR reaction system

[0065] Reaction components Reaction volume (10 μL) Template DNA 1 μL Primers: F+R 1.5 μL 2x PCR mix 5 μL ddH2O 2.5 μL

[0066] The PCR reaction program is shown in Table 2.

[0067] Table 2 PCR reaction program

[0068]

[0069] The PCR primer group is shown in Table 3.

[0070] Table 3 PCR primer group

[0071] Primer Sequence No. Upstream primer 5'-AGTGACCCGTGACCGTGAG-3' SEQ ID NO. 2 Downstream primer 5'-AGTGACCCGTGACCGTGAG-3' SEQ ID NO. 3

[0072] The present application uses 8wt% non-denaturing polyacrylamide gel for electrophoretic separation of PCR amplification products, and silver staining detection. The gel image is statistically analyzed using Excel, and when the band position is consistent with the black branch valley band position, it is recorded as "A", and when the band position is consistent with Changnong 35, it is recorded as "B", when the two bands appear at the same time, it is recorded as "H", and when the target band is missing or unclear, it is recorded as "-".

[0073] 9. Flag leaf transcriptome difference analysis and candidate gene mining of millet

[0074] Experiments were conducted on Heizhuiguj and Changnong 35 at the heading stage (HD) and the grain filling stage (GF). The sampling time was 9:00 am, and the sampling site was the widest part of the flag leaf. Three plants with similar growth vigor were randomly selected for each variety as triplicates. After sampling, the samples were quickly placed in a liquid nitrogen-filled cooler and brought back to the laboratory. After being frozen in liquid nitrogen, they were stored in an ultra-low temperature freezer. The samples were sent to Beijing Baimaik Biological Technology Co., Ltd. for RNA extraction, quality detection, library construction, quality control, and high-throughput sequencing. The sequencing platform was Illumina, and the sequencing mode was PE150. Genes with significant differences in expression levels in different samples are called differentially expressed genes (DEGs). DEGs were screened using DESeq2_edgeR software with the following criteria: FoldChange ≥ 2 and FDR < 0.05. Hierarchical clustering was used to analyze all DEGs, and genes with the same or similar expression patterns in each sample were clustered and plotted as a heatmap. According to the expression levels of DEGs in the two groups, they can be divided into up-regulated and down-regulated genes, which are relative. The number of up-regulated and down-regulated DEGs in each comparison group was counted and plotted.

[0075] Based on the RNA-seq data, the target interval was analyzed for differentially expressed genes. Then, candidate genes controlling leaf width were inferred based on gene function annotation, WGCNA, and gene expression pattern analysis. The sequences of the candidate genes were obtained from Phytozome data (https: / / phytozome-next.jgi.doe.gov / ) and primers were designed for amplification.

[0076] II. Experimental Results

[0077] 1. Construction of high-density genetic map

[0078] Using Heizhuiguj as the female parent and Changnong 35 as the male parent, a high-density genetic map was constructed for the recombinant inbred line (RIL) population containing 122 strains. The map included 3795 Bin markers, with a total map distance of 3164.72 cM and an average map distance of 0.88 cM.

[0079] 2. Flag leaf width traits of parents and RIL populations under different planting densities

[0080] The flag leaf width of parents Heizhuiguj and Changnong 35 showed significant differences under six environmental conditions, such as Figure 1B, in the RIL population, the average of each trait under different environments is basically between the two parents, the coefficient of variation is more than 10.00%, the highest can be up to 20.82%; in addition, the absolute value of skewness and kurtosis of each trait in different environments is less than 1, which can be approximately considered to conform to normal distribution. The population frequency distribution graph also shows that the flag leaf width trait presents continuous distribution in different environments, such as Figure 1 C. In summary, the flag leaf width trait is a quantitative trait, controlled by multiple genes, and is easily affected by the environment.

[0081] With the increase of planting density, the flag leaf width value of Changnong 35 decreases, and there is significant difference among the three planting densities; however, there is no significant difference in the flag leaf width of Heizhuanggu under the three density conditions, and there is significant difference in the flag leaf width of RILs between E1 and E2, as shown in Figure 2 . It shows that the flag leaf width trait is affected by genetics and environmental factors.

[0082] 3. QTL mapping of flag leaf width trait under different planting density environments

[0083] Based on the high-density genetic map constructed by re-sequencing of RIL population, combined with the phenotypic data of flag leaf traits of RIL population under multi-year and multi-density conditions, the compound interval mapping method of WinQTLCartV2.5 was used to detect the flag leaf width QTL, and the results are shown in Table 4. A total of 10 QTLs related to millet flag leaf width were located on the 3rd, 5th, 6th and 8th chromosomes, with LOD values ranging from 2.75 to 4.92, contribution rates between 7.73% and 15.22%, and additive effects of-0.23 and 0.22, as shown in Table 3. Among them, qFLW5-2 is a major QTL with a positioning interval of 6. qFLW3-1 and qFLW3-2 are located in the 23.15Mb-26.94Mb and 45.01Mb-45.42Mb intervals of the 3rd chromosome, with phenotypic variation contribution rates of 10.30% and 14.01%. qFLW5-1 and qFLW5-3 are located in the 5.91Mb-6.12Mb and 34.55Mb-34.95Mb intervals of the 5th chromosome, with phenotypic variation rates of 12.25% and 11.26%, LOD values of 4.15 and 3.49, and the beneficial alleles are derived from Changnong 35. qFLW8 and qFLW9 are located in the 37.64Mb-37.91Mb and 14.43Mb-15.90Mb intervals of the 8th and 9th chromosomes, respectively, with phenotypic variation rates of 11.69% and 15.22%, LOD values of 3.91 and 4.89, and additive effects of 0.22 and-0.21, and the beneficial alleles are derived from Heizhuigu and Changnong 35, respectively. At the same time, qFLW3-2 and qFLA3-2, qFLW6-1 and qFLR6-1, qFLW6-2 and qFLR6-3 all have co-location, and one interval contains QTLs controlling different traits.

[0084] Table 4 QTL positioning of RIL population flag leaf width

[0085]

[0086] 4. Single marker analysis

[0087] The two QTL sites qFLW9 and qFLW3-2 with the highest phenotypic variation rates were selected, and the sites qFLW6-2 repeatedly detected and the site qFLW5-2 partially overlapping with the sites reported by previous studies were subjected to single marker analysis. The results showed that compared with other intervals, the interval marker of qFLW5-2 was more closely linked to the leaf width phenotype, and therefore qFLW5-2 was likely to be a key site controlling the leaf width of millet.

[0088] 5. Prediction of candidate genes by RNA-seq combined with QTL positioning

[0089] Heading (HD) and grain-filling (GF) are two critical stages in millet growth and development. The flag leaf width of Heizhi Millet and Changnong 35 showed highly significant differences during both stages. Therefore, we selected these two stages for transcriptome analysis. Based on resequencing data, transcriptome data, and WGCNA analysis, we strongly suggest that Seita.5G134600 is a highly likely candidate gene for qFLW5-2. According to gene annotation, the protein encoded by the Seita.5G134600 gene belongs to the AUX / IAA family.

[0090] 6. Development and application of InDel markers for flag leaf width and tight interlocking

[0091] Sequence alignment analysis of the Seita.5G134600 gene in Heizhigu and Changnong 35 showed that, compared to Changnong 35, Heizhigu has a 277bp deletion at the 5'UTR (located 66bp upstream of the start codon ATG). Figure 3 As shown, an InDel marker Seita.5G134600 was developed at the missing location Chr.5:11731400~11731900. 5UTR277 The results were validated in the parental lines and the RIL population. The results showed that the genotype of the randomly selected broad-leaved phenotype line (3.30±0.38) in the RIL population was consistent with that of Changnong 35, and the genotype of the narrow-leaved phenotype line (2.00±0.15) was consistent with that of Heizhigu. Figure 4 As shown. In addition, among 680 germplasm accessions from natural populations under two environmental conditions in Shunyi, Beijing and Changzhi, Shanxi, some carried Seita.5G134600. 5UTR277+ The leaf width of the mutant germplasm is generally wider than that of the material carrying Seita.5G134600. 5UTR277- The flag leaf width of the mutated germplasm materials was originally obtained from the millet comprehensive database Setaria-db, such as... Figure 5 As shown in the figure. Therefore, it can be inferred that the deletion of 277bp in the 5'UTR region of this gene is the cause of the difference in leaf width between the two parents' flag leaves.

[0092] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0093] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. An application of InDel markers in identifying the flag leaf width trait of millet, characterized in that, The identification of the flag leaf width trait of millet is carried out according to the following steps: Using the millet DNA to be identified as a template, PCR amplification was performed using InDel-labeled primers, and the presence of InDel-labeled gene fragments in the amplification products was detected to determine whether millet flag leaves exhibited a broad or narrow trait; the nucleotide sequence of the InDel-labeled marker is shown in SEQ ID NO.

1. The flag leaf of millet containing the gene fragment shown in SEQ ID NO.1 is wider than the flag leaf of millet whose amplification product does not contain the gene fragment of SEQ ID NO.1; The primer set consists of an upstream primer with a nucleotide sequence such as SEQ ID NO.2 and a downstream primer with a nucleotide sequence such as SEQ ID NO.3.