KASP typing marking method for digitaria chrysocoma ACCase gene 2027 resistance mutation site and application of KASP typing marking method for digitaria chrysocoma ACCase gene 2027 resistance mutation site

Abstract

The invention relates to a typing marking method for a gene mutation site related to herbicide resistance in a weed digitaria ciliariana and application of the typing marking method for the gene mutation site related to the herbicide resistance in the weed digitaria ciliariana. According to the method, a KASP fluorescent probe analysis method is adopted, two groups of specific primers are designed, and three resistance mutation types (Mut-1, Mut-2 and Mut-3) on a site 2027 of a digitaria chrysocoma Accase gene can be effectively identified. The invention provides a rapid, economic and efficient weed target resistance identification method, and a basis is provided for herbicide resistance identification and precise herbicide selection prevention and control of resistant weeds. In addition, the universality and flexibility of the method also provide support for large-scale resistance identification and sustainable treatment of drug resistance.

Description

Technical Field

[0001] The present invention relates to the field of plant genomics and agricultural biotechnology, in particular to a typing and marking method for gene mutation sites associated with herbicide resistance in the weed Digitaria ciliaris and its application. The method is mainly used for the management and control of resistant weeds in agricultural production, and has important economic value and ecological significance. Background Art

[0002] With the continuous development of global agricultural production, weeds have become an important factor restricting the yield and quality of crops. Digitaria ciliaris is an annual grass weed with strong adaptability, rapid growth, strong reproductive ability and serious harm. It can survive and reproduce under various environmental conditions. This weed is commonly found in rice, corn, soybean, sweet potato and other farmlands. Its root system is well developed and can effectively absorb water and nutrients from the soil. It has strong competitiveness with crops and greatly affects the growth, yield and quality of crops. Chemical control has always been the dominant technical means for farmland weed control. However, with the long-term continuous use of single-action type herbicides, Digitaria ciliaris has gradually developed obvious resistance to multiple herbicides. A large number of studies at home and abroad have found that mutations in herbicide target enzyme genes lead to a decrease in the ability of the target enzyme to bind to the herbicide, thereby reducing the herbicide prevention effect or even completely ineffective, resulting in the generation and spread of herbicide resistance, which has brought huge challenges to agricultural production. There is an urgent need to find effective detection and control methods.

[0003] In previous studies, scientists have conducted in-depth analysis of the acetyl-CoA carboxylase (ACCase) gene of grass weeds, and found a total of 7 amino acid variation sites in the ACCase CT region: Ile-1781, Trp-1999, Trp-2027, Ile-2041, Asp-2078, Cys-2088, and Gly-2096. In the early stage of the laboratory, the molecular mechanism of target resistance of different populations of hairy crabgrass resistant to the herbicide oxadiazine was studied. The results showed that the mutation of the 2027 site of the ACCase gene of hairy crabgrass was closely related to resistance, and the mutation of the 2027 site was found in multiple resistant populations. Therefore, the development of typing markers for this mutation site and the establishment of a rapid detection method for resistance at the 2027 site of hairy crabgrass can provide strong technical support for the precise selection of drugs and scientific prevention and control of hairy crabgrass.

[0004] Competitive allele specific PCR (KASP) typing technology has attracted much attention due to its high specificity and simplicity. The principle of this technology is to distinguish SNPs and InDels (Insertions and Deletions) types based on the specific matching of the primer terminal bases. KASP primers contain two SNP fluorescent probes (such as FAM and HEX), two universal quenching probes, and a universal primer. KASP analysis has the advantage of high throughput. It uses a fully automatic nucleic acid extractor and a fluorescent quantitative PCR platform, and uses 96-well plates or 384-well plates. Its SNP detection throughput can reach tens of thousands. Similar to TaqMan probe SNP analysis, KASP analysis also uses high-fidelity Taq DNA polymerase, and the system contains necessary amplification components such as dNTPs and salt ions. The difference from TaqMan technology is that KASP is based on the unique ARM PCR amplification principle. For a single site in a single sample, dual-color fluorescence detection is used. There is no need to design specific fluorescent primers for each SNP site, which greatly reduces the reagent cost of KASP. Therefore, KASP has become the gold standard for mutation analysis and is widely used in medicine and agriculture.

[0005] As the problem of herbicide resistance becomes increasingly serious, the research on rapid analysis technology of mutation sites of herbicide target enzymes (ACCase, ALS, EPSPS, etc.) is becoming increasingly important. The present invention provides a KASP typing and marking method for the 2027 resistance mutation site of the ACCase gene of Digitaria tangutica and its application. The method can specifically identify multiple mutation types of the 2027 resistance site of Digitaria tangutica. In addition, the method combines the rapid nucleic acid extraction technology to provide an effective tool for further rapid identification of resistance mutations and precise drug selection for resistance management. It can not only help farmers choose suitable herbicides in practice and reduce production costs, but also provide support for the sustainable development of agriculture. Summary of the invention

[0006] The present invention provides a KASP typing and marking method for the ACCase gene 2027 mutation site of Digitaria tangutica. The method can efficiently and accurately identify the resistance genotype of Digitaria tangutica, thereby providing support for the effective control of resistant weeds in agricultural production.

[0007] The technical solution adopted by the present invention is:

[0008] A KASP typing and marking method for the 2027 mutation site of the ACCase gene of the weed Digitaria tangutica comprises the following steps:

[0009] (1) Extraction of DNA from Digitaria tangutica;

[0010] (2) DNA quality testing and dilution;

[0011] (3) Design KASP primers based on the 2027 mutation site of the ACCase gene of Digitaria pubescens, and perform fluorescence PCR amplification on the diluted DNA;

[0012] (4) After amplification, KASP detection results are analyzed.

[0013] For the mutation type 1 at site 2027 of the hairy horsetail gene, two sets of primers were designed in the KASP primer design: forward primer F1 plus FAM sequence:

[0014] 5'-FAMGAAGGTGACCAAGTTCATGCTCCTCTCTTCATCCTTGCTAACTG-3'; forward primer F2 plus VIC sequence:

[0015] 5'-GAAGGTCGGAGTCAACGGATTCCTCTCTTCATCCTTGCTAACTC-3'; reverse primer Commen: TCTCTTTGTCCACCAGAGA AAC.

[0016] For the mutation type 2 at site 2027 of the hairy horsetail gene, two sets of primers were designed in the KASP primer design: forward primer F3 plus FAM sequence:

[0017] 5'-FAMGAAGGTGACCAAGTTCATGCTCCTCTCTTCATCCTTGCTAACTGG-3'; forward primer F4 plus VIC sequence: 5'-GAAGGTCGGAGTCAACGGATTCCTCTCTTCAT CCTTGCTAACTGY-3'; reverse primer Commen: TCTCTTTGTCCACCAGAGAAAC.

[0018] The KASP typing labeling method of the present invention has the following characteristics:

[0019] (1) High specificity: It can effectively distinguish different genotypes, especially wild type and mutant type.

[0020] (2) Simplicity: It uses fluorescent PCR amplification technology, which is easy to operate and suitable for large-scale application.

[0021] (3) Rapidity: The typing time is short and the results can be obtained in a short time, which meets the needs of agricultural production.

[0022] The implementation of the invention will provide a scientific basis for the use of herbicides in agricultural production, thereby promoting the development of sustainable agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Represents the PCR amplification electrophoresis analysis and sequencing analysis of the mutation site of Digitaria tricolor 2027, including (A) PCR amplification electrophoresis diagram of different populations; (B) mutation type and resistance (R) and sensitivity (S) analysis of different populations.

[0024] Figure 2 Represents the typing results of KASP mutation type 1 (Trp-2027-Ser).

[0025] Figure 3 Indicates the typing result of KASP mutation type 2 (Trp-2027-Cys)

[0026] Specific implementation

[0027] Example 1: Analysis of the 2027 mutation site of the Accase gene of Digitaria pubescens

[0028] 1. Test materials

[0029] Samples of different populations of hairy crabgrass (JS-19-C3, JS-21-C1, JS-21-C5, JS-21-C7, JS-21-C8) were collected from rice fields in Yancheng, Jiangsu Province, Nanjing, Jiangsu Province, Chuzhou, Anhui Province, Tianchang, Anhui Province, and Yangzhou, Jiangsu Province. The seeds were sown in plug trays and cultured to the 4-6 leaf stage. The spray tower sprayed 4 times the recommended dose of oxadiazine (MET). The herbicide symptoms of the seedlings were observed 2 weeks after treatment. The resistance levels of different populations of hairy crabgrass were counted, R indicated resistance to the herbicide MET, and S indicated sensitivity to MET. After indoor bioassays, the results showed that JS-19-C3 and JS-21-C7 were highly resistant to MET (R), and JS-21-C, JS-21-C5, and JS-21-C8 were sensitive populations (S).

[0030] 2. Research Methods

[0031] Rapid DNA extraction

[0032] The DNA rapid extraction method refers to the kit method (Shanghai Youlong Biotechnology Co., Ltd., HC0132), and the specific operation is as follows:

[0033] (1) Take 20 mg of leaf sample and place it in a 1.5 mL centrifuge tube;

[0034] (2) Add 300 μL of nucleic acid extract to the above centrifuge tube, add grinding beads, and grind with a tissue grinder at 1600 rpm for 10 s;

[0035] (3) inserting the binding area of ​​the nucleic acid extraction test strip into the nucleic acid extraction solution for adsorption for about 10 seconds;

[0036] (4) Take another centrifuge tube, add 200 μL of elution solution, and insert the binding area of ​​the nucleic acid extraction test strip into the elution solution for about 5 seconds;

[0037] (5) inserting the binding area of ​​the nucleic acid extraction test strip into the PCR amplification system for 5 seconds to release the DNA;

[0038] (6) Perform PCR amplification.

[0039] 3. PCR Amplification and Sequencing Analysis

[0040] According to the results of PCR amplification and sequencing of the 2027 mutation site of the ACCase gene of Digitaria pubescens, amplification primers were designed. Amplification primer ACCase-F: AGGATCGGCATAGCTGATGAA; amplification primer ACCase-R: CCATTATCTTAGGACCACCCAATT. The amplification length was 585bp. The amplification reagent used was PCR amplification reaction reagent 2×Rapid Taq Master Mix (produced by Nanjing Novi Company, catalog number: P222-01). The specific system preparation is shown in Table 1:

[0041] Table 1 PCR amplification reaction components

[0042]

[0043] Amplification program: The PCR reaction program was 34 cycles of pre-denaturation at 95°C for 5 min, denaturation at 95°C for 25 sec, annealing at 56°C for 25 sec, and extension at 72°C for 20 sec, and ended with extension at 72°C for 10 min. Agarose gel electrophoresis analysis was performed after amplification.

[0044] PCR amplification analysis was performed on 39 samples, and the target band was around 500. The results are as follows Figure 1 As shown in A. The sequencing results showed that compared with the sensitive populations of JS-21-C, JS-21-C5, and JS-21-C8, the two highly resistant hairy crabgrass populations of JS-19-C3 and JS-21-C7 MET had two types of amino acid mutations (Trp-2027-Ser / Cys) and three types of nucleotide mutations (TGG-TCG / TGC / TGT). Figure 1 As shown in B.

[0045] 4.KASP primer design and result analysis

[0046] 4.1 According to the mutation type 1 at site 2027 of the Digitaria tricholoma gene, two sets of primers were designed in the KASP primer design: forward primer F1 plus FAM sequence: 5'-FAMGAAGGTGACCAAGTTC ATGCTCCTCTCTTCATCCTTGCTAACTG-3'; forward primer F2 plus VIC sequence: 5'-GAA GGTCGGAGTCAACGGATTCC TCTCTTCATCCTTGCTAACTC-3'; reverse primer Commen: TCTCTTTGT CCACCAGAGAAAC.

[0047] 4.2 According to the mutation type 2 at site 2027 of the hairy crabgrass gene, two sets of primers were designed in the KASP primer design: forward primer F3 plus FAM sequence: 5'-FAMGAAGGTGACCAAGTT CATGCTCCTCTCTTCATCCTTGCTAACTGG-3'; forward primer F4 plus HEX sequence: 5'-GAAGGTCGGAGTCAACGGATTCCTC TCTTCATCCTTGCTAACTGY-3', Y represents (C or T). Reverse primer Commen: TCTCTTTGTCCACCAGAGAAAC.

[0048] 5. KASP reaction system and procedure

[0049] 5.1 KASP reaction system

[0050] The reaction system is shown in Table 2.

[0051] Table 2 KASP reaction system

[0052] PCR amplification reaction components Volume (10 μL) qPCR Master Mix 5 F1 0.2 F2 0.2 Quenching 1 0.2 Quenching 2 0.2 Commen 0.4 Template 0.5 DNFbuffer 0.5 <![CDATA[ddH2O]]> 2.8

[0053] 5.2 KASP Amplification Procedure

[0054] The specific KASP amplification procedure is shown in Table 3.

[0055] Table 3 KASP amplification procedure

[0056] program temperature time 1 94℃ 15min 2 94℃ 20s 3 61℃-55℃ Each cycle drops 0.6℃ (10 cycles) 4 94℃ 20s 5 55℃ 60s (26 cycles), collecting fluorescence once in each cycle 6 37℃ 60s

[0057] 6. Analysis of KASP mutation type 1 typing results

[0058] The typing results were analyzed using a BIO-RAD CFX real-time fluorescence quantitative analyzer. 17 samples from three groups, JS-21-C1, JS-21-C5, and JS-19-C3-1, were analyzed. The KASP genotyping results showed that the fluorescent signals with FAM labels (orange) were concentrated near the X-axis, and the fluorescent signals with VIC labels (blue) were concentrated near the Y-axis. The rest were heterozygous types (green), and black indicated blank controls. The results are shown in Figure 2. Figure 2 shown.

[0059] Twelve individual samples from three groups, JS-21-C8, JS-21-C7, and JS-19-C3-2, were analyzed. The fluorescent signals with FAM labels (orange WT) were concentrated near the X-axis, the fluorescent signals with VIC labels (blue) were concentrated near the Y-axis, and the heterozygous type (green) was indicated by black, as shown in the figure. Figure 3 shown.

[0060] 7. KASP marker detection of herbicide resistance genes in the hairy crabgrass population

[0061] The KASP marker typing results were verified by PCR amplification and sequencing, and the results are shown in Table 5. The nucleotide mutation types of the resistant population (R) JS-19-C3-1 and JS-21-C7 were TCG, TGC, and TGT. The nucleotide sequence of the sensitive population (S) JS-21-C8, JS-21-C7, and JS-19-C3-2 was TGG.

[0062] Table 4 Primer sequences of KASP markers

[0063]

[0064]

[0065] Table 5 Typing results of herbicide resistance genes in Digitaria tangutica population detected by KASP marker

[0066]

[0067] The accuracy of the KASP marker typing results was verified by PCR amplification sequencing. The results showed that the KASP marker typing results of 29 individual samples from four populations were consistent with the Sanger sequencing results, with an accuracy of 100%, indicating that the accuracy of the KASP marker is high. In addition, the method has a high throughput and can process 96 or 384 samples at the same time. It has the advantages of accuracy, convenience, and high throughput in genotyping technology.

Claims

1. A KASP typing method for the Accase gene 2027 mutation site of the weed Digitaria tangutica, comprising the following steps: (1) Extraction of DNA from Digitaria tangutica, (2) DNA quality testing and dilution, (3) KASP primers were designed based on the 2027 mutation site of the Accase gene of Digitaria pubescens, and the diluted DNA was amplified by fluorescence PCR. (4) After amplification, KASP test results are analyzed; For the mutation type 1 (Mut-1) at the 2027 site of the hairy crabgrass gene, two sets of primers were designed in the KASP primer design: forward primer F1 plus FAM sequence: 5'-FAMGAAGGTGACCAAGTTCAT GCTCCTCTCTTCATCCTTGCTAACTG-3'; forward primer F2 plus VIC sequence: 5'-GAAGG TCGGAGTCAACGGATTCCTCTCTT CATCCTTGCTAACTC-3'; reverse primer Commen: TCTCTTTGTCCAC CAGAGAAAC; For mutation type 2 and mutation type 3 (Mut-2 and Mut-3) at site 2027 of the Digitaria tangutica gene, two sets of primers were designed in the KASP primer design: forward primer F3 plus FAM sequence: 5'-FAMGAAGGTGACCAAGTTCATGCTCCTCTCTTCATCCTTGCTAACTGG-3'; forward primer F4 plus HEX sequence: 5'-GA AGGTCGGAGTCAACGGATTCCTCTCTTCATCCTTGCTAACTGY-3'; reverse primer Commen: TCTCT TTGTCCACCAGAGAAAC.

2. The KASP typing labeling method according to claim 1, characterized in that: The hairy horsetail resistance gene loci, i.e., hairy horsetail resistance associated SNP loci information is as follows:

3. The KASP typing labeling method according to claim 1, characterized in that: KASP analysis reagent is prepared based on 2×TaqMan Fast qPCR Master Mix. Every 10μL contains 2×TaqMan Fast qPCRmaster Mix 5μL, 10μM forward primer 0.2-0.25μL each, 10μM quencher 1 and quencher 2 0.2-0.25μL each, 10μM Commen 0.4-0.5μL, Template 0.5-1μL, DNFbuffer 0.5μL, and ddH2O to make up to 10μL.

4. The KASP typing labeling method according to claim 1, wherein the KASP analysis amplification procedure is as follows: 。 5. According to the KASP typing and labeling method of claim 1, the KASP mutation type typing result analysis and determination adopts a real-time fluorescence quantitative analyzer, the real-time fluorescence quantitative analyzer has multiple fluorescence channels, WT is modified by FAM fluorescence signal, and the result is gathered near the X axis, Mut is modified by non-FAM fluorescence signal, displayed in blue, and gathered near the Y axis, the heterozygous type is displayed in green, and gathered between the X and Y axes, and black represents a blank control.

Images