InDel molecular marker for screening rice salt-tolerant gene Ts33 and application of InDel molecular marker

Abstract

The invention relates to the technical field of biology, and particularly provides an InDel molecular marker for screening a rice salt-tolerant gene Ts33 and application of the InDel molecular marker. The method comprises the following steps: selecting leaves of rice to extract genome DNA (deoxyribonucleic acid) of the tissues, then respectively carrying out PCR (polymerase chain reaction) amplification by taking the DNA of the tissues as a template and taking corresponding sequences of ProTs33-F1 and ProTs33-R1 as specific primers to obtain amplified fragments, and after electrophoresis, determining that the strains with 238bp bands are salt-sensitive strains, and determining that the strains without bands are salt-tolerant strains. According to the invention, the rice variety improved by utilizing the wild rice Ts33 gene can be rapidly bred, the current situations of more field work and large workload caused by carrying out a large amount of salt tolerance identification by utilizing a population material can be improved, and the method has important theoretical and practical significance for breeding a new variety of rice with salt tolerance character.

Description

Technical Field

[0001] The invention relates to the technical field of rice variety screening, in particular to an InDel molecular marker for screening a rice salt-tolerant gene Ts33 and an application thereof. Background Art

[0002] Rice ( Oryza sativa L.) is one of the world's important food crops. With the continuous surge in the world's population, ensuring high and good yields of rice has become a top priority in rice research. Since the mid-20th century, two leaps in rice yield have been achieved through dwarfing breeding and the use of hybrid vigor. Rice is a salt-sensitive crop. During the vegetative growth stage, rice seedlings are more sensitive to salt; during the reproductive growth stage, rice is highly sensitive to salt. Today, the increase in rice yields has reached a bottleneck period, and more than 20% of arable land cannot be effectively used due to salinization. The ancestor of Asian cultivated rice, common wild rice ( Oryza rufipogon ), which preserves the specific genes that have disappeared or weakened in the domestication process of cultivated rice, and has good resistance and tolerance to various environmental stresses. Therefore, using wild rice resources to discover and identify new rice salt-tolerance genes and apply them to rice breeding can not only control and improve salinized soils, but also make full use of salinized soils, and even become a solid foundation for ensuring the steady increase of my country's rice production.

[0003] There are abundant salt-tolerance genes in rice germplasm resources, but most rice salt tolerance is a genetically complex trait, generally controlled by multiple micro-effect genes. In order to further explore these salt-tolerance genes, researchers usually locate them by constructing recombinant inbred lines, backcross inbred lines, substitution lines and other mapping populations with simple backgrounds. So far, only one major effect QTL SKC1 at the seedling stage has been successfully cloned. However, there are few reports on how to identify and obtain salt-tolerance genes in wild rice. Summary of the invention

[0004] The purpose of the present invention is to use the constructed backcross genetic population of highly salt-tolerant common wild rice and cultivated rice variety NK57 (Nongken 57) to explore genes related to salt tolerance in wild rice and develop corresponding salt-tolerant molecular markers. A salt-tolerant gene Ts33 was located, and the InDel marker associated with it was developed, providing a new molecular marker for improving rice salt tolerance to accelerate the process of rice salt-tolerant breeding.

[0005] In order to achieve the above object, the present invention provides the following technical solutions: The first aspect of the present invention provides an application of the InDel molecular marker in the promoter region of rice Ts33 in screening salt-tolerant rice varieties. The upstream primer sequence of the specific primer pair for amplifying the InDel molecular marker is shown in ProTs33-F1, and the downstream primer sequence is shown in ProTs33-R1; the upstream primer ProTs33-F1 (SEQ ID NO: 1): ATGCACTCGGGTAAGCTGTT; the downstream primer ProTs33-R1 (SEQ ID NO: 2): AGGTTCAGAGAGATGTTGTGCA; the amplified product size is 238bp.

[0006] The second aspect of the present invention provides the use of the specific primer pair of the above-mentioned InDel molecular marker in molecular screening of salt-tolerant rice varieties.

[0007] The third aspect of the present invention provides a method for screening the presence or absence of a salt-tolerant gene in a rice Ts33 promoter region, comprising the following steps: S1. Select rice leaves and use a DNA extraction kit (TIANGEN) to extract DNA from the test materials. According to the different SNP site information in the parents, select the polymorphic primers between the two parents to design molecular markers to detect the genotype in the offspring population. Then use the DNA of the above tissues as a template and the corresponding sequences of ProTs33-R1 and ProTs33-F1 as specific primers to perform PCR amplification to obtain amplified fragments; S2. After agarose gel electrophoresis, the Ts33 promoter fragment had only one 238 bp main band, which was a salt-sensitive strain, while the strain without any band was a salt-tolerant strain.

[0008] Furthermore, the PCR amplification system is as follows: the volume is 51 µL, including 2 µL DNA, 1 µL KOD-FX enzyme, 1.5 µL forward primer and 1.5 µL reverse primer, 25 µL 2×PCR Buffer for KOD FX, ddH 2 O 10 µL, dNTP 10 µL.

[0009] Furthermore, the PCR amplification program is: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 68°C for 30 s, 35 cycles; extension at 68°C for 10 min.

[0010] Beneficial effects of the present invention: The InDel molecular marker was used to detect the parent wild rice, NK57 and randomly selected offspring population F 6 The genotypes of 6 different strains in wild rice / NK57 were analyzed, and the parent wild rice and 3 of them were found to be F 6The DNA of the first generation lines was amplified by PCR and no bands appeared in electrophoresis, all of which were wild rice genotypes, while the parent NK57 and the other three F 6 After the DNA of the first generation line was amplified by PCR, only one 238bp main band was found in the electrophoresis, which was the cultivated rice genotype. Therefore, the molecular marker can be used to quickly select salt-tolerant rice materials improved by using the wild rice Ts33 gene, which helps to improve the current situation of heavy field work and heavy workload caused by using a large number of group materials for salt tolerance identification, and has important theoretical and practical significance for breeding new rice varieties with salt tolerance traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is the electrophoresis diagram of the rice Ts33 promoter fragment in Example 1: M is Marker 2000, and the lanes are wild rice and cultivated rice NK57, respectively.

[0012] Figure 2 The electrophoresis diagram of the rice Ts33 promoter fragment in Example 2: M is Marker 2000, and the lanes are: cultivated rice NK57, wild rice and F 6 Group, T 1 、T 2 、T 3 Salt-tolerant F 6 Generation single plant, S 1 , S 2 , S 3 Salt-tolerant F 6 Generation of single plants.

[0013] Figure 3 Wild rice, NK57 and 6 F before and after salt stress 6 Salt tolerance phenotype of the first generation of individual plants. DETAILED DESCRIPTION

[0014] The specific implementation modes of the present invention are described below so that those skilled in the art can understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation modes. For those of ordinary skill in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the attached claims, these changes are obvious, and all inventions and creations utilizing the concept of the present invention are protected.

[0015] Experimental materials: Wild rice, cultivated rice NK57, and offspring population F established with wild rice and cultivated rice NK57 as parents 6 . Example 1

[0016] A method for screening whether a salt-tolerant gene Ts33 exists in a promoter region of rice comprises the following steps: S1. Extract genomic DNA of the above tissues from rice leaves, then use the DNA of the above tissues as templates and the corresponding sequences of ProTs33-R1 and ProTs33-F1 as specific primers to perform PCR amplification to obtain amplified fragments; use KOD-FX high-fidelity enzyme for PCR amplification, and the PCR amplification system is 51 µL, including 2 µL DNA (50 ng), 1 µL KOD-FX enzyme, 1.5 µL primers (forward + reverse) each (10 µmol·L-1 ), 25 µL 2×PCR Buffer for KOD FX, ddH 2 O10 μL, dNTP 10 μL; PCR amplification program was 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 68℃ extension for 30 s, 35 cycles; 68℃ extension for 10 min.

[0017] S2. The obtained amplified fragments were separated by electrophoresis at 200 V using 1.0% agarose gel, and the band pattern of each sample was observed and recorded.

[0018] Identification results: The Ts33 promoter fragments in the two parents with only one 238bp main band after electrophoresis are salt-sensitive, while the ones without bands are salt-tolerant ( Figure 1 and Figure 2 ).

[0019] Figure 1 It can be seen that the length and number of the promoter fragments of salt-tolerant and salt-sensitive rice Ts33 are quite different. The bands are clear after electrophoresis and can be directly and accurately judged by the naked eye. At the same time, the molecular identification results of the salt tolerance of the two parents are consistent with the salt tolerance phenotypic identification results, indicating that the identification procedure of the present invention is simple and has a wide range of applications. Example 2

[0020] S1. Extract genomic DNA of the above tissues from rice leaves, then use the DNA of the above tissues as templates and the corresponding sequences of ProTs33-R1 and ProTs33-F1 as specific primers to perform PCR amplification to obtain amplified fragments; use KOD-FX high-fidelity enzyme for PCR amplification, and the PCR amplification system is 51 µL, including 2 µL DNA (50 ng), 1 µL KOD-FX enzyme, 1.5 µL primers (forward + reverse) each (10 µmol·L-1 ), 25 µL 2×PCR Buffer for KOD FX, ddH 2 O10 μL, dNTP 10 μL; PCR amplification program was 98℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 68℃ extension for 30 s, 35 cycles; 68℃ extension for 10 min.

[0021] S2. The obtained amplified fragments were separated by electrophoresis at 200 V using 1.0% agarose gel, and the band pattern of each sample was observed and recorded.

[0022] Identification result: F 6 The Ts33 promoter fragment in the population has only one 238bp main band after electrophoresis, which is a salt-sensitive strain, while the one without a band is a salt-tolerant strain ( Figure 2 and Figure 3 ).

[0023] Figure 2 It can be seen that the fragment length and number of salt-tolerant and salt-sensitive rice Ts33 promoters after electrophoresis are very different, and the bands after electrophoresis are clear, which can be directly and accurately judged by the naked eye. At the same time, the molecular identification results of rice salt tolerance are consistent with the salt tolerance phenotype results, indicating that the identification accuracy of the present invention is high.

[0024] In summary, the InDel molecular marker was used to detect the F 6 The genotypes of 6 different strains in wild rice / NK57 were analyzed, and the parent wild rice and 3 of them were found to be F 6 The DNA of the first generation strains was amplified by PCR and no bands were found in electrophoresis. All of them were of the salt-tolerant genotype of Ts33, while the parent NK57 and the other three F 6 After the DNA of the first generation line was amplified by PCR, only one 238bp main band was found in the electrophoresis, which was the salt-sensitive genotype of Ts33. Therefore, the molecular marker can be used to quickly select salt-tolerant rice varieties improved by using the wild rice Ts33 gene, helping breeders overcome the shortcomings of having to use a large number of population materials for field salt tolerance identification, which is labor-intensive and time-consuming.

[0025] The present invention uses specific embodiments to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core idea. At the same time, for those skilled in the art, according to the idea of ​​the present invention, there will be changes in the scope of the specific implementation methods. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. Application of InDel molecular markers in the promoter region of rice Ts33 in screening salt-tolerant rice varieties, characterized in that: The upstream primer sequence of the specific primer pair for amplifying the InDel molecular marker is shown in ProTs33-F1, and the downstream primer sequence is shown in ProTs33-R1; upstream primer ProTs33-F1: ATGCACTCGGGTAAGCTGTT; downstream primer ProTs33-R1: AGGTTCAGAGAGATGTTGTGCA; the amplified product size is 238 bp.

2. Use of the specific primer pair of the InDel molecular marker according to claim 1 in molecular screening of salt-tolerant rice varieties.

3. A method for screening the presence or absence of a salt-tolerant gene in the promoter region of rice Ts33, characterized in that: The following steps are included: S1. Select rice leaves to extract genomic DNA from leaf tissues, then use the DNA from the tissues as templates and the corresponding sequences of ProTs33-R1 and ProTs33-F1 described in claim 1 as specific primers to perform PCR amplification to obtain amplified fragments; S2. The amplified fragments were subjected to agarose gel electrophoresis. The Ts33 promoter fragment with only one 238 bp main band after electrophoresis was a salt-sensitive type, while the one with no band was a salt-tolerant type.

4. The method according to claim 3, characterized in that The PCR amplification system is as follows: the volume is 51 µL, including 2 µL DNA, 1 µL KOD-FX enzyme, 1.5 µL forward primer and 1.5 µL reverse primer, 25 µL 2×PCR Buffer for KOD FX, 10 µL ddH2O, and 10 µL dNTP.

5. The method according to claim 3, characterized in that: The PCR amplification program was as follows: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s, annealing at 58°C for 30 s, and extension at 68°C for 30 s, for 35 cycles; and extension at 68°C for 10 min.

Images