Method for in vivo editing of KLKB1

Abstract

A first systemic administration of CRISPR / Cas9-based therapy for in vivo editing of the liver KLKB1 gene in clinical trials is described. Described herein are methods of editing a Cas9 nuclease in vivo by systemically administering a lipid nanoparticle composition comprising an mRNA encoding the Cas9 nuclease and a guide RNA targeting the liver KLKB1 gene. Assessment of biosafety indicators and clinical efficacy indicators and methods of treatment are also described herein.

Description

Background Art

[0001] Hereditary angioedema (HAE) is a rare autosomal dominant genetic disorder characterized by recurrent and unpredictable severe inflammatory attacks in various organs and tissues of the body, which can be painful, debilitating and life-threatening. Hereditary angioedema results from an excess of bradykinin in the blood that promotes vascular permeability and episodes of swelling. Most patients with HAE have a deficiency in the C1 inhibitor (also known as C1 esterase inhibitor or C1-INH) protein (either reduced levels of functional C1-INH or normal levels of variants with reduced activity). In the absence of sufficient C1-INH function, bradykinin levels rise, triggering vascular leakage and leading to episodes of swelling. Bradykinin production is controlled via the kallikrein-kinin (contact) pathway, which is endogenously inhibited by C1-INH. Bradykinin is formed when high molecular weight kininogen (HMWK) is cleaved by plasma kallikrein (pKal), which is the activated form of the protein prekallikrein. Prekallikrein, also known as KLKB1 protein, is encoded by KLKB1. Prekallikrein is produced in the liver and secreted into the plasma where it can be activated by Factor XIIa. Once KLKB1 is activated to kallikrein, pKal increases bradykinin levels. Excess bradykinin in the blood can cause fluid to leak through blood vessel walls into body tissues. Excessive accumulation of fluid in body tissues leads to episodes of swelling in individuals with HAE.

[0002] Drugs can be used to prevent attacks (prophylaxis) or to treat attacks on demand. While on-demand treatment is administered at the onset of an HAE attack, prophylactic agents require chronic intravenous (IV) or subcutaneous (SC) administration twice a week or daily oral administration to ensure sustained pathway inhibition for disease control. Despite chronic administration, breakthrough attacks still occur.

[0003] A variety of novel therapeutic strategies have improved outcomes for patients with HAE (Busse and Christiansen, 2020). These strategies are based on detailed characterization of the biochemical pathways that regulate abnormal bradykinin production and are designed to restore normal function of the contact-activated pathway. These strategies include C1 esterase inhibitor (C1-INH) replacements (recombinant or plasma-derived), B2 bradykinin receptor (B2R) inhibitors (icatibant), and kallikrein inhibitors (ecallantide, lanadelumab, berotralstat). However, a significant proportion of patients experience injection site reactions (with lanadelumab) and gastrointestinal side effects (with berotralstat) (Cohn et al., 2020).

[0004] Enhanced regulation of abnormal bradykinin production by rebalancing the function of contact-activated pathways, including sustained knockdown of prekallikrein, may translate into improved outcomes for subjects with HAE. Thus, there remains an unmet need for gene editing therapies that can produce lasting effects in gene expression (e.g., knockdown of prekallikrein) without the need for chronic administration. Summary of the invention

[0005] The present disclosure describes systemic administration of CRISPR / Cas9-based treatments for editing KLKB1 in vivo. In some embodiments, the present invention provides methods for using a single guide RNA with a Cas9 nuclease (such as a CRISPR / Cas9 system) to significantly reduce or knock down the expression of the KLKB1 gene, thereby substantially reducing or eliminating the production of prekallikrein associated with signal transduction through a contact activation pathway. Substantially reducing or eliminating the production of prekallikrein protein by altering the KLKB1 gene can reduce or eliminate plasma kallikrein levels for a long time, such as a persistent reduction in plasma kallikrein. Additional embodiments include lipid nanoparticle systems for delivering CRISPR / Cas9 RNA components liver-targeted LNPs to human subjects in vivo, such as a single guide RNA targeting the KLKB1 gene and mRNA encoding the Cas9 nuclease, and methods using lipid nanoparticle systems.

[0006] The following non-limiting embodiments are provided:

[0007] 1. In a first embodiment, disclosed herein is a method for treating hereditary angioedema (HAE) in a human subject, comprising systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. an mRNA encoding a Cas nuclease and ii. a guide RNA targeting the KLKB1 gene in the liver.

[0008] 2. In a second embodiment, disclosed herein is a method for preventing the onset of HAE in a human subject, comprising systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. an mRNA encoding a Cas nuclease and ii. a guide RNA targeting the KLKB1 gene in the liver.

[0009] 3. In a third embodiment, disclosed herein is a method for reducing the frequency of angioedema attacks in a human subject suffering from HAE, comprising systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. an mRNA encoding a Cas nuclease and ii. a guide RNA targeting the KLKB1 gene in the liver.

[0010] 4. In a fourth embodiment, disclosed herein is a method for editing the kallikrein (KLKB1) gene in vivo in a human subject with HAE, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding a Cas nuclease and ii. a guide RNA targeting the KLKB1 gene; and b. editing the KLKB1 gene at a site targeted by the guide RNA in the subject's hepatocytes; wherein administration of the composition results in a clinically significant improvement in the subject's clinical indicator level compared to the baseline level.

[0011] 5. In a fifth embodiment, disclosed herein is a method for treating hereditary angioedema (HAE) in a human subject, comprising: systemically administering to the human subject a LNP composition comprising a therapeutically effective amount of: i. an mRNA encoding a Cas nuclease and ii. a guide RNA targeting the KLKB1 gene, wherein the guide RNA comprises a targeting sequence comprising the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15), wherein administration of the composition reduces total plasma kallikrein protein levels relative to baseline total plasma kallikrein protein levels.

[0012] 6. In a sixth embodiment, disclosed herein is a method for treating hereditary angioedema (HAE) in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding a Cas nuclease and ii. a guide RNA targeting the KLKB1 gene in the liver; b. determining a first level of a clinical indicator of the subject before administration; c. determining a second level of the clinical indicator of the subject a period of time after administration; and d. evaluating the change between the first level and the second level of the clinical indicator, wherein administration of the composition results in an improvement in the change in the clinical indicator level of the subject compared to the baseline level, thereby treating HAE.

[0013] 7. In the seventh embodiment, disclosed herein is a method for treating hereditary angioedema (HAE) in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding a Cas nuclease and ii. a guide RNA targeting the KLKB1 gene in the liver; b. determining a first level of a biosafety indicator in the subject before administration; c. determining a second level of the biosafety indicator in the subject a period of time after administration; and d. evaluating the change between the first level and the second level of the biosafety indicator, wherein the administration of the composition results in an acceptable change in the subject's biosafety indicator level compared to the baseline level.

[0014] 8. In an eighth embodiment, disclosed herein is a method for treating hereditary angioedema (HAE) in a human subject, comprising: a. systemically administering to the human subject an LNP composition, wherein the LNP composition comprises a therapeutically effective amount of: i. an mRNA encoding a Cas nuclease, and ii. a guide RNA targeting the KLKB1 gene, wherein administration of the composition results in a clinically significant improvement in the subject's clinical indicator level compared to the baseline level of the clinical indicator.

[0015] 9. In a ninth embodiment, disclosed herein is a method for treating HAE in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. an mRNA encoding a Cas nuclease and ii. a guide RNA targeting the KLKB1 gene, wherein the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene are administered at a combined dose of about 25 mg to about 75 mg.

[0016] 10. In a tenth embodiment, disclosed herein is a method for treating HAE in a human subject, comprising systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. an mRNA encoding a Cas nuclease and ii. a guide RNA targeting the KLKB1 gene, wherein the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene are administered at a combined dose of about 50 mg to about 75 mg.

[0017] 11. Provided herein is the method of any one of embodiments 1 to 10, wherein the level of kallikrein protein is reduced by at least 60% after administration of the composition.

[0018] 12 Provided herein is a method according to any one of embodiments 1 to 11, further comprising a reduction in the level of kallikrein activity by at least 60% after administration of the composition.

[0019] 13. Provided herein is a method of any one of embodiments 1 to 4 or 6 to 12, wherein the guide RNA comprises a targeting sequence comprising the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15).

[0020] 14. Provided herein is a method according to any one of embodiments 1 to 13, wherein the guide RNA further comprises a scaffold sequence comprising the nucleotide sequence GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 387).

[0021] 15. Provided herein is a method according to any one of embodiments 1 to 14, wherein the guide RNA is a modified guide RNA comprising or consisting of the nucleotide sequence mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUm AmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 391), wherein m indicates a 2'-O-methyl modified nucleotide, and * indicates a phosphorothioate linkage between nucleotides.

[0022] 16. Provided herein is a method according to any one of embodiments 1 to 15, wherein when the LNP composition is systemically administered to a human subject, the subject is simultaneously treated with HAE prophylaxis.

[0023] 17. Provided herein is a method of embodiment 16, wherein HAE prevention comprises an agent selected from the following: a C1 esterase inhibitor (C1-INH) substitute (e.g., recombinant or plasma-derived), a B2 bradykinin receptor (B2R) inhibitor (e.g., icatibant), a kallikrein inhibitor (e.g., ecallant, lanariumab, berotinostat), an attenuated androgen (e.g., danazol, oxandrolone, stanozolol), or an antifibrinolytic agent. In certain embodiments, HAE prevention comprises berotinostat. In certain embodiments, HAE prevention comprises danazol. In certain embodiments, HAE prevention comprises a recombinant or plasma-derived C1 esterase inhibitor (C1-INH) substitute. In certain embodiments, HAE prevention comprises icatibant. In certain embodiments, HAE prevention comprises ecallant. In certain embodiments, HAE prevention comprises lanariumab. In certain embodiments, HAE prevention comprises oxandrolone. In certain embodiments, HAE prophylaxis comprises stanozolol.

[0024] 18. Provided herein is a method according to any one of embodiments 1 to 17, wherein the subject has an attack frequency of at least 2 confirmed HAE attacks within 90 days immediately prior to systemic administration of the LNP composition to the human subject.

[0025] 19. Provided herein is a method according to any one of embodiments 1 to 17, wherein immediately prior to systemic administration of the LNP composition to the human subject, the subject had an attack frequency of at least 3 confirmed HAE attacks per 90 days.

[0026] 20. Provided herein is a method according to any one of embodiments 1 to 17, wherein immediately prior to systemic administration of the LNP composition to the human subject, the subject had an average attack frequency of at least 6 confirmed HAE attacks per 90 days.

[0027] 21. Provided herein is a method of any one of embodiments 18 to 20, wherein at least 90 days immediately following systemic administration of the LNP composition to the human subject, optionally at least 6 months immediately following systemic administration of the LNP composition to the human subject, the subject-confirmed seizure frequency is reduced by at least 50%.

[0028] 22. Provided herein is a method according to any one of embodiments 18 to 20, wherein at least 90 days immediately following systemic administration of the LNP composition to the human subject, optionally 6 months immediately following systemic administration of the LNP composition to the human subject, the subject-confirmed seizure frequency is reduced by at least 80%.

[0029] 23. Provided herein is a method of any one of embodiments 18 to 20, wherein 90 days immediately following systemic administration of the LNP composition to the human subject, optionally 6 months immediately following systemic administration of the LNP composition to the human subject, the subject has no confirmed attack.

[0030] 24. Provided herein is a method according to any one of embodiments 18 to 20, wherein the subject-confirmed seizure frequency is reduced by at least 80% on days 29 to 112 after systemic administration of the LNP composition to the human subject, optionally on days 29 to 216 after systemic administration of the LNP composition to the human subject.

[0031] 25. Provided herein is a method according to any one of embodiments 18 to 20, wherein the subject-confirmed seizure frequency is reduced by at least 90% on days 29 to 112 after systemic administration of the LNP composition to the human subject, optionally on days 29 to 216 after systemic administration of the LNP composition to the human subject.

[0032] 26. Provided herein is a method of any one of embodiments 18 to 20, wherein on days 29 to 112 after systemic administration of the LNP composition to the human subject, optionally on days 29 to 216 after systemic administration of the LNP composition to the human subject, the subject has no confirmed attack.

[0033] 27. Provided herein is a method according to any one of embodiments 16 to 26, wherein prevention is stopped simultaneously with systemic administration of the LNP composition to the human subject.

[0034] 28. Provided herein is a method according to any one of embodiments 16 to 27, wherein prevention is discontinued on or after day 36 following systemic administration of the LNP composition to the human subject.

[0035] 29. Provided herein is a method according to any one of embodiments 1 to 28, wherein the subject has a reduced frequency of use of acute therapy for treating HAE attacks.

[0036] 30. Provided herein is the method of any one of embodiments 1 to 29, wherein the subject has a reduced frequency of hospitalization associated with HAE attacks compared to a control, e.g., a subject prior to treatment with the composition.

[0037] 31. Provided herein is the method of any one of embodiments 1 to 30, wherein the severity of the subject's confirmed HAE attack is reduced.

[0038] 32. Provided herein is a method according to any one of embodiments 1 to 31, wherein the frequency of confirmed severe HAE episodes in the subject is reduced.

[0039] 33. Provided herein is a method according to any one of embodiments 1 to 31, wherein the subject has a reduced frequency of confirmed HAE attacks with laryngeal edema.

[0040] 34. Provided herein is a method according to any one of embodiments 1 to 33, wherein the subject's quality of life improves, optionally as determined by the MOXIE Angioedema Quality of Life Assessment.

[0041] 35. Provided herein is a method according to any one of embodiments 1 to 34, wherein the subject is intolerant to long-term treatment with attenuated androgens or has an average attack frequency of at least 1 per 90 days while on treatment with attenuated androgens.

[0042] 36. Provided herein is a method of any one of embodiments 1 to 35, wherein the subject is a child, a pregnant woman, a subject with liver disease, a subject with breast cancer, a subject with prostate cancer, a subject with cardiovascular risk factors, and a subject with hepatocellular carcinoma.

[0043] 37. Provided herein is a method of embodiment 36, wherein the subject is a pregnant woman.

[0044] 38. Provided herein is a method according to any one of embodiments 1 to 37, wherein the subject is a female of childbearing potential.

[0045] 39. Provided herein is a method according to any one of embodiments 1 to 38, wherein the subject has had at least one confirmed HAE episode with laryngeal edema.

[0046] 40. Provided herein is a method of any one of embodiments 1 to 28, wherein the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadec-9,12-dienoate.

[0047] 41. Provided herein is a method according to any one of embodiments 1 to 40, wherein the LNP comprises a PEG lipid.

[0048] 42. Provided herein is a method of embodiment 41, wherein the PEG lipid comprises 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000.

[0049] 43. Provided herein is a method according to any one of embodiments 1 to 42, wherein the LNP comprises a neutral lipid.

[0050] 44. Provided herein is a method of embodiment 43, wherein the neutral lipid comprises 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0051] 45. Provided herein is a method according to any one of embodiments 1 to 44, wherein the LNP composition has an N / P ratio of about 5-7.

[0052] 46. ​​Provided herein is a method of any one of embodiments 1 to 45, wherein the guide RNA and the mRNA encoding the Cas nuclease are present in a ratio ranging from about 5:1 to about 1:5 by weight.

[0053] 47. Provided herein is a method according to any one of embodiments 1 to 46, wherein the mRNA encodes a Cas9 nuclease.

[0054] 48. Provided herein is a method according to any one of embodiments 1 to 47, wherein the mRNA encodes Streptococcus pyogenes (S. pyogenes) Cas9.

[0055] 49. Provided herein is a method according to any one of embodiments 1 to 48, wherein the mRNA encoding the Cas nuclease is codon-optimized.

[0056] 50. Provided herein is a method according to any one of embodiments 1 to 49, wherein the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 25-75 mg of total RNA.

[0057] 51. Provided herein is a method according to any one of embodiments 1 to 50, wherein the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 25 mg of total RNA.

[0058] 52. Provided herein is a method according to any one of embodiments 1 to 50, wherein the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 50 mg of total RNA.

[0059] 53. Provided herein is a method according to any one of embodiments 1 to 50, wherein the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 75 mg of total RNA.

[0060] 54. Provided herein is a method of any one of embodiments 1 to 53, wherein administration of the composition reduces total plasma kallikrein protein levels by 60%-95%, 60%-90%, 70%-95%, 70%-90% or 80%-95% compared to baseline total plasma kallikrein levels prior to administration of the composition.

[0061] 55. Provided herein is a method of any one of embodiments 1 to 54, wherein administration of the composition reduces plasma kallikrein activity by 60%-95%, 60%-90%, 70%-95%, 70%-90% or 80%-95% compared to the baseline plasma kallikrein activity level before administration of the composition.

[0062] 56. Provided herein is a method according to any one of embodiments 54 to 55, wherein the plasma kallikrein level is determined at least 28 days after administration of the LNP composition.

[0063] 57. Provided herein is a method according to any one of embodiments 54 to 56, wherein the plasma kallikrein level is determined 56 days after administration of the LNP composition.

[0064] 58. Provided herein is a method of any one of embodiments 1 to 57, wherein administration of the composition results in an acceptable change in the subject's biosafety indicator level compared to a biosafety indicator baseline level.

[0065] 59. Provided herein is a method according to embodiment 58, wherein the biosafety indicator is activated partial thromboplastin time (aPTT).

[0066] 60. Provided herein is a method according to embodiment 58 or 59, wherein the biosafety indicator is alanine aminotransferase (ALT).

[0067] 61. Provided herein is a method according to any one of embodiments 58 to 60, wherein the biosafety indicator is aspartate aminotransferase (AST).

[0068] 62. Provided herein is a method according to any one of embodiments 58 to 61, wherein the change in the biosafety indicator subsides within 14 days.

[0069] 63. Provided herein is a method according to any one of embodiments 58 to 62, wherein the biosafety index is level 3 or lower.

[0070] 64. Provided herein is a method of any one of embodiments 1 to 63, wherein the composition is administered with a second treatment to treat HAE.

[0071] 65. Provided herein is a method of embodiment 64, wherein the second treatment is a HAE prophylactic treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0073] Figure 1 : Schematic diagram showing the pathways inhibited by C1-INH. C1-INH deficiency leads to upregulated bradykinin release and accumulation, endothelial cell activation, and angioedema.

[0074] Figure 2 : NTLA-2002 validated off-target and on-target editing in primary human hepatocytes (PHH).

[0075] Figure 3 : Dose response of NTLA-2002, MAPK1-targeted LNP-G018729, and nontargeted LNP-G000739 MAPK1 intronic locus editing in primary human hepatocytes.

[0076] Figure 4 : Percentage of KLKB1 editing, KLKB1 mRNA levels, and serum kallikrein levels as a percentage of TSS vehicle control-treated mice.

[0077] Figure 5 : Percentage of KLKB1 liver editing and serum prekallikrein levels as a function of NTLA-2002 dose in humanized mice.

[0078] Figure 6 : Vascular permeability of humanized mice treated with LNP formulations containing gRNA (G013901) and controls was assessed using the Evans blue vascular permeability assay.

[0079] Figure 7 : Plasma kallikrein activity levels in non-human primates treated with LNP formulations containing gRNA (G013901) compared to controls.

[0080] Figure 8: Plasma kallikrein protein levels in non-human primates treated with LNP formulations containing gRNA (G013901) compared to controls.

[0081] Fig. 9 : Plasma kallikrein protein levels in non-human primates treated with LNP formulations containing gRNA (G012267) compared to controls.

[0082] Fig.10 : Plasma kallikrein activity levels in non-human primates treated with LNP formulations containing gRNA (G012267) compared to controls.

[0083] Fig.11 : Diagram describing the clinical trial design of a dose escalation schedule.

[0084] Fig.12 : Mean percent change in plasma kallikrein levels in subjects treated with a single 25 mg and 75 mg dose of NTLA-2002.

[0085] Fig.13 : Following treatment with a single 25 mg and 75 mg dose of NTLA-2002, subjects experienced a mean absolute reduction in kallikrein.

[0086] Fig.14 Results: Mean percent reduction in kallikrein in subjects in Cohorts 1 and 2 following treatment with a single 25 mg or 75 mg dose of NTLA-2002.

[0087] Fig.15 : Lane graphs showing the frequency and severity of attacks in individual patients following treatment with a single 25 mg (patients 1-3) or 75 mg (patients 4-6) dose of NTLA-2002. The use of prophylaxis is indicated. Danazol was discontinued from patient 2 on day 151. Berostat was discontinued from patient 3 on day 112.

[0088] Fig.16A and Fig. 16B : Results of percent change from baseline in HAE attack rate in (A) Cohort 1 (n=3) and (B) Cohort 2 (n=3) subjects following treatment with a single 25 mg or 75 mg dose of NTLA-2002.

[0089] Fig.17 : Mean absolute kallikrein reductions in subjects following treatment with a single 25 mg, 50 mg, and 75 mg dose of NTLA-2002.

[0090] Fig.18Results: Mean percent reduction in kallikrein in subjects from Cohorts 1, 2, and 3 following treatment with a single 25 mg, 50 mg, or 75 mg dose of NTLA-2002.

[0091] Fig.19 : Lane graph illustrating the frequency and severity of seizures for individual patients following treatment with a single 25 mg (patients 1-3), 50 mg (patients 7-10), or 75 mg (patients 4-6) dose of NTLA-2002. Arrows indicate cessation of prophylaxis.

[0092] Fig. 20A and Fig. 20B : Updated results for the percent change from baseline in HAE attack rate in (A) Cohort 1 (n=3) and (B) Cohort 2 (n=3) subjects following treatment with a single 25 mg or 75 mg dose of NTLA-2002.

[0093] Fig.21 Methods: Following treatment with a single 25 mg or 50 mg dose of NTLA-2002, investigators confirmed the monthly exacerbation rates during the baseline and 16-week initial observation period, as well as the mean % changes from baseline at Weeks 1-16 and Weeks 5-16 for each cohort.

[0094] Fig. 22 : Updated results on mean absolute kallikrein reductions in subjects treated with a single 25 mg, 50 mg, and 75 mg dose of NTLA-2002.

[0095] Fig.23 : Updated results of the mean percent reduction in kallikrein in subjects in Cohorts 1, 2, and 3 following treatment with a single 25 mg, 50 mg, or 75 mg dose of NTLA-2002.

[0096] Fig.24 : Recent lane graphs illustrating the frequency and severity of seizures in individual patients following treatment with a single 25 mg (patients 1-3), 50 mg (patients 7-10), or 75 mg (patients 4-6) dose of NTLA-2002. Arrows indicate cessation of prophylaxis.

[0097] Fig.25 : Updated results for the percent change from baseline in HAE attack rate in Cohort 1 (n=3) subjects following treatment with a single 25 mg dose of NTLA-2002.

[0098] Fig.26 : Updated results for the percent change from baseline in HAE attack rate in Cohort 1 (n=4) subjects following treatment with a single 50 mg dose of NTLA-2002.

[0099] Fig. 27 : Updated results for the percent change from baseline in HAE attack rate in Cohort 1 (n=3) subjects following treatment with a single 75 mg dose of NTLA-2002.

[0100] Fig.28 : Mean absolute kallikrein activity values ​​for patients in cohorts 1, 2, and 3 during the study period to date.

[0101] Fig.29 : Mean percent change from baseline in kallikrein activity values ​​for patients in Cohorts 1, 2, and 3 during the study period to date.

[0102] Fig.30 : Spaghetti plot of percent change from baseline in kallikrein protein levels in cohort 1 (25 mg) patients.

[0103] Fig.31 : Spaghetti plot of percent change from baseline in kallikrein protein levels in cohort 3 (50 mg) patients.

[0104] Fig.32 : Spaghetti plot of percent change from baseline in kallikrein protein levels in cohort 2 (75 mg) patients.

[0105] Fig.33 : Spaghetti plot of percent change from baseline in kallikrein activity levels in patients in cohort 1 (25 mg).

[0106] Fig.34 : Spaghetti plot of percent change from baseline in kallikrein activity levels in cohort 3 (50 mg) patients.

[0107] Fig.35 : Spaghetti plot of percent change from baseline in kallikrein activity levels in cohort 2 (75 mg) patients.

[0108] Fig.36 : Correlation plot of plasma kallikrein protein concentration (percent change from baseline) versus kallikrein activity (percent change from baseline) in HAE patients following administration of a single dose (25, 50, or 75 mg) of NTLA-2002.

[0109] Fig.37 : Geometric mean plasma concentration-time profiles of LPO1 following single IV infusion of NTLA-2002 at the indicated doses. Available LPO1 (lipid A) pharmacokinetic data are depicted up to 76 hours from the start of NTLA-2002 infusion.

[0110] Fig.38: Angioedema episodes during the screening period, initial observation period, and post-initial observation period.

[0111] Fig.39 : Changes in the monthly incidence of angioedema over time. DETAILED DESCRIPTION

[0112] Reference will now be made in detail to certain embodiments of the present invention, examples of which are shown in the accompanying drawings. Although the present invention is described in conjunction with the embodiments shown, it should be understood that it is not intended to limit the present invention to those embodiments. On the contrary, the present invention is intended to cover all replacements, modifications and equivalents, which may be included in the present invention limited by the attached embodiments.

[0113] Before describing the present teachings in detail, it should be understood that the present disclosure is not limited to specific compositions or process steps, as they may vary. It should be noted that, unless the context clearly indicates otherwise, as used in this specification and the attached embodiments, the singular forms "a / an" and "the" include plural referents. Thus, for example, reference to "a conjugate" includes a plurality of conjugates, reference to "a cell" includes a plurality of cells or cell populations, etc. As used herein, the term "includes" and its grammatical variants are intended to be non-restrictive, such that the recitation of an item in a list does not exclude other similar items that may be substituted or added to the listed items.

[0114] Numerical ranges include the values ​​defining the ranges. Taking into account significant figures and errors associated with measurement, measured values ​​and measurable values ​​should be understood as approximate values. In addition, the use of "comprise / comprises / comprising", "contain / contains / containing", "include / includes / including" is not intended to be limiting. It should be understood that the foregoing general description and detailed description are merely exemplary and illustrative, and not limiting of the teachings.

[0115] Unless otherwise specified in the specification, embodiments described in the specification as "comprising" various components are also contemplated as "consisting of" or "consisting essentially of" the recited components; embodiments described in the specification as "consisting of" various components are also contemplated as "comprising" or "consisting essentially of" the recited components; and embodiments described in the specification as "consisting essentially of" various components are also contemplated as "consisting of" or "comprising" the recited components (this interchangeability does not apply to the use of these terms in the claims).

[0116] Unless the context clearly dictates otherwise, the term "or" is used in an inclusive sense, ie, equivalent to "and / or".

[0117] When used before a list or range, the term "about" modifies each member of the list or range. The term "about" or "approximately" refers to the acceptable error of a particular value determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. For example, in some embodiments, about includes within 2 standard deviations of the mean. In some embodiments of the invention, "about" includes ± 10% of the value, or optionally ± 5%. It should be understood that some values ​​are variable in nature, for example, the number of days in a month can vary, and for detection purposes, there are acceptable tolerances in the art for detection at less frequent intervals.

[0118] The term "at least" before a number or a series of numbers is understood to include the number adjacent to the term "at least", and all subsequent numbers or integers that can be included logically, as clearly seen from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a nucleic acid molecule of 20 nucleotides" means that 18, 19 or 20 nucleotides have the indicated characteristics. When at least appears before a series of numbers or ranges, it should be understood that "at least" can modify each number in the series or range.

[0119] As used herein, "not greater than" or "less than" is understood to be a value adjacent to the phrase and a logical low value or integer, which is logically zero from the context. For example, a duplex region of "not greater than 2 nucleotide base pairs" has 2, 1, or 0 nucleotide base pairs. When "not greater than" or "less than" appears before a series of values ​​or ranges, it should be understood to modify each value in the series or range.

[0120] As used herein, ranges include upper and lower limits.

[0121] As used herein, it is understood that when the maximum amount of a value is represented by 100% (e.g., 100% inhibition or 100% encapsulation), the value is limited by the detection method. For example, 100% inhibition is understood to be inhibition to a level below the detection level of the assay, and 100% encapsulation is understood to be unable to detect the material for encapsulation outside the vesicle.

[0122] Unless otherwise indicated, the following terms and phrases used herein are intended to have the following meanings.

[0123] "mRNA" is used herein to refer to a polynucleotide comprising RNA and modified RNA, which includes an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for ribosome and aminoacylated tRNA translation). mRNA may include a phosphate-sugar backbone comprising a ribose residue or an analog thereof, for example, a 2'-methoxyribose residue. In some embodiments, the sugar on the nucleic acid phosphate sugar backbone consists essentially of a ribose residue, a 2'-methoxyribose residue, or a combination thereof. In general, mRNA does not contain a large amount of thymidine residues (e.g., 0 residues or less than 30, 20, 10, 5, 4, 3 or 2 thymidine residues; or less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2% or 0.1% thymidine content). mRNA may contain modified uridines at some or all of its uridine positions.

[0124] "Polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds comprising nucleosides or nucleoside analogs having nitrogenous heterocyclic bases or base analogs linked together along the backbone, including polymers of conventional RNA, DNA, mixed RNA-DNA and analogs thereof. In some embodiments, the polynucleotide is chemically synthesized or in vitro transcribed. The polynucleotide may be mRNA, such as in vitro transcribed RNA containing modified uridine. The "backbone" of nucleic acid may be composed of a variety of linkages, including one or more sugar-phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA; PCT No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages or combinations thereof. The sugar moiety of the nucleic acid may be ribose, deoxyribose or a similar compound having a substitution, for example, a 2'methoxy or 2'halide substitution. RNA may include DNA or one or more deoxynucleosides or deoxynucleoside analogs.

[0125] "Guide RNA", "gRNA" and "guide" are used interchangeably herein to refer to RNA such as crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA), which targets the Cas nuclease to a genomic location. Homologous guide RNA structures of Cas nucleases (such as Cas9 nucleases) are known in the art. The crRNA and trRNA sequences of the guide RNA can be associated as a single RNA molecule (single guide RNA, sgRNA) or as, for example, separate RNA molecules (double guide RNA, dgRNA). TrRNA can be a naturally occurring sequence, or a trRNA sequence that has a modification or variation compared to a naturally occurring sequence. Guide RNA may include modified RNA as described herein.

[0126] As used herein, "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and has the function of directing the guide RNA to the target sequence for binding or modification (e.g., cleavage) by a Cas nuclease. "Guide sequence" may also be referred to as a "targeting sequence" or "spacer sequence". The guide sequence may be 20 base pairs in length, for example, in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs, for example, the guide target sequence is 18, 19, or 20 contiguous nucleotides in length. In some embodiments, the guide sequence and the target region may be 100% complementary or identical. In some embodiments, the guide sequence and the target region may contain 1 or 2 mismatches, wherein the guide sequence comprises 20 nucleotides of the target region.

[0127] The target sequence of the Cas protein includes the positive and negative strands of the genomic DNA (i.e., the reverse complementary sequence of the given sequence and the sequence), because the nucleic acid substrate of the Cas protein is a double-stranded nucleic acid. Therefore, when the guide sequence is referred to as "complementary to the target sequence", it is understood that the guide sequence can guide the guide RNA to bind to the reverse complementary sequence of the target sequence. Therefore, in some embodiments, when the guide sequence binds to the reverse complementary sequence of the target sequence, the guide sequence is identical to some nucleotides of the target sequence (e.g., a target sequence excluding PAM), but T in the guide sequence is replaced by U.

[0128] As used herein, "Cas nuclease" means a polypeptide or polypeptide complex having RNA and DNA binding activity, such as Cas9 nuclease, wherein the DNA binding activity is sequence-specific and depends on the sequence of the guide RNA. Exemplary Cas nucleases (and "Cas proteins") include Cas lyases, that is, Cas nucleases are dsDNA lyases that cleave two strands of DNA. As used herein, "Cas9 nuclease" is, for example, a single-chain polypeptide with dsDNA lyase activity. "Cas9" encompasses Spy Cas9, Cas9 variants listed herein, and equivalents thereof. See, for example, Makarova et al., Nat Rev Microbiol, 13 (11): 722-36 (2015); Shmakov et al., Molecular Cell, 60: 385-397 (2015). Spy Cas9dsDNA lyases are particularly included herein. As used herein, the delivery of Cas nucleases (e.g., Cas nucleases, Cas9 nucleases, or Streptococcus pyogenes Cas9 nucleases) includes the delivery of polypeptides or mRNAs. For example, the LNP compositions described herein may comprise mRNA encoding a Cas nuclease.

[0129] As used herein, "modified uridine" refers to a nucleoside other than thymidine, and the nucleic acid has the same hydrogen bond acceptor as uridine, and has one or more structural differences with uridine. In some embodiments, the modified uridine is a substituted uridine, i.e., a uridine in which one or more non-proton substituents (e.g., alkoxy, such as methoxy) replace protons. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is a substituted pseudouridine, i.e., a pseudouridine in which one or more non-proton substituents (e.g., alkyl, such as methyl) replace protons, such as N1-methyl pseudouridine. In some embodiments, the modified uridine is any one of a substituted uridine, a pseudouridine, or a substituted pseudouridine.

[0130] As used herein, "uridine position" refers to a position in a polynucleotide that is occupied by a uridine or a modified uridine. Thus, for example, a polynucleotide in which "100% of the uridine positions are modified uridines" contains a modified uridine at each position that would be a uridine in a conventional RNA of the same sequence (where all bases are standard A, U, C, or G bases). Unless otherwise indicated, a U in a polynucleotide sequence in the present disclosure or in an accompanying sequence table or sequence listing may be a uridine or a modified uridine.

[0131] As used herein, "treatment" is the administration or application of any therapeutic agent for a disease or condition of a subject, and includes inhibiting the disease, alleviating one or more symptoms of the disease, curing the disease, reducing the frequency of HAE attacks, reducing the severity of HAE attacks, improving one or more clinical indicators described herein (e.g., a suitable quality of life (QoL) questionnaire, such as the MOXIE angioedema quality of life (AE-QoL) questionnaire), or preventing the recurrence of one or more symptoms of the disease. In some embodiments, the treatment of HAE includes reducing the frequency of HAE attacks. In some embodiments, the treatment of HAE may include a substantial reduction or knockdown of the expression of the KLKB1 gene, for example, a persistent reduction of at least 60% in total plasma kallikrein protein levels, thereby substantially reducing or eliminating the production of kallikrein proteins associated with HAE. In some embodiments, the treatment of HAE may include a substantial reduction or knockdown of the expression of the KLKB1 gene, for example, a persistent reduction of at least 80% in total kallikrein protein levels, thereby substantially reducing or eliminating the production of kallikrein proteins associated with HAE.

[0132] As used herein, "simultaneous treatment" and the like should be understood as treatment with two or more agents, which may have a pharmacodynamic effect based on pharmacokinetic properties (such as half-life). As used herein, "simultaneous treatment" when a LNP composition is systemically administered to a human subject during treatment with an HAE preventive agent should be understood as within five half-lives from the time of administration of the HAE preventive agent. The half-life of such agents is known in the art, and exemplary values ​​for various agents are provided herein. For particularly long-acting agents, a washout period can be defined, during which the long-acting agent may have a pharmacokinetic effect. During the washout period for treatment with an HAE preventive agent, systemic administration of an LNP composition to a human subject should be understood as simultaneous treatment.

[0133] As used herein, "knockdown" refers to the reduction of expression of a specific gene product (e.g., KLKB1 or kallikrein) in a sample, such as a cell, a cell colony, a tissue or an organ, or a fluid, by gene editing; wherein the sample is optionally a human sample. In some embodiments, gene editing can be assessed by sequence, such as next generation sequencing (NGS). Compared with a suitable control (e.g., before the baseline or treatment of the subject), expression can be reduced by at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or reduced to a detection level below the assay. Methods for measuring mRNA knockdown are known and include sequencing of mRNA isolated from a tissue or cell colony of interest, for example, in a liver hepatocyte. The knockdown of a protein can be measured by detecting the amount of protein in serum, human serum, and fractional serum from a tissue, a cell colony, or a fluid of interest, such as a non-human primate. Flow cytometry analysis is a known method for measuring protein expression knockdown. For secreted proteins, knock-down can be assessed in fluids (such as tissue culture medium or blood, or serum or plasma derived therefrom). Plasma protein levels can be measured by quantitative assays (e.g., ELISA), and can be used to detect knock-down. In some embodiments, "knock-down" may refer to some losses of the expression of a specific gene product, such as a reduction in the amount of a full-length wild-type mRNA that is transcribed or translated into a full-length protein, or a reduction in the amount of a protein expressed by a cell population. In certain embodiments, the sample may be processed, for example, to activate the product in the sample before performing an enzymatic assay. In some embodiments, "knock-down" may refer to some losses of the expression of a specific gene product (e.g., kallikrein).

[0134] As used herein, "persistent" in the context of knocking down (e.g., knocking down persistently) or "persistently" reducing gene (e.g., KLKB1 gene) expression of kallikrein refers to a persistent effect, such as a persistent knockdown or a persistent reduction in gene expression. In some embodiments, the persistent knockdown of plasma kallikrein refers to a maintained reduction (relative to the level of baseline), as measured at a time point after the dose, reaching a maximum reduction at ≥ about the 28th day (e.g., about the 56th day) after administering the LNP composition, for example, at least 6 months, 9 months, 1 year, 2 years, 3 years, 4 years, 5 years or longer. In some embodiments, the level of maintenance can vary. In some embodiments, the reduction is related to the expected clinical efficacy of the treated condition. It is known in the art to achieve a reduced level of the expected clinical effect for a given condition (e.g., HAE). For example, at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the reduction is related to the expected clinical efficacy of a particular condition. For example, a reduction of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more is associated with a desired clinical efficacy in HAE.

[0135] As used herein, "effective amount" or "therapeutically effective amount" refers to the amount of mRNA encoding Cas nuclease and guide RNA that can produce a therapeutic effect, including reducing the frequency of HAE attacks, reducing plasma kallikrein activity, reducing total plasma kallikrein levels, for example, reducing at least 60% in a subject relative to baseline total plasma kallikrein levels or reducing total plasma kallikrein to less than about 20 μg / mL after administration of mRNA encoding Cas nuclease and guide RNA. For example, the LNP composition may include an effective amount of mRNA encoding Cas nuclease and guide RNA, such as a guide RNA (combined or total RNA) targeting KLKB1. In some embodiments, the LNP composition delivers mRNA encoding Cas9 nuclease and a single guide RNA, and the composition may include an "effective amount" of RNA measured in total RNA. In some embodiments, an effective amount of mRNA encoding Cas9 nuclease and a single guide RNA reduces the serum kallikrein level of the subject relative to the baseline plasma kallikrein level (e.g., total plasma kallikrein level) by at least 60%, or 60%-95%, 60%-90%, 70%-95%, 70%-90%, or 80%-95%. In some embodiments, after administration of mRNA encoding Cas9 nuclease and a single guide RNA targeting KLKB1, an effective amount of mRNA encoding Cas9 nuclease and a single guide RNA reduces total plasma kallikrein to less than about 20 μg / mL, less than about 15 μg / mL, or less than about 10 μg / mL.

[0136] As used herein, "biological safety indicators" refer to clinical indicators for monitoring safety events associated with the administration of LNP compositions described herein to human subjects. Biological safety indicators can allow the determination of safety events, including adverse events (NCI-CTCAE 3 or higher), serious adverse events, adverse events of particular interest, or adverse events occurring during treatment (CTCAE 3 or higher), as described herein. Guidelines for defining the severity of safety events (e.g., adverse events) are known in the art (e.g., Common Terminology Criteria for Adverse Events (CTCAE), including the National Cancer Institute (National Cancer Institute) (NCI)-CTCAE, Version 5.0). In some embodiments, the biological safety indicator is a liver enzyme level, such as ALT, AST. In some embodiments, the biological safety indicator is aPTT. In some embodiments, the adverse event is an infusion-related reaction (IRR), such as flushing, dyspnea, chest pain, syncope, rash, increased heart rate, and / or facial edema. In some embodiments, the level of the biological safety indicator is measured before administering the LNP composition. In some embodiments, the level of the biosafety indicator is measured after the LNP composition is administered. In some embodiments, the level of the biosafety indicator is measured before and after the LNP composition is administered, thereby allowing the level of the biosafety indicator to be compared before and after treatment with the LNP composition to determine changes, such as acceptable changes. As used herein, "acceptable" changes refer to changes in the level of biosafety indicators, wherein the resulting changes do not constitute safety events (e.g., adverse events (NCI-CTCAE 3 or higher), serious adverse events, adverse events of particular interest, adverse events that occur during treatment (CTCAE 3 or higher)) or events that originally require stopping the study drug as determined by a clinician. In some embodiments, the level of the biosafety indicator measured before the LNP composition is administered can serve as a baseline for comparison with one or more biosafety indicator levels measured after the LNP composition is administered (e.g., measurements taken at specific intervals after administration can be compared with baseline levels). In some embodiments, the baseline is the last available measurement taken before the LNP composition is administered. In some embodiments, if the value of the biosafety indicator alone can determine a safety event, the biosafety indicator will not be compared with the baseline.

[0137] As used herein, "safe and well tolerated" refers to the absence of safety events as described herein, such as the absence of: adverse events (NCI-CTCAE grade 3 or higher), serious adverse events, adverse events that occur during treatment (CTCAE grade 3 or higher), or events that would otherwise require discontinuation of the study drug as determined by a clinician. In some embodiments, "safe and well tolerated" includes patients with NCI-CTCAE grade 3 or higher adverse events that are unrelated to the administration of a composition described herein (e.g., an LNP composition comprising an effective amount of mRNA encoding a Cas nuclease and a guide RNA targeting KLKB1), or resolution after an acceptable period of time for the event (e.g., with or without intervention).

[0138] In some embodiments, adverse events of particular interest include, for example, infusion-related reactions (IRRs) (e.g., requiring treatment or discontinuation of infusion, or Grade 3 or higher); occurrence of cytokine release syndrome; abnormal coagulation results defined by the occurrence of clinically relevant abnormal bleeding or thrombotic or hemorrhagic or abnormal blood test results of CTCAE ≥ 2; acute liver injury demonstrated by CTCAE ≥ 2 ALT increase, CTCAE ≥ 2 AST increase, CTCAE ≥ 2 total bilirubin increase, CTCAE ≥ 2.

[0139] In some embodiments, adverse events are any adverse medical events that occur in subjects receiving study drugs or receiving study procedures, and they are not necessarily causally related to treatment. In some embodiments, adverse events are unexpected signs (including abnormal laboratory findings), symptoms or diseases temporarily related to treatment, whether or not related to drug (research) products. In some embodiments, adverse events induce clinical signs or symptoms. In some embodiments, adverse events require active intervention. In some embodiments, adverse events require interruption or cessation of treatment. In some embodiments, adverse events are considered to be clinically significant abnormalities by researchers. The grading criteria for adverse events are known in the art, such as, for example, Common Terminology Criteria for Adverse Events (CTCAE), including National Cancer Institute (NCI)-CTCAE.

[0140] Biological safety indicators include known laboratory assessments, typically involving, for example, coagulation, hematology, clinical chemistry, urinalysis, and other bioanalytical assessments (e.g., cytokines, complement). Specific biological safety indicators include, but are not limited to: liver enzyme levels (e.g., alanine aminotransferase (ALT) or aspartate aminotransferase (AST) elevated > 5×ULN for more than 4 weeks after treatment, ALT or AST > 3×ULN and total bilirubin > 2×ULN after treatment (Hyman's law)), activated partial thromboplastin time (aPTT) levels (e.g., aPTT elevated > 5×ULN for more than 4 weeks after treatment), prothrombin time (PT) levels, thrombin generation time (TGT) levels (e.g., peak height, lag time, or endogenous thrombin generation potential) Potential), fibrinogen levels, prothrombin international normalized (INR) ratio, d-dimer levels, laboratory parameters consistent with disseminated intravascular coagulation, changes in hematology values ​​(e.g., abnormal blood test results of CTCAE>2 after administration of treatment), changes in chemistry values, changes in coagulation, changes in urinalysis, glutamate dehydrogenase levels, C-reactive protein levels, complement (C3a, C5a, Bb) levels, cytokine (GM-CSF, INF-γ, IL-1β, IL-4, IL-5, IL-6, IL-8, IL-10, IL-13, IL-23, TNF-α, IL-17, MCP-1) levels, acute liver injury (e.g., CTCAE>2 elevations in ALT, AST, total bilirubin or clinically relevant liver injury symptoms / signs after administration of treatment), and changes in 12-lead electrocardiogram. Additional biosafety indicators, including those associated with the administration of LNP compositions, are known in the art. Similarly, acceptable levels or changes in biosafety indicators are known in the art and can be assessed by routine methods (eg, by a clinician or laboratory).

[0141] As used herein, "clinical efficacy index" refers to an index for evaluating the improvement of a disease in a human subject treated with a LNP composition as described herein. In some embodiments, the level of the clinical efficacy index is measured after the LNP composition is administered. In some embodiments, the level of the clinical efficacy index is measured before and after the LNP composition is administered, thereby allowing comparison of the level of the clinical efficacy index before and after treatment with the LNP composition. In some embodiments, the efficacy index is determined over time, such as a monthly attack frequency, such as the average attack frequency per month within a given time period (e.g., a three-month time period) (e.g., reducing the number of HAE attacks, breakthrough attacks, the number or proportion of patients with no attacks within a given time period, the frequency of hospitalization associated with HAE attacks, or the frequency of use of acute therapy associated with HAE attacks). In some embodiments, the clinical index level measured before the administration of the LNP composition can serve as a baseline or control for comparison with one or more clinical index levels measured after the administration of the LNP composition, the measurement after the administration of the LNP composition is performed immediately after the LNP composition is administered, or after an interval allowing the LNP composition to begin to take effect, such as starting measurement on the 29th day after the LNP composition is administered. In some embodiments, the baseline is the last available measurement taken prior to administration of the LNP composition.

[0142] For conditions characterized by HAE attacks, clinical efficacy indicators include, but are not limited to: a decrease in total plasma kallikrein protein levels (e.g., a 60% decrease in total plasma kallikrein protein after administration of treatment, for example, as measured by ELISA), a decrease in total plasma kallikrein activity (e.g., a decrease in plasma kallikrein activity of at least 60%). Additional clinical efficacy indicators include the frequency of HAE attacks (e.g., a reduction in the number of HAE attacks, breakthrough attacks, the number or proportion of patients with no attacks in a given time period, the frequency of hospitalizations associated with HAE attacks, or the frequency of use of acute therapies associated with HAE attacks) and the severity of HAE attacks. Provided herein are methods for confirming and grading HAE attacks. Criteria for "confirmed" HAE attacks are provided as follows. In some embodiments, a "confirmed" HAE attack is determined by a physician.

[0143] Similarly, "clinically significant improvement" of clinical efficacy indicators, i.e., levels or changes in clinical efficacy indicators indicating improvement in the disease (including HAE attack frequency, e.g., confirmed HAE attack frequency and HAE attack severity) are known in the art and can be evaluated by conventional methods, such as by a healthcare professional or laboratory. For example, plasma kallikrein protein levels (e.g., total plasma kallikrein protein levels) are clinical efficacy indicators for HAE. "Clinically significant improvement" in this clinical efficacy indicator for the treatment of HAE includes using the LNP composition described herein, compared to a baseline (e.g., before treatment), total plasma kallikrein protein levels (e.g., after treatment) (e.g., immediately after treatment or starting at a predetermined period after treatment) are reduced by at least 60%, 70%, 80%, 85%, 90% or 95%. For example, a reduction in HAE attack frequency (e.g., confirmed monthly attack frequency, such as the average confirmed attack frequency per month during 3 or 6 months) is also a clinical efficacy indicator for HAE. "Clinically significant improvement" in this clinical efficacy indicator for treating HAE includes, for example, a reduction in attack frequency of at least 40%, 50%, 60%, 70%, 80%, 85%, 90% or 95% following treatment with the LNP compositions described herein compared to baseline (e.g., before treatment).

[0144] As used herein, the term "lipid nanoparticle" (LNP) refers to a particle comprising multiple (i.e., more than one) lipid molecules that are physically associated with each other by intermolecular forces and encapsulate RNA. See, e.g., WO2017173054 and WO2019067992, the contents of which are incorporated herein in their entirety.

[0145] As used herein, the phrase "pharmaceutically acceptable" means useful for preparing a pharmaceutical composition that is generally non-toxic and not biologically undesirable and that is not otherwise unacceptable for pharmaceutical use. In certain embodiments, a pharmaceutically acceptable composition is sterile. In certain embodiments, a pharmaceutically acceptable composition is pyrogen-free.

[0146] As used herein, systemic administration can be by intravenous infusion. "Infusion" refers to the active administration of one or more agents, and the infusion time is, for example, about 2 hours. In some embodiments, the infusion time is completed within 6 hours after opening the vial containing the LNP composition. In some embodiments, LNP (e.g., comprising mRNA encoding the Cas9 nuclease described herein and sgRNA described herein) is administered to a human subject systemically.

[0147] As used herein, "infusion prophylaxis" refers to a regimen administered to a subject prior to treatment (e.g., including administration of LNPs) that includes, for example, 8 mg of dexamethasone or equivalent orally 8 to 24 hours prior to the LNP composition; and intravenous steroids (e.g., dexamethasone 10 mg); intravenous H1 blockers (e.g., diphenhydramine 50 mg) or oral H1 blockers (e.g., cetirizine 10 mg); and intravenous or oral H2 blockers (e.g., famotidine 20 mg) administered approximately 1-2 hours prior to administration of the LNP composition.

[0148] I. Compositions for Targeted Genes

[0149] Disclosed herein are methods for editing a gene of interest (e.g., KLKB1) in a human subject's liver, modifying a gene in a subject's hepatocytes, or treating a disease, and related compositions, including compositions for such methods. In general, disclosed herein are LNP compositions comprising mRNA encoding a Cas nuclease (e.g., Cas9) and a guide RNA targeting a gene (e.g., a guide RNA targeting a KLKB1 gene). Subjects treated using such methods and compositions may have wild-type or non-wild-type gene sequences of interest, such as, for example, subjects with HAE.

[0150] In some embodiments, the methods disclosed herein comprise systemic administration of a lipid nanoparticle system to deliver a guide RNA and an mRNA encoding a Cas nuclease in the liver in vivo.

[0151] 1. Guide RNA (gRNA)

[0152] A single guide RNA used in the disclosed methods and compositions includes a guide sequence targeting a gene of interest (e.g., the KLKB1 gene), the guide sequence comprising at least 18 contiguous nucleotides, preferably 20 nucleotides of the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15).

[0153] In the case of an sgRNA, the above guide sequence may further comprise additional nucleotides to form an sgRNA, for example, having the following exemplary nucleotide sequence 3' to the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUU AAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 387) in a 5' to 3' orientation, providing an sgRNA having the nucleotide sequence GGAUUGCGUAUGGGACACAAGUUUUUAGAGCUAGAAAUAGCAA GUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGC ACCGAGUCGGUGCUUUU (SEQ ID NO: 388). In an alternative embodiment, the sgRNA may comprise the following exemplary nucleotide sequence 3' to the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGG CUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGC (SEQ ID NO: 389). In an alternative embodiment, the sgRNA may comprise the following exemplary nucleotide sequence 3' to the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAG UUAAAAUAAGGCUAGUCCGUUAUCAAAAUGGCACCGAGUCG GUGC (SEQ ID NO: 390).

[0154] In some embodiments, the sgRNA is modified. In some embodiments, the sgRNA comprises a 5' end modification, a 3' end modification, or both a 5' and a 3' end modification. In some embodiments, the sgRNA comprises the modification pattern shown in SEQ ID NO: 391 below, wherein the modified sgRNA comprises the following sequence: mG*mG*mA*UUGCGUAUGGGAC ACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 391), wherein A, C, G, and U indicate RNA nucleosides (2'-OH) adenine, cytosine, guanine, and uridine, respectively; mA, mC, mG, and mU indicate 2'-O-methyl modified adenine, cytosine, guanine, and uridine, respectively; and * indicates a phosphorothioate linkage.

[0155] In some embodiments, the gRNA comprises a guide sequence that guides a Cas9 nuclease (e.g., a SpyCas9 nuclease) to a target DNA sequence. The sgRNA comprises 18, 19, or 20 contiguous nucleotides of the targeting sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15).

[0156] A single guide RNA provided herein is used to identify a target sequence in a KLKB1 genomic locus by hybridizing a targeting sequence with a target sequence. For example, a gene target sequence of interest is recognized and cleaved by a Cas9 lyase comprising a guide RNA provided. Therefore, a Cas9 lyase (such as a Spy Cas9 lyase) is guided to a target sequence in a KLKB1 genomic locus by a guide RNA, wherein the guide sequence of the guide RNA hybridizes with the target sequence, and a Cas9 lyase (such as a Spy Cas9 lyase) is cleaved within the target sequence in the genomic locus.

[0157] 2. Modification of gRNA

[0158] In some embodiments, the gRNA is chemically modified. A gRNA comprising one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or a "chemically modified" gRNA to describe the presence of one or more non-natural or naturally occurring components or configurations that are used to replace or supplement canonical A, G, C, and U residues. In some embodiments, a modified gRNA is synthesized with non-canonical nucleosides or nucleotides, referred to herein as "modified".

[0159] The modified guide RNA may comprise nucleosides or nucleoside analogs having nitrogenous heterocyclic bases or base analogs linked together along the backbone, including polymers of conventional RNA, DNA, mixed RNA-DNA, and analogs thereof. The guide RNA "backbone" may be composed of a variety of linkages, including one or more of sugar-phosphodiester linkages, phosphorothioate linkages, or a combination thereof. The sugar moiety of the guide RNA may be ribose, deoxyribose, or a similar compound having a substitution, for example, a 2' methoxy group. The nitrogenous base may be a conventional base (A, G, C, T, U), an analog thereof (e.g., a modified uridine, such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine or others); inosine; a derivative of a purine or pyrimidine (e.g., N 4 -methyldeoxyguanosine, deazapurine or azapurine, deazapyrimidine or azapyrimidine, a pyrimidine base having a substituent at the 5-position or 6-position (e.g., 5-methylcytosine), a purine base having a substituent at the 2-position, 6-position or 8-position, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine and O 4-alkyl-pyrimidine; U.S. Pat. No. 5,378,825 and PCT No. WO 93 / 13121). For a general discussion of chemical modifications of guide RNAs, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., ed., 11th ed., 1992). Guide RNAs may comprise only conventional RNA or DNA sugars, bases, and bonds, or may comprise conventional components and substitutes (e.g., conventional bases with 2' methoxy bonds, or polymers containing conventional bases and one or more base analogs). RNA and DNA have different sugar moieties, and may differ by the presence of uracil or its analogs in RNA and thymine or its analogs in DNA.

[0160] Unmodified nucleic acids can be easily degraded by, for example, intracellular nucleases or those found in serum. For example, nucleases can hydrolyze nucleic acid phosphodiester bonds. Thus, in one aspect, the gRNA described herein can contain one or more, for example, to introduce modified nucleosides or nucleotides for stability against intracellular or serum-based nucleases.

[0161] Phosphorothioate (PS) linkages or bonds refer to bonds in which sulfur replaces one of the non-bridging phosphate oxygens in a phosphodiester linkage, for example, in the bond between nucleotide bases. When phosphorothioates are used to produce oligonucleotides, the modified oligonucleotides may also be referred to as S-oligonucleotides.

[0162] "*" may be used to depict a PS modification. In this application, the terms A*, C*, U*, or G* may be used to denote a nucleotide that is linked to the next (eg, 3') nucleotide via a PS bond.

[0163] In the present application, the term "mA*", "mC*", "mU*" or "mG*" may be used to indicate a nucleotide that has been substituted with 2'-O-Me and is linked to the next (eg, 3') nucleotide via a PS bond.

[0164] The following diagram shows S-substitution to a non-bridging phosphate oxygen, resulting in a PS bond in place of the phosphodiester bond:

[0165]

[0166] In some embodiments, one or more of the first three, four, or five nucleotides at the 5' terminus and one or more of the last three, four, or five nucleotides at the 3' terminus are modified. In some embodiments, the modification is 2'-O-Me, 2'-F, inverted abasic nucleotides, PS bonds, or other nucleotide modifications well known in the art for increasing stability or performance.

[0167] In some embodiments, the first four nucleotides at the 5' terminus and the last four nucleotides at the 3' terminus are linked by phosphorothioate (PS) bonds.

[0168] In some embodiments, for example, the first three nucleotides at the 5' terminus and the last three nucleotides at the 3' terminus comprise 2'-O-methyl (2'-O-Me) modified nucleotides.

[0169] In some embodiments, the guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification pattern shown in SEQ ID NO: 391, wherein N is any natural or non-natural nucleotide, and wherein the totality of N constitutes a guide sequence that guides the nuclease to the target sequence.

[0170] In some embodiments, the guide RNA includes an sgRNA as shown in any one of Table 2 of WO2021158858A1, the contents of which are hereby incorporated in their entirety. In some embodiments, the guide RNA includes an sgRNA comprising any one of the guide sequences in Table 1 of WO2021158858A1, the contents of which are hereby incorporated in their entirety, and wherein the guide sequence may be modified as shown in SEQ ID NO: 391. In some embodiments, the guide RNA includes an sgRNA as shown in any one of Table 24 or Table 25.

[0171] 3. RNA containing an open reading frame encoding Cas9 nuclease

[0172] Any RNA disclosed herein comprising an ORF encoding a Cas9 nuclease (e.g., Streptococcus pyogenes Cas9) can be combined with an sgRNA disclosed herein in a composition or method. In any embodiment described herein, the nucleic acid comprising an open reading frame encoding a Cas9 nuclease can be an mRNA.

[0173] Codons that improve protein expression or correspond to highly expressed tRNAs; exemplary codon sets

[0174] In some embodiments, the nucleic acid comprises an ORF with a codon that improves protein expression in a mammal, such as a human. In other embodiments, the nucleic acid comprises an ORF with a codon that improves protein expression in an organ, such as a liver, of a human. In other embodiments, the nucleic acid comprises an ORF with a codon that improves protein expression in a cell type, such as a hepatocyte. The improvement in protein expression in hepatocytes, liver, or humans, etc., can be determined relative to the degree of translation of the wild-type sequence of the ORF, or relative to an organism with a codon distribution matching the codon distribution of an organism from which the ORF is derived or an organism containing the most similar ORF at the amino acid level, such as Streptococcus pyogenes, Staphylococcus aureus (S. aureus), or another prokaryotic organism, depending on the case of a prokaryotic derived Cas nuclease, such as a Cas nuclease from other prokaryotes as described below. Alternatively, in some embodiments, the improvement in protein expression of the Cas9 sequence in a mammal, cell type, mammalian organ, human, human organ, etc. is determined relative to the translation of an ORF having a sequence of SEQ ID NO: 393 (Table 23), all else being equal, including any applicable point mutations, heterologous domains, etc. Codons that can be used to increase expression in humans (including human liver and human hepatocytes) can be codons corresponding to tRNAs that are highly expressed in human liver / hepatocytes, as discussed in Dittmar KA, PLos Genetics 2(12):e221(2006). In some embodiments, at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the codons in the ORF are codons corresponding to tRNAs that are highly expressed in mammals (such as humans) (e.g., the tRNA with the highest expression for each amino acid). In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the codons in the ORF are codons corresponding to tRNAs that are highly expressed in mammalian organs (such as human organs) (e.g., the tRNAs with the highest expression of each amino acid). In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the codons in the ORF are codons corresponding to tRNAs that are highly expressed in mammalian liver (such as human liver) (e.g., the tRNAs with the highest expression of each amino acid). In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the codons in the ORF are codons corresponding to tRNAs that are highly expressed in mammalian hepatocytes (such as human hepatocytes) (e.g., the tRNAs with the highest expression of each amino acid).

[0175] Alternatively, codons corresponding to tRNAs highly expressed in organisms (e.g., humans) can generally be used. Various codon uses are known in the art (see, e.g., WO2019067910, WO2020198641) and can be applied to ORFs provided herein.

[0176] Exemplary sequences

[0177] In some embodiments, the ORF encoding the Cas nuclease comprises a sequence that is at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to any one of SEQ ID NOs: 393-407, 392, and 408.

[0178] In some embodiments, the mRNA comprises an ORF encoding a Cas nuclease, wherein the Cas nuclease comprises an amino acid sequence that is at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to any one of SEQ ID NOs: 406-407.

[0179] In some embodiments, the ORF encoding the Cas nuclease comprises a sequence that is codon-optimized according to the sequence provided in Table 3 from any one of SEQ ID NOs: 393-407, 392, and 408, or a sequence that is at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to any one of SEQ ID NOs: 393-407, 392, and 408.

[0180] As used herein, a first sequence is considered to be "comprising a sequence having at least X% identity to a second sequence" if alignment of the first sequence with the second sequence shows that X% or more of the positions of the second sequence match the first sequence as a whole. Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. One skilled in the art will understand what algorithm and parameter settings are appropriate for a given pair of sequences to be aligned; for sequences of approximately similar length and expected identity of >50% for amino acids or >75% for nucleotides, the Needleman-Wunsch algorithm with default settings of the Needleman-Wunsch algorithm interface provided by EBI on the www.ebi.ac.uk web server is generally appropriate.

[0181] Additional features of RNA, mRNA, and ORF

[0182] Any additional features described herein may be combined with any of the above embodiments to the extent feasible.

[0183] Encoded Cas nuclease

[0184] In some embodiments, the Cas9 nuclease has a lyase activity, which may also be referred to as a double-stranded endonuclease activity. Examples of Cas9 nucleases include those of the type II CRISPR systems of Streptococcus pyogenes, Staphylococcus aureus, and other prokaryotes, and modified (engineered or mutant) versions thereof. See, for example, US20160312198; US20160312199.

[0185] Poly-A tail

[0186] In some embodiments, RNA (e.g., mRNA) also includes a polyadenylation (poly-A) tail. In some cases, for example, when the poly-A tail is encoded by a plasmid, the poly-A tail will be "interrupted" by one or more non-adenine nucleotide "anchors" at one or more positions in the poly-A tail. The poly-A tail may include at least 8 consecutive adenine nucleotides, and in some embodiments, the poly-A tail also includes one or more non-adenine nucleotides. As used herein, "non-adenine nucleotides" refer to any natural or non-natural nucleotides that do not contain adenine. Guanine, thymine and cytosine nucleotides are exemplary non-adenine nucleotides. Therefore, the poly-A tail on the polynucleotides described herein (e.g., mRNA) may include continuous adenine nucleotides at 3' of the nucleotides encoding the Cas nuclease or the sequence of interest. In some cases, the poly-A tail on the mRNA includes non-continuous adenine nucleotides at 3' of the nucleotides encoding the Cas nuclease or the sequence of interest, wherein the non-adenine nucleotides interrupt the adenine nucleotides at regular or irregular intervals.

[0187] In some embodiments, the poly-A tail is encoded in a plasmid for in vitro transcription of mRNA and becomes part of the transcript. The poly-A sequence encoded in the plasmid, i.e., the number of consecutive adenine nucleotides in the poly-A sequence, may be imprecise, for example, 100 poly-A sequences (SEQ ID NO: 410) in a plasmid may result in up to 100 poly-A sequences (SEQ ID NO: 410) in the transcribed mRNA. In some embodiments, the encoded poly-A tail length is about 90 or 95 nucleotides. In some embodiments, the poly-A tail is not encoded in the plasmid, but is added by PCR tailing or enzymatic tailing, for example, using Escherichia coli (E. coli) poly (A) polymerase.

[0188] UTR; Kozak sequence

[0189] In some embodiments, the RNA (e.g., mRNA) encoding the Cas nuclease comprises a 5'UTR, a 3'UTR, or a 5' and 3'UTR. In some embodiments, the RNA (e.g., mRNA) comprises at least one UTR from hydroxysteroid 17-β dehydrogenase 4 (HSD17B4 or HSD), such as a 5'UTR from HSD. In some embodiments, the RNA (e.g., mRNA) comprises at least one UTR from a globin mRNA, such as human α-globin (HBA) mRNA, human β-globin (HBB) mRNA, or African clawed frog β-globin (Xenopus laevis beta globin) (XBG) mRNA. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5'UTR, a 3'UTR, or a 5' and 3'UTR from a globin mRNA (such as HBA, HBB, or XBG). In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5'UTR from bovine growth hormone, cytomegalovirus (CMV), mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 3'UTR from bovine growth hormone, cytomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5' and 3'UTR from bovine growth hormone, cytomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, XBG, heat shock protein 90 (Hsp90), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin, α-tubulin, tumor protein (p53), or epidermal growth factor receptor (EGFR).

[0190] In some embodiments, the polynucleotide (eg, mRNA) comprises 5' and 3' UTRs from the same source, eg, a constitutively expressed mRNA such as actin, albumin, or globin (such as HBA, HBB, or XBG).

[0191] In some embodiments, the polynucleotide (e.g., mRNA) comprises a Kozak sequence. Kozak sequences are known in the art. Kozak sequences can affect the initiation of translation and the total yield of polypeptides translated from nucleic acids. Kozak sequences comprise a methionine codon that can act as a start codon. The minimum Kozak sequence is NNNRUGN, where at least one of the following is true: the first N is A or G and the second N is G. In the context of nucleotide sequences, R means purine (A or G). In some embodiments, the Kozak sequence is gccgccRccAUGG (SEQ ID NO: 392), where the lowercase positions have zero mismatches or at most one, two, three, or four mismatches.

[0192] Modified nucleotides

[0193] In some embodiments, the mRNA comprising the ORF encoding the Cas9 nuclease comprises modified uridines at some or all uridine positions. In some embodiments, the modified uridine is a uridine modified, for example, with a halogen or C1-C3 alkoxy group at the 5 position. In some embodiments, the modified uridine is a pseudouridine modified, for example, with a C1-C3 alkyl group at the 1 position. The modified uridine can be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In certain embodiments, mRNA comprises N1-methyl-pseudouridine at all uridine positions.

[0194] In some embodiments, at least 80%, 85%, 90%, 95%, 98%, or 99%; or 100% of the uridine positions in the nucleic acid are modified uridines. In some embodiments, 80-95% or 90-100% of the uridine positions in the nucleic acid are modified uridines, for example, N1-methylpseudouridine, pseudouridine, or a combination thereof. In some embodiments, 80-95% or 90-100% of the uridine positions in the nucleic acid are pseudouridines. In some embodiments, 80-95% or 90-100% of the uridine positions in the nucleic acid are N1-methylpseudouridine.

[0195] 5' Cap

[0196] In some embodiments, the mRNA comprising an ORF encoding a Cas nuclease (e.g., Cas9) comprises a 5' cap, such as Cap0, Cap1, or Cap2. The 5' cap is generally a 7-methylguanine ribonucleotide (which may be further modified, as discussed below, for example, with respect to ARCA) at the 5' position of the first nucleotide (i.e., the first cap-proximal nucleotide) of the 5' to 3' chain of nucleotides connected by a 5'-triphosphate. In Cap0, the ribose of the first and second cap-proximal nucleotides of the mRNA both comprise a 2'-hydroxyl group. In Cap1, the ribose of the first and second transcribed nucleotides of the mRNA comprise a 2'-methoxy group and a 2'-hydroxyl group, respectively. In Cap2, the ribose of the first and second cap-proximal nucleotides of the mRNA both comprise a 2'-methoxy group. See, e.g., Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30; Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115.

[0197] Caps can be included in RNA co-transcription. For example, ARCA (anti-reverse cap analog; Thermo Fisher Scientific catalog number AM8045) is a cap analog comprising 7-methylguanine 3'-methoxy-5'-triphosphate connected to the 5' position of guanine ribonucleotide, which can be incorporated into transcripts in vitro at the beginning. ARCA produces Cap0 caps, wherein the 2' position of the first cap proximal nucleotide is a hydroxyl group. See, for example, Stepinski et al., (2001) "Synthesis and properties of mRNAs containing the novel'anti-reverse'cap analogs7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG", RNA 7:1486-1495. The ARCA structure is shown below.

[0198]

[0199] CleanCap TM AG (m7G (5') ppp (5') (2'OMeA) pG; TriLink Biotechnologies Cat. No. N-7113) or CleanCap TMGG (m7G (5') ppp (5') (2'OMeG) pG; TriLink Biotechnologies Cat. No. N-7133) can be used to co-transcriptionally provide the Cap1 structure. TM AG and CleanCap TM 3'-O-methylated versions of GG are also available from TriLink Biotechnologies as catalog numbers N-7413 and N-7433. TM The AG structure is shown below. This article sometimes uses the last three digits of the catalog number listed above to refer to CleanCap TM Structure (e.g., "CleanCap TM 113" represents TriLink Biotechnologies catalog number N-7113).

[0200]

[0201] Alternatively, the cap can be added to the RNA after transcription. For example, vaccinia capping enzyme is commercially available (New England Biolabs catalog number M2080S) and has RNA triphosphatase and guanylyltransferase activities provided by its D1 subunit and guanine methyltransferase provided by its D12 subunit. Thus, in the presence of S-adenosylmethionine and GTP, vaccinia capping enzyme can add 7-methylguanine to RNA to obtain Cap0. See, for example, Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479. For additional discussion of caps and capping methods, see, for example, WO 2017 / 053297 and Ishikawa et al., Nucl. Acids. Symp. Sequence (2009) No. 53, 129-130.

[0202] 4. Delivery of Nucleic Acid Compositions

[0203] In some embodiments, a method of inducing double-strand breaks (DSBs) or gene editing in KLKB1 is provided, comprising systemically administering a composition comprising a guide RNA as described herein. In some embodiments, the guide RNA is systemically administered to induce DSBs in KLKB1. The guide RNA is systemically administered together with an mRNA encoding a Cas9 nuclease (e.g., Streptococcus pyogenes Cas9). In a specific embodiment, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA encoding the Cas9 nuclease are systemically administered in an LNP described herein, such as an LNP comprising an ionizable lipid, referred to herein as lipid A (which is (9Z, 12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadec-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z, 12Z)-octadec-9,12-dienoate). In other embodiments, the LNP comprises a lipid component including lipid A, a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k-DMG), and a neutral lipid (e.g., DSPC).

[0204] In some embodiments, a method of inducing a double-strand break (DSB) in the KLKB1 gene is provided, comprising systemically administering an LNP composition comprising a single guide RNA (such as a chemically modified single guide RNA). The guide RNA is systemically administered together with an mRNA encoding a Cas9 nuclease (e.g., Streptococcus pyogenes Cas9) as described herein. In a specific embodiment, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA encoding the Cas nuclease are systemically administered in an LNP as described herein (such as an LNP comprising lipid A, a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k-DMG) and a neutral lipid (e.g., DSPC)).

[0205] In some embodiments, a method for modifying the KLKB1 gene is provided, comprising systemically administering a composition comprising a single guide RNA (such as a chemically modified single guide RNA). The guide RNA is systemically administered together with an mRNA encoding a Cas9 nuclease (e.g., Streptococcus pyogenes Cas9) as described herein. In a specific embodiment, the guide RNA is chemically modified. In some embodiments, the guide RNA and the RNA encoding the Cas nuclease are systemically administered in LNPs described herein (such as LNPs comprising lipid A, auxiliary lipids (e.g., cholesterol), stealth lipids (e.g., PEG lipids, such as PEG2k-DMG) and optionally neutral lipids (e.g., DSPC)).

[0206] In some embodiments, a method for treating HAE is provided, comprising systemically administering a composition comprising a single guide RNA targeting the KLKB1 gene. The guide RNA is systemically administered together with an mRNA encoding Cas9 nuclease (e.g., Streptococcus pyogenes Cas9) as described herein. In a specific embodiment, the guide RNA is chemically modified. In some embodiments, the guide RNA and the nucleic acid encoding the Cas nuclease are systemically administered in LNPs described herein (such as LNPs comprising lipid A, auxiliary lipids (e.g., cholesterol), stealth lipids (e.g., PEG lipids, such as PEG2k-DMG) and neutral lipids (e.g., DSPC)).

[0207] In some embodiments, a method for reducing plasma kallikrein protein level or activity is provided, which includes systemic administration of a guide RNA targeting the KLKB1 gene. In some embodiments, gRNA is systemically administered to reduce plasma kallikrein protein level or activity. In some embodiments, the plasma kallikrein protein level is the total plasma kallikrein protein level. gRNA is systemically administered together with a nucleic acid encoding Cas9 nuclease (e.g., Streptococcus pyogenes Cas9). In a specific embodiment, the guide RNA is chemically modified. In some embodiments, the guide RNA and the mRNA encoding the Cas nuclease are systemically administered in LNPs described herein (such as LNPs comprising lipid A, auxiliary lipids (e.g., cholesterol), stealth lipids (e.g., PEG lipids, such as PEG2k-DMG) and neutral lipids (e.g., DSPC)).

[0208] In some embodiments, a gRNA comprising a guide sequence induces DSBs together with a Cas9 nuclease translated from a nucleic acid, and non-homologous end joining (NHEJ) during repair results in a mutation in the KLKB1 gene. In some embodiments, NHEJ results in a deletion or insertion of nucleotides, which induces a frameshift or nonsense mutation in the KLKB1 gene.

[0209] 5. Lipid composition

[0210] In some embodiments, nucleic acid compositions described herein, comprising gRNA and nucleic acids encoding Cas nucleases (e.g., Cas9) as described herein, are formulated in lipid nanoparticles or administered systemically via lipid nanoparticles; see, for example, WO2017173054A1 entitled "LIPID NANOPARTICLE FORMULATIONS FOR CRISPR / CAS COMPONENTS" and WO2019067992A1 entitled "FORMULATIONS", the contents of which, in particular the LNP compositions disclosed therein, are incorporated herein by reference as a whole. It is known to those skilled in the art that lipid nanoparticles (LNPs) capable of delivering therapeutic RNA to a subject can be used with guide RNAs as described herein and nucleic acids encoding Cas nucleases.

[0211] Compositions comprising LNPs may include two active substances, guide RNA and RNA encoding Cas nucleases (e.g., Cas9 nucleases, such as Spy.Cas9 nucleases), and lipid components comprising ionizable lipids. Lipid nanoparticles refer to particles comprising multiple (i.e., more than one) lipid molecules that are physically associated with each other by intermolecular forces.

[0212] Ionizable lipids

[0213] The lipid composition for delivering CRISPR / Cas mRNA and RNA components to the liver can include lipid A, which is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadec-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadec-9,12-dienoate. Lipid A can be depicted as:

[0214]

[0215] Lipid A can be synthesized according to WO2015 / 095340 (eg, pages 84-86).

[0216] Additional lipids

[0217] "Neutral lipids" suitable for lipid compositions of the present disclosure include, for example, a variety of neutral, uncharged or zwitterionic lipids. Examples of neutral phospholipids suitable for the present disclosure include, but are not limited to, 5-heptadecanylbenzene-1,3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), phosphorylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (egg phosphatidylcholine)(EPC), dilauroylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoylphosphatidylcholine (MPPC), 1-palmitoyl-2-myristoylphosphatidylcholine (PMPC), 1-palmitoyl-2-stearoylphosphatidylcholine (PSPC), 1,2-diazanoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2-palmitoylphosphatidylcholine (PSPC), In one embodiment, the neutral phospholipids can be selected from the group consisting of distearoylphosphatidylcholine (DSPC) and dimyristoylphosphatidylethanolamine (DMPE). In another embodiment, the neutral phospholipids can be distearoylphosphatidylcholine (DSPC).

[0218] "Helper lipids" include steroids, sterols, and alkylresorcinols. Helper lipids suitable for use in the present disclosure include, but are not limited to, cholesterol, 5-heptadecanylresorcinol, and cholesterol hemisuccinate. In one embodiment, the helper lipid may be cholesterol.

[0219] "Stealth lipids" are lipids that change the length of time that nanoparticles can exist in vivo (e.g., in the blood), and the stealth lipids can be PEG lipids. Stealth lipids can assist in the formulation process by, for example, reducing particle aggregation and controlling particle size. Stealth lipids used herein can adjust the pharmacokinetic properties of LNPs. Stealth lipids suitable for lipid compositions of the present disclosure include, but not typically, PEG lipids comprising a lipid portion and a PEG-based polymer portion. PEG lipids known in the art are contemplated, including lipids comprising "PEG-2K", also referred to as "PEG 2000" (whose average molecular weight is about 2,000 daltons). PEG-2K herein is represented by the following formula (I), wherein n is 45, meaning that the number-average degree of polymerization comprises about 45 subunits.

[0220] However, other PEG embodiments known in the art may also be used.

[0221]

[0222] In any of the embodiments described herein, the PEG lipid can be selected from PEG-dilauroylglycerol, PEG-dimyristoylglycerol (PEG-DMG) (Catalog No. GM-020, from NOF, Tokyo, Japan), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE) (Catalog No. DSPE-020CN, NOF, Tokyo, Japan), PEG-dilaurylglycamide, PEG-dimyristoylglyceramide, PEG-dipalmitoylglyceramide and PEG-distearoylglyceramide, PEG-cholesterol (1-[8'-(cholest-5-ene-3[β]-oxy)formyl amino-3',6'-dioxaoctyl]carbamoyl-[ω]-methyl-poly(ethylene glycol), PEG-DMB (3,4-tetradecanoylbenzyl-[ω]-methyl-poly(ethylene glycol) ether), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DMPE) or 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG2k-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSPE) (Cat. No. 880120C from AvantiPolar Lipids, Alabaster, Alabama, USA), 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG2k-DSG; GS-020, NOF Tokyo, Japan), polyethylene glycol-2000-dimethacrylate (PEG2k-DMA), and 1,2-distearoyloxypropyl-3-amine-N-[methoxypolyethylene glycol-2000] (PEG2k-DSA). In one embodiment, the PEG lipid can be PEG2k-DMG.

[0223] In some embodiments, the PEG lipid comprises a glycerol group. In some embodiments, the PEG lipid comprises a dimyristoylglycerol (DMG) group. In some embodiments, the PEG lipid comprises PEG2k. In some embodiments, the PEG lipid is PEG-DMG. In some embodiments, the PEG lipid is PEG2k-DMG. In some embodiments, the PEG lipid is 1,2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol-2000. In some embodiments, PEG2k DMG is 1,2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol-2000.

[0224] LNP formulation

[0225] The LNP composition may include a lipid component and an RNA component, wherein the RNA component includes a Cas nuclease mRNA (e.g., Cas9 mRNA, such as Spy.Cas9 mRNA) and a gRNA targeting KLKB1. In some embodiments, the LNP composition includes mRNA and gRNA encoding Cas9 nuclease as RNA components. In certain embodiments, the LNP composition may include an RNA component, lipid A, an auxiliary lipid, a neutral lipid, and a stealth lipid. In certain LNP compositions, the auxiliary lipid is cholesterol. In certain compositions, the neutral lipid is DSPC. In additional embodiments, the stealth lipid is PEG2k-DMG.

[0226] In certain embodiments, lipid composition is described according to the respective mol ratio of component lipid in preparation. Embodiments disclosed herein provide lipid composition described according to the respective mol ratio of component lipid in preparation.In one embodiment, the mol-% of ionizable lipid (such as lipid A) is about 40mol-% to 60mol-%, optionally about 50mol-%.In one embodiment, the mol-% of ionizable lipid is about 55mol-%.In some embodiments, the mol-% of ionizable lipid of LNP batches will be ± 30%, ± 25%, ± 20%, ± 15%, ± 10%, ± 5% or ± 2.5% of target mol-%.In some embodiments, the ionizable lipid mol-% of LNP batches is ± 4mol-%, ± 3mol-%, ± 2mol-%, ± 1.5mol-%, ± 1mol-%, ± 0.5mol-% or ± 0.25mol-%.All mol-% numbers are given with the fraction of lipid component in LNP compositions.

[0227] In one embodiment, the mol-% of neutral lipids (e.g., neutral phospholipids) is about 5 mol-% to 15 mol-%, optionally about 9 mol-%. In some embodiments, the mol-% of neutral lipids in the LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5% or ±2.5% of the mol-% of the target neutral lipid.

[0228] In one embodiment, the mol% of the helper lipid is about 20mol%-60mol%. In one embodiment, the mol% of the helper lipid is about 25mol% to 55mol%, optionally, the mol% of the helper lipid is about 30mol% to 40mol%. In one embodiment, the mol% of the helper lipid is adjusted based on the concentration of ionizable lipids, neutral lipids, and PEG lipids so that the lipid component is 100mol%. In one embodiment, the mol% of the helper lipid is adjusted based on the concentration of ionizable lipids and PEG lipids so that the lipid component is at least 99mol%. In some embodiments, the mol% of the helper lipid of the LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target mol%.

[0229] In one embodiment, the mol% of PEG lipid is about 1 mol% to 10 mol%. In one embodiment, the mol% of PEG lipid is about 2 mol% to 4 mol%. In one embodiment, the mol% of PEG lipid is about 2.5 mol% to 4 mol%. In one embodiment, the mol% of PEG lipid is about 3 mol-%. In some embodiments, the mol% of PEG lipid of the LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5% or ±2.5% of the mol% of the target PEG lipid.

[0230] In certain embodiments, goods include nucleic acids (e.g., mRNA) and sgRNA encoding Cas9 nucleases. In some embodiments, ionizable lipids are lipid A. In some embodiments, LNP compositions include ionizable lipids (e.g., lipid A), neutral lipids, helper lipids, and PEG lipids. In certain embodiments, helper lipids are cholesterol. In certain embodiments, neutral lipids are DSPC. In specific embodiments, PEG lipids are PEG2k-DMG. In some embodiments, LNP compositions may include lipid A, helper lipids, neutral lipids, and PEG lipids. In additional embodiments, LNP compositions include lipid A, cholesterol, DSPC, and PEG2k-DMG.

[0231] Embodiments of the present disclosure also provide lipid compositions described according to the molar ratio between the positively charged ionizable groups (N) of the ionizable lipids and the negatively charged phosphate groups (P) of the nucleic acids to be encapsulated. This can be mathematically represented by the ratio N / P. In some embodiments, the LNP composition may include a lipid component comprising an ionizable lipid, an auxiliary lipid, a neutral lipid, and a PEG lipid; and a nucleic acid component, wherein the N / P ratio is about 3 to 10. In some embodiments, the N / P ratio is about 5 to 7, and optionally the N / P ratio is about 6. In some embodiments, the N / P ratio is 6±1. In some embodiments, the N / P ratio is 6±0.5. In some embodiments, the N / P ratio is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target N / P ratio.

[0232] In some embodiments, the RNA component comprises an mRNA encoding a Cas9 nuclease, e.g., a Spy Cas9 nuclease, such as a nucleic acid disclosed herein, an mRNA described herein, and an sgRNA described herein. In any of the foregoing embodiments, the sgRNA is a chemically modified sgRNA described herein.

[0233] In certain embodiments, the LNP composition comprises a Cas9 nuclease mRNA as described herein (such as Spy Cas9 mRNA) and an sgRNA as described herein. In certain embodiments, the LNP composition comprises a certain ratio of gRNA to Cas9 nuclease mRNA, such as Spy Cas9 nuclease mRNA is about 10: 1 to 1: 10, for example, about 1: 1, 1: 2 or 1: 3.

[0234] In some embodiments, LNPs are formed by mixing an aqueous RNA solution with an organic solvent-based lipid solution (e.g., 100% ethanol). Suitable solutions or solvents include or may contain: water, PBS, Tris buffer, NaCl, citrate buffer, ethanol, chloroform, ether, cyclohexane, tetrahydrofuran, methanol, isopropanol. Pharmaceutically acceptable buffers may be used, for example, for in vivo administration of LNPs.

[0235] In some embodiments, microfluidic mixing, T mixing or cross mixing are used. In some aspects, flow rate, junction size, junction geometry, junction shape, tube diameter, solution or RNA and lipid concentration can be varied. LNP or LNP composition can be, for example, concentrated or purified via dialysis, tangential flow filtration or chromatography. LNP can be composed of 4 kinds of lipids, including lipid A; DSPC; cholesterol; and DMG-PEG2k. In some embodiments, LNP is suspended and formulated in 50mM Tris, 45mM NaCl and 5% (weight / volume) sucrose, pH 7.4 aqueous buffer.

[0236] Dynamic light scattering ("DLS") can be used to characterize the polydispersity index ("pdi") and size of the LNPs of the present disclosure. DLS measures the scattering of light produced after a sample is subjected to a light source. The PDI, as determined by DLS measurements, represents the distribution of particle sizes in a population (around a mean particle size), where a completely uniform population would have a PDI of zero.

[0237] In some embodiments, the size of LNP disclosed herein is 50 to 100 nm. In some embodiments, the size of LNP is 85 to 90 nm. Unless otherwise stated, all sizes mentioned herein are the average size (diameter) of fully formed nanoparticles measured by dynamic light scattering on Malvern Zetasizer. Nanoparticle samples were diluted in phosphate buffered saline (PBS) so that the count rate was about 200-400 kcts. Data are represented by weighted averages of intensity measurements.

[0238] In some embodiments, the LNP associated with the gRNA disclosed herein and the mRNA encoding Cas9 nuclease (e.g., SpyCas9 nuclease) disclosed herein is used to prepare a drug for treating HAE. In some embodiments, the LNP associated with the gRNA disclosed herein and the mRNA encoding Cas9 nuclease (e.g., SpyCas9 nuclease) disclosed herein is used to prepare a drug for reducing plasma kallikrein in subjects with HAE. In some embodiments, the LNP associated with the gRNA disclosed herein and the mRNA encoding Cas9 nuclease (e.g., Spy Cas9) disclosed herein is used to prepare a drug for reducing plasma kallikrein concentration. In some embodiments, the LNP associated with the gRNA disclosed herein and the mRNA encoding Cas9 nuclease (e.g., Spy Cas9) disclosed herein is used to prepare a drug for reducing plasma kallikrein activity. In some embodiments, the LNP associated with the gRNA disclosed herein and the mRNA encoding Cas9 nuclease (e.g., SpyCas9) disclosed herein is used to treat HAE in human subjects. In some embodiments, the LNP associated with the gRNA disclosed herein and the mRNA encoding Cas9 nuclease (e.g., Spy Cas9) disclosed herein is used to reduce the plasma kallikrein protein level or plasma kallikrein activity level of the human subject. In some embodiments, the LNP associated with the gRNA disclosed herein and the mRNA encoding Cas9 nuclease (e.g., Spy Cas9) disclosed herein is used to reduce the total plasma kallikrein protein level of the human subject. In some embodiments, the LNP associated with the gRNA disclosed herein and the mRNA encoding Cas9 nuclease (e.g., Spy Cas9) disclosed herein is used to reduce the HAE attack frequency of the human subject.

[0239] In some embodiments, the LNP comprises a lipid component, and the lipid component comprises, consists essentially of, or consists of: about 50 mol-% of an ionizable lipid, such as lipid A; about 9 mol-% of a neutral lipid, such as DSPC; about 3 mol-% of a stealth lipid, such as a PEG lipid, such as PEG2k-DMG, and the remainder of the lipid component is a helper lipid, such as cholesterol, wherein the N / P ratio of the LNP composition is about 6. In some embodiments, the ionizable lipid is lipid A. In some embodiments, the neutral lipid is DSPC. In some embodiments, the stealth lipid is a PEG lipid. In some embodiments, the stealth lipid is PEG2k-DMG. In some embodiments, the stealth lipid is cholesterol. In some embodiments, the LNP comprises a lipid component, and the lipid component comprises: about 50 mol-% of lipid A; about 9 mol-% of DSPC; about 3 mol-% of PEG2k-DMG, and the remainder of the lipid component is cholesterol, wherein the N / P ratio of the LNP composition is about 6.

[0240] II. Systemic Delivery Methods

[0241] In some embodiments, systemic administration comprises mRNA encoding Cas9 nuclease (e.g., Spy Cas9); and LNP compositions described herein of guide RNA targeting KLKB1 gene. As used herein, systemic administration refers to extensive biodistribution in an organism, such as intravenous administration.

[0242] In some embodiments, a single administration of LNP compositions described herein is sufficient to knock down the expression of target proteins. In some embodiments, a single administration of LNP compositions is sufficient to knock down the expression of target proteins in cell populations. In other embodiments, more than one administration of LNP compositions may be beneficial to maximize editing via cumulative effects. For example, LNP compositions may be administered for the second or third time ("subsequent doses"), such as the second or third doses. The dosage of the second or third dose may be determined by a clinician to provide plasma kallikrein total protein or activity levels compared to baseline levels (e.g., levels before the first LNP administration), for example, about or greater than 60%, 70%, 80% or 90% reduction. More than one administration (second or third dose) may be administered at a fixed dose, such as 25mg, 50mg, 75mg, 100mg, 125mg or 150mg; or administered in a dose based on body weight.

[0243] In some embodiments, the LNP compositions described herein are administered by infusion, and the infusion time is about 2-4 hours. In some embodiments, the LNP compositions described herein are administered by infusion, and the infusion time is about 2-5 hours. In some embodiments, the LNP compositions described herein are administered by infusion, and the infusion time is at least 2 hours.

[0244] III. Dosage

[0245] In some embodiments, a LNP composition described herein (e.g., comprising an effective amount of mRNA encoding a Cas9 nuclease and a guide RNA targeting a KLKB1 gene, such as a guide RNA targeting a KLKB1 gene (total dose or combined dose)) is administered using a fixed dose. For human subjects, the fixed dose may be about 25-75 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 25-100 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 50-75 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 25 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 50 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 75 mg. The LNP composition can be administered in an effective amount, wherein, when administered on a total RNA basis, the LNP composition administers an effective amount of mRNA encoding the Cas9 nuclease and a guide RNA targeting the KLKB1 gene.

[0246] In some embodiments of the invention, "about" means within ± 5% of the value, e.g., for a value of about 25 mg, the range is 23.75 mg to 26.25 mg, or for a value of about 75 mg, the range is 71.25 mg to 78.75 mg. In some embodiments of the invention, "about" means within ± 10% of the value. In some embodiments of the invention, "about" means within ± 20% of the value, e.g., for a value of about 25 mg, the range is 20 mg to 30 mg, or for a value of about 75 mg, the range is 60 mg to 90 mg. Acceptable tolerances in various fields should be understood.

[0247] In some embodiments, a LNP composition described herein (e.g., comprising an effective amount of mRNA encoding a Cas9 nuclease and a guide RNA (total RNA or combined RNA) targeting a KLKB1 gene) is administered to, for example, a pediatric patient using a weight-based dose.

[0248] In other embodiments, the subject receiving the dose that is not enough to provide the total plasma kallikrein protein level or the total plasma kallikrein activity is fully reduced may receive more than one LNP composition administration to maximize editing via cumulative effect. For example, the LNP composition may be administered 2, 3, 4, 5 or more times, such as 2 times, for example, the second administration, the third administration, the fourth administration or the fifth administration. In some embodiments, the LNP composition is administered to a human subject who has previously been administered with the LNP composition. In some embodiments, the LNP composition is administered to a human subject, and the human subject has previously been administered with the LNP composition and after the first LNP administration, for example, at least 28 days, for example, at 56 days, as measured by, for example, ELISA (for example, prekallikrein and kallikrein human ELISA kit catalog number ab171015) The total plasma kallikrein protein level measured does not achieve a reduction greater than 60%, 70% or 80% (for example, after administering the LNP composition, the total plasma kallikrein protein level is reduced by less than 60%, 70% or 80%). In some embodiments, the LNP composition is administered to a human subject who has previously been administered the LNP composition and is measured, for example, by an activity assay kit (e.g., The plasma kallikrein activity level measured by the Rh110 Plasma Kallikrein Activity Assay Kit *Fluorimetric*, Catalog No. AS-72255) does not achieve a reduction of greater than 60%, 70% or 80% (e.g., the plasma kallikrein activity level is reduced by less than 60%, 70% or 80% after administration of the LNP composition). The percent reduction is compared to a baseline sample obtained before administration of the LNP composition. Commercial kits are available for determining total kallikrein protein levels and total kallikrein activity levels. The selection of appropriate controls and methods for validation of such kits are well known to those skilled in the art.

[0249] IV. How to use

[0250] Pathology and therapeutic interventions in hereditary angioedema disorders

[0251] HAE is a rare autosomal dominant genetic disorder, characterized by repeated, painful, unpredictable and potentially fatal inflammatory attacks of skin and submucosal swelling in various organs and tissues of the body. These symptoms are caused by the disorder caused by bradykinin (a peptide that causes increased vascular permeability and causes swelling). The frequency of attacks can be once every 7 to 14 days and lasts for 48 to 72 hours, wherein laryngeal edema is particularly life-threatening because it can cause airway obstruction and suffocation death (Zuraw 2008; Busse 2020, The US HAEA Medical Advisory Board 2020 Guidelines for the Management of Hereditary Angioedema (doi.org / 10.1016 / j.jaip.2020.08.046)).

[0252] The most common form of HAE is caused by a deficiency of C1 esterase inhibitor (C1-INH), a key regulator of the contact activation pathway. Deficiency is due to low levels of functionally active C1-INH protein (type I) or normal levels of functionally inactive C1-INH (type II). See, e.g. Figure 1 . Factor XII (FXII) is a plasma protein at the beginning of the contact activation pathway, which, after activation to factor XIIa (FXIIa), converts plasma prekallikrein (PKK) to active kallikrein. Kallikrein catalyzes the conversion of high molecular weight kininogens to bradykinin. In healthy subjects, the homeostasis of FXIIa and kallikrein activity is negatively controlled by C1-INH, a direct inhibitor of FXIIa and kallikrein. However, in types I and II HAE, C1-INH deficiency or dysfunction leads to dysregulated FXIIa and kallikrein activity, local accumulation of bradykinin, and increased vascular permeability and vasodilation, subsequently leading to angioedema (Busse 2020). The 2020 guidelines for the management of hereditary angioedema from the US HAEA Medical Advisory Committee recommend that HAE be broadly divided into HAE due to C1INH deficiency (HAE-C1INH) and HAE-nl-C1INH (HAE with normal C1INH). HAE-C1INH is further subdivided into type I and type II, which have similar clinical presentations. HAE-nl-C1INH is further subdivided based on the underlying mutation or unknown if no mutation is found.

[0253] Most of the currently approved treatments for HAE are designed to restore the normal function of the contact activation pathway. These strategies include C1-INH substitutes (recombinant or plasma-derived), B2 bradykinin receptor inhibitors (icatibant) and kallikrein inhibitors (ecallant, lanariumab, berostat). Depending on the dosage, these drugs can be used to prevent attacks (prevention) or treat attacks on demand. They are IV, injected subcutaneously (SC) or administered orally. Although on-demand treatment is administered at the beginning of an HAE attack, preventive agents require chronic IV or SC administration twice a week or daily oral administration to ensure continued pathway inhibition for disease control. However, despite chronic administration, breakthrough attacks still occur.

[0254] Agents for HAE attack prevention can be used in combination with NTLA-2002. Such agents may be particularly useful in the early stages after administration with NTLA-2002. The time to stop HAE attack prevention can be determined by the healthcare provider. Although some agents for HAE attack prevention are not allowed in the context of this study, such agents are not necessarily prohibited for use with NTLA-2002. On the contrary, certain agents, for example, are not allowed to be used in combination with the study because they may interfere with certain diagnostic measures in the study.

[0255] The agent for HAE attack prevention may be discontinued prior to administration of NTLA-2002. The half-life and washout period of such agents are known in the art and provided herein. NTLA-2002 administration may be performed during the washout period or after the washout period is completely completed.

[0256] 1. In vivo editing methods

[0257] Provided herein is a method for editing the KLKB1 gene in vivo in the liver of a human subject (e.g., a human subject with HAE). In some embodiments, the method for editing a gene in vivo includes systemically administering to a human subject an LNP composition described herein, the LNP composition comprising mRNA encoding a Cas9 nuclease (e.g., Spy Cas9); and a guide RNA targeting the KLKB1 gene. In some embodiments, in vivo editing occurs at a site targeted by a guide RNA in a subject's hepatocytes.

[0258] In these embodiments, the administration of the LNP composition to the subject may be associated with a change in a biosafety indicator. In some embodiments, the subject is evaluated to determine whether the change in the biosafety indicator is an acceptable change. In some embodiments, an acceptable change may be determined by a clinician or a laboratory. In some embodiments, an acceptable change may be a change that is not a safety event, including an adverse event (NCI-CTCAE grade not greater than or equal to 3), a serious adverse event, an adverse event of particular interest, or an adverse event that occurs during treatment (CTCAE grade not greater than or equal to 3), as described herein. Biosafety indicators, including those associated with the administration of LNP compositions, are known in the art. Acceptable levels or changes in biosafety indicators are known in the art and can be assessed by conventional methods.

[0259] In some embodiments, an acceptable biosafety indicator level is a level that falls within the subject inclusion criteria described herein or does not fall within the subject exclusion criteria described herein.

[0260] In some embodiments, the acceptable change of the biosafety indicator level is an acceptable change after a period of time, for example, initially exceeding the acceptable level but stabilizing to an acceptable level by, for example, the 2nd, 3rd, 4th, 5th, 6th, 7th, 14th or 28th day after administration. Acceptable changes and acceptable resolution times of biosafety indicator levels are provided herein for various measures. Methods for measuring biosafety indicators and grading levels of biosafety indicators are known in the art.

[0261] In some embodiments, an acceptable biosafety indicator level (or an acceptable change in a biosafety indicator level) is a level that does not constitute a grade 3 or higher adverse event according to CTCAE guidelines (including the National Cancer Institute (NCI)-CTCAE guidelines version 5.0). In some embodiments, if a change in a biosafety indicator level (e.g., one or more levels associated with laboratory parameters, vital signs, ECG data, physical examination, etc. described herein) induces clinical signs or symptoms; requires active intervention; requires interruption or cessation of the LNP composition; or a change in a biosafety indicator is clinically significant as determined by a clinician, the change constitutes an adverse event.

[0262] In some embodiments, adverse events are any adverse medical events that occur in subjects receiving study drugs or receiving study procedures, and they are not necessarily causally related to treatment. In some embodiments, adverse events are unexpected signs (including abnormal laboratory findings), symptoms or diseases temporarily related to treatment, whether or not related to drug (research) products. In some embodiments, adverse events induce clinical signs or symptoms. In some embodiments, adverse events require active intervention. In some embodiments, adverse events require interruption or cessation of treatment. In some embodiments, adverse events are considered to be clinically significant abnormalities by researchers. The grading criteria for adverse events are known in the art, such as, for example, Common Terminology Criteria for Adverse Events (CTCAE), including National Cancer Institute (NCI)-CTCAE.

[0263] In some embodiments, an acceptable biosafety indicator level (or an acceptable change in the biosafety indicator level) is a level that does not constitute a serious adverse event. In some embodiments, a serious adverse event results in death. In some embodiments, a serious adverse event is life-threatening (e.g., as determined by a clinician to place the subject at direct risk of death). In some embodiments, a serious adverse event results in persistent or severe disability. In some embodiments, a serious adverse event results in a loss of ability to perform normal life functions or is significantly damaged. In some embodiments, a serious adverse event results in congenital anomalies or birth defects. In some embodiments, a serious adverse event requires hospitalization of an inpatient or results in an extended hospital stay.

[0264] In some embodiments, an acceptable biosafety indicator level (or an acceptable change in biosafety indicator level) is one that does not constitute a grade of 3 or greater on the Common Terminology Criteria for Adverse Events (CTCAE) for treatment-emergent adverse events.

[0265] Methods of in vivo editing may include measuring known biological assessments, typically involving, for example, coagulation, hematology, clinical chemistry, urinalysis, and other bioanalytical assessments (e.g., cytokines, complement). Specific biosafety indicators include, but are not limited to, one or more of the following non-limiting biosafety indicators: liver enzymes, levels of activated partial thromboplastin time (aPTT), levels of prothrombin time (PT), levels of thrombin generation time (TGT) (e.g., peak height, lag time, or thrombin generation potential), levels of fibrinogen, prothrombin international normalized (INR) ratio, d-dimer levels, HBV, HBsAg, HCV Ab, laboratory parameters consistent with disseminated intravascular coagulation, changes in hematology values, changes in chemistry values, changes in coagulation, changes in urinalysis, levels of C-reactive protein, levels of complement (C3a, C5a, Bb), levels of cytokines (GM-CSF, INF-γ, IL-1β, IL-4, IL-5, IL-6, IL-8, IL-10, IL-13, IL-23, TNF-α, IL-17, MCP-1), acute liver injury (e.g., after administration of treatment, ALT, AST, total bilirubin, CTCAE> grade 2 elevation or clinically relevant liver injury symptoms / signs) and changes in 12-lead electrocardiogram. In certain embodiments, laboratory assessment is the level of activated partial thromboplastin time (aPTT). In some embodiments, biosafety indicators include injection site reactions and gastrointestinal symptoms.

[0266] For example, other biosafety indicators related to hematology, coagulation, clinical chemistry and urinalysis are known in the art. For example, biosafety indicators related to hematology include but are not limited to platelet count, RBC count, hemoglobin, hematocrit, RBC index (MCV, MCH, MCHC, RDW), reticulocyte percentage, white blood cell (WBC) count and classification (neutrophil, lymphocyte, monocyte, eosinophil, basophil). For example, biosafety indicators related to coagulation include but are not limited to aPTT, PT, INR, fibrinogen, d-dimer and TGT. For example, biosafety indicators related to clinical chemistry include but are not limited to albumin, blood urea nitrogen, creatinine, non-fasting glucose, potassium, sodium, chloride, carbon dioxide, calcium, AST, ALT, alkaline phosphatase, total bilirubin and direct bilirubin, total protein, creatine kinase, lactose dehydrogenase, total cholesterol and LDL cholesterol. For example, biological safety indicators associated with urinalysis include, but are not limited to, specific gravity, pH, glucose, protein, blood, ketones, bilirubin, urobilinogen, nitrite, and leukocyte esterase. In certain embodiments, the biological safety indicator is aPTT level.

[0267] In some embodiments, the level of biosafety indicators is measured after the LNP composition is administered. In some embodiments, the level of biosafety indicators is measured before and after the LNP composition is administered, thereby allowing comparison of the level of biosafety indicators before and after treatment with the LNP composition. In some embodiments, the level of biosafety indicators measured before the LNP composition is administered can serve as a baseline for comparison with one or more biosafety indicator levels measured after the LNP composition is administered. In some embodiments, the baseline is the last available measurement performed before the LNP composition is administered. In these embodiments, the administration of the LNP composition results in an acceptable change in liver enzyme levels (e.g., after administration of treatment for more than 4 weeks, no more than ALT or AST increases> 5 × ULN, after administration of treatment, ALT or AST> 3 × ULN and total bilirubin> 2 × ULN (Hyman's rule)). In these embodiments, the administration of the composition results in an acceptable change in the level of activated partial thromboplastin time (aPTT) (e.g., after administration of treatment for more than 4 weeks, aPTT increases> 5 × ULN). In these embodiments, the administration of the composition results in an acceptable change in the level of prothrombin time (PT). In these embodiments, the administration of the composition results in an acceptable change in the level of thrombin generation time (TGT) (e.g., peak height, lag time or thrombin generation potential). In these embodiments, the administration of the composition results in an acceptable change in the level of fibrinogen. In some embodiments, the administration of the composition results in an acceptable change in the prothrombin international normalization (INR) ratio. In these embodiments, the administration of the composition results in an acceptable change in the level of d-dimer. In these embodiments, the administration of the composition results in an acceptable change in laboratory parameters consistent with disseminated intravascular coagulation. In these embodiments, the administration of the composition results in an acceptable change in hematological values ​​(e.g., after administration of treatment, CTCAE> grade 2 abnormal blood test results). In these embodiments, the administration of the composition results in an acceptable change in chemical values. In these embodiments, the administration of the composition results in an acceptable change in abnormal coagulation results defined by clinically relevant abnormal bleeding. In these embodiments, the administration of the composition results in an acceptable change in urinalysis. In these embodiments, the administration of the composition results in an acceptable change in the level of C-reactive protein. In these embodiments, the administration of the composition results in an acceptable change in the level of complement. In these embodiments, the administration of the composition results in an acceptable change in the level of cytokines.

[0268] In these embodiments, the administration of the composition results in an acceptable change in the level of biosafety indicators, and according to the CTCAE guidelines, the acceptable change does not constitute an adverse event that occurs in treatment of grade 3 or higher. In these embodiments, the administration of the composition results in an acceptable change in the level of biosafety indicators, and the acceptable change does not constitute the occurrence of thrombosis. In these embodiments, the administration of the composition results in an acceptable change in the level of biosafety indicators, and the acceptable change does not constitute the occurrence of bleeding. In these embodiments, the administration of the composition results in an acceptable change in the level of biosafety indicators, and the acceptable change does not constitute the occurrence of disseminated intravascular coagulation. In these embodiments, the administration of the composition results in an acceptable change in the level of biosafety indicators, and the acceptable change does not constitute the occurrence of cytokine release syndrome. In these embodiments, the administration of the composition results in an acceptable change in the level of biosafety indicators, and the acceptable change does not constitute acute liver injury (e.g., after administration of treatment, ALT, AST, total bilirubin or clinically relevant liver injury symptoms / signs of CTCAE>2 grade increase). In these embodiments, the administration of the composition results in an acceptable change in a 12-lead electrocardiogram as determined by a clinician.

[0269] In some embodiments, the method of editing a gene in vivo comprises systemically administering to a human subject a LNP composition comprising an effective amount of mRNA encoding Cas9 and a guide RNA targeting the KLKB1 gene, and the administration results in an acceptable change in anti-Cas9 antibody levels.

[0270] In some embodiments, administration of the LNP composition results in an acceptable change in the pharmacokinetics of lipid A. In some embodiments, administration of the LNP composition results in an acceptable change in the pharmacokinetics of DMG-PEG2k. In some embodiments, administration of the LNP composition results in an acceptable change in the pharmacokinetics of Cas9 mRNA. In some embodiments, administration of the LNP composition results in an acceptable change in the pharmacokinetics of sgRNA.

[0271] 2. Treatment Methods

[0272] Provided herein is a method for treating a human subject by editing the KLKB1 gene in vivo in the liver. In some embodiments, the method for editing the KLKB1 gene in vivo includes systemically administering to a human subject an LNP composition described herein (e.g., mRNA comprising an effective amount of an encoding Cas9 nuclease, such as Spy Cas9; and a guide RNA targeting the KLKB1 gene), and editing the KLKB1 gene in vivo occurs at a site targeted by the guide RNA in the subject's hepatocytes. In certain embodiments, the guide RNA comprises a targeting sequence comprising at least 18 adjacent nucleotides, preferably 20 nucleotides of GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15). In some embodiments, the guide RNA comprises a nucleotide sequence of GGAUUGCGUAUGGGACACAAGUUUUAGAGCUAG AAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 388). In some embodiments, sgRNA is modified. In some embodiments, the sgRNA comprises the modification pattern shown in SEQ ID NO: 391 below, wherein the modified sgRNA comprises the following sequence: mG*mG*mA*UUGCGUAUGGGAC ACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 391), wherein A, C, G, and U indicate RNA nucleosides (2'-OH) adenine, cytosine, guanine, and uridine, respectively; mA, mC, mG, and mU indicate 2'-O-methyl modified adenine, cytosine, guanine, and uridine, respectively; and * indicates a phosphorothioate linkage.

[0273] In some embodiments, provided herein are methods for treating a human subject suffering from HAE, as described herein (e.g., reducing the number of HAE attacks, the number or proportion of patients with breakthrough attacks or no attacks in a given period of time, the frequency of hospitalizations associated with HAE attacks, or the frequency of use of acute therapy associated with HAE attacks). In some embodiments, HAE is Type I. In some embodiments, HAE is Type II.

[0274] In some embodiments, provided herein is a method for treating HAE in a human subject, comprising systemically administering to the human subject a LNP composition described herein (e.g., comprising an effective amount of mRNA encoding a Cas9 nuclease, such as Spy Cas9; and a guide RNA targeting the KLKB1 gene, such as a guide having a targeting sequence of SEQ ID NO: 15 (GGAUUGCGUAUGGGACACAA)), thereby treating HAE, wherein administration of the composition results in a clinically significant improvement in the subject's clinical indicator level as compared to the baseline level of the clinical indicator.

[0275] In some embodiments, provided herein is a method for treating HAE in a human subject, comprising systemically administering to the human subject a LNP composition described herein (e.g., comprising an effective amount of mRNA encoding a Cas9 nuclease, such as Spy Cas9; and a guide RNA targeting a KLKB1 gene, such as a guide having a targeting sequence of SEQ ID NO: 15 (GGAUUGCGUAUGGGACACAA)), thereby treating HAE, wherein the mRNA encoding the Cas9 nuclease and the guide RNA targeting the KLKB1 gene are administered at a combined dose of about 25-150 mg, such as about 25-100 mg.

[0276] In some embodiments, provided herein is a method for treating HAE in a human subject, comprising systemically administering to the human subject a LNP composition described herein (e.g., comprising an effective amount of mRNA encoding a Cas9 nuclease, such as Spy Cas9; and a guide RNA targeting a KLKB1 gene, such as a guide having a targeting sequence of SEQ ID NO: 15 (GGAUUGCGUAUGGGACACAA)), thereby treating HAE, wherein the mRNA encoding the Cas9 nuclease and the guide RNA targeting the KLKB1 gene are administered at a combined dose of about 25-75 mg.

[0277] In some embodiments, provided herein is a method for treating HAE in a human subject, comprising systemically administering to the human subject a LNP composition described herein (e.g., comprising an effective amount of mRNA encoding a Cas9 nuclease, such as Spy Cas9; and a guide RNA targeting a KLKB1 gene, such as a guide having a targeting sequence of SEQ ID NO: 15 (GGAUUGCGUAUGGGACACAA)), thereby treating HAE, wherein the mRNA encoding the Cas9 nuclease and the guide RNA targeting the KLKB1 gene are administered at a combined dose of about 50-75 mg.

[0278] In some embodiments, provided herein is a method for treating HAE in a human subject, comprising systemically administering to the human subject a LNP composition described herein (e.g., comprising an effective amount of mRNA encoding a Cas9 nuclease, such as Spy Cas9; and a guide RNA targeting a gene, such as a guide RNA targeting a KLKB1 gene, such as a guide having a targeting sequence of SEQ ID NO: 15 (GGAUUGCGUAUGGGACACAA)), thereby treating HAE, wherein administration of the composition reduces total plasma kallikrein protein levels or kallikrein activity levels relative to baseline plasma. In some embodiments, the HAE is type I. In some embodiments, the HAE is type II. In some embodiments, the LNP comprises (9Z, 12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadecane-9,12-dienoate. In some embodiments, the LNP comprises a PEG lipid. In the embodiment that LNP comprises PEG lipid, PEG lipid comprises dimyristoylglycerol (DMG). In the embodiment that PEG lipid comprises dimyristoylglycerol (DMG), PEG lipid comprises PEG-2k. In some embodiments, LNP composition has the N / P ratio of about 5-7. In some embodiments, guide RNA and Cas nuclease are present in the ratio within the range of about 5:1-1:5 by weight. In some embodiments, mRNA encodes Cas9 nuclease. In some embodiments, mRNA encodes Streptococcus pyogenes Cas9. In some embodiments, Cas nuclease is codon optimized. In some embodiments, guide RNA comprises at least one modification. In the embodiment that guide RNA comprises at least one modification, guide RNA comprises 2'-O-methyl modified nucleotides or phosphorothioate bonds between nucleotides. In some embodiments, the effective amount of mRNA encoding Cas nuclease and guide RNA targeting KLKB1 gene is the combined dose of about 25-150mg of total RNA. In some embodiments, the effective amount of mRNA encoding Cas nuclease and guide RNA targeting KLKB1 gene is the combined dose of about 25-100mg of total RNA. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is about, for example, a combined dose of 25 mg, 50 mg, 75 mg, 100 mg, 125 mg, or 150 mg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 50-75 mg of total RNA. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 25 mg of total RNA.In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 75 mg of total RNA. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 50 mg of total RNA. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 0.3-2 mg / kg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 0.5-1 mg / kg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 0.3 mg / kg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 0.5 mg / kg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 0.7 mg / kg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 0.9 mg / kg. In some embodiments, the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 1 mg / kg. In some embodiments, the administration of the composition reduces the total plasma kallikrein protein by at least 60%, or by 60%-95%, 60%-90%, 70%-95%, 70%-90% or 80%-95% compared to the baseline total plasma kallikrein protein before administration of the composition. In some embodiments, after administration of the composition, the total plasma kallikrein protein level is less than about 20 μg / mL. In some embodiments, after administration of the composition, the total plasma kallikrein protein level is less than about 15 μg / mL. In some embodiments, after administration of the composition, the total plasma kallikrein protein level is less than about 10 μg / mL.

[0279] In certain embodiments, the methods provided herein are used to reduce the frequency of HAE attacks in a subject relative to the subject's historical attack frequency.

[0280] In certain embodiments, the methods provided herein are used to improve one or more clinical indicators described herein for HAE, such as according to an appropriate quality of life (QoL) questionnaire, such as the MOXIE Angioedema Quality of Life (AE-QoL) questionnaire, or to prevent the recurrence of one or more symptoms.

[0281] In certain embodiments, the methods provided herein are used to reduce the severity of HAE attacks in the subject relative to the severity of the subject's historical attacks. In certain embodiments, the methods provided herein are used to reduce the frequency of attacks with laryngeal edema, which is generally associated with severe overall attack severity, the attack is characterized by significant limitation of activity, and the subject requires assistance.

[0282] In certain embodiments, the methods provided herein are used to reduce the frequency or severity of HAE attacks in a subject relative to the subject's historical frequency or severity of attacks.

[0283] In certain embodiments, the subject has a reduced frequency of hospitalization associated with an HAE attack. In certain embodiments, the subject has a reduced frequency of acute therapy associated with an HAE attack.

[0284] In certain embodiments, due to the severity of the attack, the methods provided herein can be used for the treatment of subjects with rare or infrequent attacks or even after a single attack. In certain embodiments, the methods provided herein are used for subjects with a single attack, wherein the attack includes laryngeal edema, as such edema can be life-threatening.

[0285] In some embodiments, the method of treatment includes systemically administering to a human subject an LNP composition as described herein, e.g., comprising an effective amount of mRNA encoding a Cas9 nuclease and a guide RNA targeting a KLKB1 gene, wherein prior to administering the LNP composition, the subject has an average of at least two HAE attacks per month, e.g., confirmed HAE attacks, when averaged over a three-month (90-day) period. In some embodiments, prior to administering the LNP composition, the subject has an average of at least one HAE attack per month, e.g., confirmed HAE attacks, when averaged over a three-month (90-day) period.

[0286] Despite HAE prevention, HAE breakthrough attacks are common, especially for those subjects with more severe conditions. In some embodiments, provided herein is a method for treating a subject receiving HAE prevention, including a method for treating a subject having a breakthrough attack when receiving HAE prevention. In some embodiments, the method includes systemically administering to a human subject an LNP composition as described herein, for example, an mRNA encoding an effective amount of a Cas9 nuclease and a guide RNA targeting the KLKB1 gene, wherein the subject has been or is currently being treated with different HAE therapies, such as non-acute HAE therapies, i.e., HAE prevention. In some embodiments, prior to administering the LNP composition, during HAE prevention, when averaged over a three-month (90-day) period, the subject has an average of at least two HAE attacks per month, such as confirmed HAE attacks. In some embodiments, prior to administering the LNP composition, during HAE prevention, when averaged over a three-month (90-day) period, the subject has an average of at least one HAE attack per month, such as confirmed HAE attacks.

[0287] In some embodiments, the subject is intolerant to long-term treatment with at least one type of HAE prevention, for example, unsatisfactory treatment with continued non-acute treatment or use of chronic treatment (e.g., events occurring during treatment after needle fatigue). In certain embodiments, the subject is intolerant to long-term treatment with at least one type of HAE prevention due to clinically unacceptable adverse events (e.g., grade 3 or higher adverse events). In certain embodiments, the adverse events determined by the subject are unacceptable, although clinically acceptable, such as weight gain, acne, so that the subject chooses to stop using a specific agent for HAE prevention. In certain embodiments, the subject is intolerant to long-term treatment with at least one type of HAE prevention because the subject, such as pregnant, preparing to become pregnant or lactating women, children, is prohibited from the treatment. In certain embodiments, the subject is intolerant to long-term treatment with at least one type of HAE prevention because the subject is prohibited from the treatment due to existing or previous comorbidities, such as certain types of liver disease, breast cancer, prostate cancer, hepatocellular carcinoma, and certain cardiovascular risk factors. In certain embodiments, HAE prevention is prevention using attenuated androgens (e.g., danazol, oxandrolone, stanozolol).

[0288] It should be understood that subjects who are intolerant to treatment (e.g., events that occur during treatment following continued non-acute treatment or unsatisfactory treatment with chronic treatment (e.g., needle fatigue)), such as long-term treatment with certain agents useful for HAE prevention, may tolerate the agents used for acute therapy, i.e., short-term or intermittent treatment, rather than long-term treatment.

[0289] In some embodiments, the method of editing the KLKB1 gene in vivo includes systemically administering to a human subject an LNP composition as described herein, e.g., comprising an effective amount of mRNA encoding a Cas9 nuclease and a guide RNA targeting the KLKB1 gene, and resulting in clinically significant improvements in clinical index levels (e.g., frequency of attacks, severity of attacks). In certain embodiments, the frequency of attacks is measured while the subject maintains HAE prevention. In certain embodiments, the frequency of attacks is measured after HAE prevention is stopped for the subject. In certain embodiments, the severity of attacks is measured while the subject maintains HAE prevention. In certain embodiments, the severity of attacks is measured after HAE prevention is stopped for the subject.

[0290] In certain embodiments, the confirmed HAE attack frequency is reduced by at least 60%, 70%, preferably at least 80%, 85%, 90% or 95% per month when averaged over a period of time (three months (90 days) period) compared to an appropriate historical period (e.g., confirmed HAE attack); at least 6 months after administration of the LNP composition, optionally at least one year after administration of the LNP composition. In certain embodiments, the period for determining the frequency of attacks after administration of the LNP composition begins immediately (e.g., within one day) after administration of the LNP composition. In certain embodiments, the period for determining the frequency of attacks after administration of the LNP composition begins 4 weeks after administration of the LNP composition, i.e., day 29.

[0291] In some embodiments, the method of editing the KLKB1 gene in vivo comprises systemically administering to a human subject an LNP composition as described herein, e.g., comprising an effective amount of mRNA encoding a Cas9 nuclease and a guide RNA targeting a KLKB1 gene, and resulting in a quality of life indicator assessment, e.g., a level of MOXIE angioedema quality of life (AE-QoL) assessment of a certain aspect significantly improved. In some embodiments, the method of editing the KLKB1 gene in vivo comprises systemically administering to a human subject an LNP composition as described herein, e.g., comprising an effective amount of mRNA encoding a Cas9 nuclease and a guide RNA targeting a KLKB1 gene, and resulting in a quality of life indicator assessment, e.g., a level of MOXIE angioedema quality of life (AE-QoL) assessment significantly improved.

[0292] Additional clinical efficacy indicators, including indicators for evaluating the efficacy of HAE treatment, are known in the art. Similarly, the levels or changes of clinical efficacy indicators indicating improvement of HAE are known in the art and can be assessed by conventional methods, such as by a clinician or laboratory.

[0293] In some embodiments, the method of treating HAE comprises administering a LNP composition as described herein and measuring a clinical efficacy indicator after administering the LNP composition. In some embodiments, the method of treating HAE comprises administering a LNP composition as described herein and measuring a clinical efficacy indicator before and after administering the LNP composition, thereby allowing comparison of clinical efficacy indicator levels before and after treatment with the LNP composition.

[0294] For example, plasma kallikrein levels (e.g., total plasma kallikrein protein levels) are clinical efficacy indicators for HAE. In some embodiments, the method for treating HAE includes administering the LNP compositions described herein and reducing the kallikrein levels of the subject, such as total plasma kallikrein protein levels. In some embodiments, the method for treating HAE includes administering the LNP compositions described herein and reducing the total plasma kallikrein protein levels of the subject compared to a baseline (e.g., before treatment), at least after treatment (e.g., 28 days or about 56 days after administering the LNP compositions) to reduce the total plasma kallikrein protein levels of the subject. In some embodiments, the method for treating HAE described herein produces a reduction of at least 60% in total plasma kallikrein protein levels compared to a baseline after treatment (e.g., at least 28 days or about 56 days after administering the LNP compositions). In some embodiments, the methods of treating HAE described herein produce a 60%-95%, 60%-90%, 70%-95%, 70%-90%, or 80%-95% reduction in kallikrein levels (e.g., total plasma kallikrein protein levels) compared to baseline after treatment (e.g., at least 28 days or about 56 days after administration of the LNP composition).

[0295] In other embodiments, administration of the LNP composition reduces the total plasma kallikrein protein level of the subject to less than about 20 μg / mL. In some embodiments, administration of the LNP composition reduces the total plasma kallikrein protein level to less than about 15 μg / mL. In some embodiments, administration of the LNP composition reduces the total plasma kallikrein protein level to less than about 10 μg / mL. In certain embodiments, the levels are measured at least 28 days (e.g., about 56 days) after treatment.

[0296] a. Subject inclusion criteria

[0297] In some embodiments, a subject with HAE (HAE type I or HAE type II) to whom an LNP composition described herein (e.g., comprising mRNA encoding a Cas9 nuclease, e.g., Spy Cas9; and a guide RNA targeting a KLKB1 gene, e.g., a guide RNA targeting the KLKB1 gene) is administered is evaluated according to one or more of the following subject inclusion criteria.

[0298] i. HAE subject inclusion criteria

[0299] In some embodiments, the human subject has been or is diagnosed with HAE before treatment. In some embodiments, the human subject is diagnosed with HAE based on genetic testing. In some embodiments, the human subject is diagnosed with HAE based on the assessment of functional C1-INH levels, C1-INH antigen levels and C4 levels. In addition, the subject must have a confirmed HAE attack. During the 3 months (90 days) before the start of screening, the subjects of Phase 1 must have at least 3 attacks of historical HAE confirmed and recorded by the researchers. Subjects in the Phase 1 part of the trial can use certain types of prevention during the observation period (i.e., 3 months (90 days) after the start of screening), and various exclusions are discussed below. Subjects in Phase 2 must have at least 3 attacks of historical HAE during the past 3 months (90 days) confirmed and recorded by the researchers to enter the run-in period, and must have at least 2 attacks of historical HAE during the 8-week (56 days) run-in period confirmed and recorded by the researchers to be eligible for enrollment and random grouping. In the Phase 2 portion of the study, subjects must agree to refrain from the use of preventive therapy from the beginning of the 8-week run-in period through the end of the 16-week initial observation period, and the investigators must confirm that this is medically appropriate and does not place the subject at an undue safety risk. Exclusions for other preventive agents are provided below.

[0300] In phase 1 and phase 2 trials, subjects must have access to and be able to use ≥ 1 acute medication to treat angioedema attacks.

[0301] In some embodiments, at the time of administration, the age of the human subject is at least 18 years old. In some embodiments, the human subject is diagnosed with HAE with an attack frequency with or without prevention, as provided above. In some embodiments, the human subject suffers from HAE, type 1. In some embodiments, the human subject suffers from HAE, type II. In some embodiments, at the time of screening, the aspartate aminotransferase (AST) level of the human subject is ≤ the upper limit of normal (ULN) range. In some embodiments, at the time of screening, the alanine aminotransferase (ALT) level of the human subject is ≤ the upper limit of normal (ULN) range. In some embodiments, at the time of screening, the total bilirubin level of the human subject is ≤ the upper limit of normal (ULN) range, wherein the total bilirubin of the subject with a history of Gilbert's Syndrome is ≤2×ULN at the time of the screening evaluation and is allowed to enter the trial. In some embodiments, at the time of screening, the aPTT, international normalized ratio (INR), fibrinogen and d-dimer levels of the human subject are within the reference range or the principal investigator (PI) determines that there is no clinical significance. In some embodiments, the estimated glomerular filtration rate (GFR) of the human subject at screening is >45 mL / min / 1.73 m^2 (e.g., as measured by the Modification of Diet in Renal Disease equation). In some embodiments, the platelet count of the human subject at screening is ≥100,000 cells / mm3. Although body weight is not specified as an inclusion criterion, historically, the average weight of subjects in clinical trials for the treatment of HAE has been about 80 kg. This exemplary body weight can be used for approximate dose conversion between fixed dosing and weight-based dosing.

[0302] In some embodiments, the human subjects meet all of the above laboratory and other criteria during screening at the relevant stage of the study.In some embodiments, the human subjects are limited to 1 alcoholic beverage per day during screening and within 28 days after treatment with the compositions described herein.

[0303] In some embodiments, human subjects are male or female subjects aged 18 to 90 years old (inclusive) when signing informed consent. In some embodiments, high follicle stimulating hormone (FSH) levels in the postmenopausal range can be used to confirm the postmenopausal status of women who do not use hormonal contraception or hormone replacement therapy. In some embodiments, a single FSH measurement is insufficient in the absence of 12 months of amenorrhea). In some embodiments, at least 1 month before screening, female subjects undergo surgical sterilization (such as hysterectomy, bilateral salpingectomy and bilateral oophorectomy). In some embodiments, male subjects with fertility potential or pregnant partners agree to use condoms within 84 days before screening and after the study drug is administered. In some embodiments, male subjects agree not to donate sperm 84 days after the study drug is administered. If sperm donation is prohibited based on guidelines for a specific country, the time frame may be extended to more than 84 days.

[0304] In some embodiments, a human subject is assessed for risk of transmission or infection with SARS-CoV-2 and is determined to be eligible for elective procedures in a healthcare setting (e.g., documentation of completion of a vaccination series, recent negative PCR test, or no longer requiring such testing, etc.).

[0305] In some embodiments, the human subject agrees not to participate in another intervention study for the duration of the trial.

[0306] b. Subject exclusion criteria

[0307] In some embodiments, a subject with HAE (HAE Type I or HAE Type II) to whom an LNP composition described herein (e.g., comprising mRNA encoding a Cas9 nuclease, e.g., Spy Cas9; and a guide RNA targeting a KLKB1 gene) is administered is evaluated according to one or more of the following subject exclusion criteria.

[0308] i. HAE subject exclusion criteria

[0309] In some embodiments, the human subject meets the following criteria:

[0310] In the Phase 2 studies, subjects had not used long-term prophylaxis for HAE within 5 half-lives prior to the start of screening; as provided in the table below, the list of prophylactic agents, half-lives, and recommended washout periods.

[0311] Table 1: HAE prevention products and estimated washout durations

[0312]

[0313] In certain embodiments, prior to the start of the Phase 2 lead-in period, the subject has not used C1-INH for HAE within 5 half-lives of the dose; i.e., after using rabbit purified C1-INH (ruconest), a 24-hour washout is required prior to starting the lead-in period, and after using human plasma purified C1-INH (berinert), a 4-day washout is required prior to starting the lead-in period. Exceptions occur during the lead-in period, and C1-INH can be used to treat acute HAE attacks.

[0314] In certain embodiments, the subject is not concurrently diagnosed with any other type of recurrent angioedema, including acquired or idiopathic angioedema.

[0315] In some embodiments, the human subject does not have hypersensitivity to any lipid nanoparticle (LNP) component, or has previously received LNP and experienced any treatment-related laboratory abnormality or adverse event (e.g., ALT or AST>3×ULN if baseline is normal, or ALT or AST>3×baseline if baseline is above normal after receiving a product containing LNP, INR, aPTT, or d-dimer>1.5×ULN if baseline is normal, or INR, aPTT, or d-dimer>1.5×baseline if baseline is above normal after receiving a product containing LNP, LNP treatment-related adverse event classified as CTCAE grade 3 or higher, infusion-related reaction (IRR) to a product containing LNP, requiring treatment or discontinuation of infusion).

[0316] In certain embodiments, the subject was not exposed to angiotensin converting enzyme (ACE) inhibitors or any systemically absorbed estrogen-containing drugs within 90 days prior to the administration of the study drug. In certain embodiments, the subject was not using antithrombotic therapy other than aspirin (e.g., warfarin, dabigatran, apixaban) within 14 days prior to the administration of the study drug.

[0317] In certain embodiments, the subject does not have a history of thrombosis, or the gene test of factor VLeiden or prothrombin 20210 is not positive. In some embodiments, the human subject does not have a history of cirrhosis. In some embodiments, the human subject has no known or suspected systemic viral, parasitic or fungal infection, or has received antibiotics for bacterial infection. In some embodiments, the human subject does not have a history of hepatitis B or hepatitis C infection or hepatitis B surface antigen (HBsAg) or hepatitis C virus antibody (HCV Ab) test is positive. In some embodiments, the human subject does not have a history of positive human immunodeficiency virus (HIV) status. In some embodiments, the human subject has not undergone liver, heart or other solid organ transplantation or bone marrow transplantation or expected transplantation within 1 year of administration. In some embodiments, the human subject does not have a history of alcoholism or drug abuse within 3 years before screening. In some embodiments, the human subject is not a woman and does not have fertility potential or is breastfeeding. In some embodiments, the human subject does not have a positive severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) polymerase chain reaction (PCR) test within 7 days of administration.

[0318] The study protocol was amended to include females of childbearing potential, who were initially excluded out of an abundance of caution because a nonclinical study investigating the potential for oocyte editing was ongoing at the time the study began. While the study was ongoing, a definitive GLP breeding study of transgenic mice containing the human KLKB1 gene was completed. This study revealed no evidence of germline transmission of KLKB1 editing, suggesting that the overall benefit / risk assessment for females of childbearing potential is comparable to that for the overall patient population. The benefit / risk assessment has been updated to reflect this, and additional changes related to the inclusion of females of childbearing potential have been added, including pregnancy testing, contraception, and pregnancy reporting requirements.

[0319] Evaluation of these and other exclusion criteria is known in the art.

[0320] In certain embodiments, the subject meets all of the above exclusion criteria.

[0321] 3. Infusion prevention

[0322] In some embodiments, the methods described herein, for example, including administering to a subject an LNP composition described herein (e.g., comprising mRNA encoding a Cas nuclease (e.g., Cas9); and a guide RNA targeting a gene, such as a guide RNA targeting the KLKB1 gene), further comprises infusion prevention. In some embodiments, infusion prevention is administered to the subject prior to administering the gene editing composition. In some embodiments, the infusion prevention regimen administered to the subject prior to administering the LNP composition includes administering intravenous steroids; intravenous H1 blockers or oral H1 blockers; and intravenous or oral H2 blockers. The intravenous steroid can be dexamethasone, for example, 10 mg. The intravenous H1 blocker can be diphenhydramine, for example, 50 mg. The oral H1 blocker can be cetirizine, for example, 10 mg. The intravenous or oral H2 blocker can be famotidine, for example, 20 mg.

[0323] Clinical trial evaluation protocols and standards

[0324] Exemplary kits and methods used in clinical trials are provided below.For the assessment of standard laboratory values ​​(eg, ALT, AST), no methods are provided, as such methods are routine and well established in the art.

[0325] Plasma kallikrein protein and activity levels

[0326] Kits for detecting total plasma kallikrein (prekallikrein + kallikrein) and for the level of kallikrein activity are known in the art, and methods for validating kits and assays are known in the art.

[0327] The Prekallikrein and Human Kallikrein ELISA Kit (Abcam, catalog number ab171015) provides instructions for the use of the kit for quantitative measurement of human Prekallikrein (Fletcher Factor) concentrations in plasma, serum, saliva, milk, cerebrospinal fluid, and cell culture and cell lysates.

[0328] The kit provides a pre-coated 96-well plate and blocked pre-kallikrein specific antibody for the method. The standard or test sample provided by the kit is added to the well, and then the pre-kallikrein specific biotinylated detection antibody is added, and then washed with wash buffer. Streptavidin-peroxidase conjugate is added and the unbound conjugate is washed away with wash buffer. TMB is then used to visualize the streptavidin-peroxidase enzymatic reaction. TMB is catalyzed by streptavidin-peroxidase to produce a blue product, which turns yellow after adding an acidic stop solution. The density of the yellow coloration is proportional to the amount of pre-kallikrein and kallikrein captured in the plate, and the assay is reported as about 0.77ng / ml. Protein determination is a quantitative method with a reference standard curve and reports concentration. The validation results prove that the assay is specific, accurate, precise, and sensitive to its intended use. Belostat in the sample does not interfere with the detection. The method does not detect tissue kallikrein.

[0329] The Rh110 Plasma Kallikrein Activity Assay Kit * Fluorescence Method * (AnaSpec, catalog number AS-72255) provides instructions for using the kit for detecting plasma kallikrein activity using a 96-well plate format. The Rh110 plasma kallikrein activity assay kit uses a fluorescent peptide substrate for the detection of enzyme activity. This substrate contains a rhodamine 110 fluorophore (Rh110). Plasma kallikrein cleaves this Rh110 substrate and causes the release of bright green fluorescence, and can be detected at excitation / emission = 496nm / 520nm. The longer wavelength spectrum and higher extinction coefficient of Rh110 provide higher sensitivity and less interference from other reaction components. It is reported that the assay can detect activated plasma kallikrein as low as 1ng / mL. It is reported that the kit can be used to detect enzyme activity in purified enzyme preparations, biological samples, and can also be applied to compound screening. Activity determination is a qualitative method and is directly reported as % inhibition based on the slope (signal vs. time, as a kinetic reading). In order to be used for the clinical trial method provided herein, according to the kit instructions, the sample is first activated to convert all prekallikrein to kallikrein, and then the kallikrein activity is measured. This fluorescence method is a qualitative determination based on the measurement of enzymatic reaction kinetics (fluorescent signal over time) (without reference to a standard curve). The assay slope (signal over time) within the linear range was determined, with post-dose activity (slope) reported as relative signal compared to the pre-dose slope.

[0330] For total kallikrein protein levels and kallikrein activity levels, the percentage inhibition at the post-dose time point was calculated for each patient based on their pre-dose levels (average of 3 pre-dose samples, 2 from the screening phase and 1 from the dosing day before the dose). Pre-dose samples were tested only once and reported as individual concentrations (protein assays) or % inhibition based on the slope after dose versus before dose (activity assays). The positive control was from commercial kallikrein protein purified from pooled human plasma.

[0331] Normal human plasma (multiple pools) was used to confirm the detection of protein and activity. No patient samples were used for method development and validation. Normal plasma samples were obtained from the CRL employee donation program and samples were processed using the same procedures as in the clinical trial.

[0332] Hereditary Angioedema (HAE) Attack Data Collection and Validation

[0333] The following guidance was provided to investigators and site teams regarding the documentation and review of episode histories, as well as the collection, review, and evaluation of events considered potential angioedema episodes. The guidance is provided to help:

[0334] Provide a definition of hereditary angioedema (HAE) attacks

[0335] Define best practices for reviewing potential episodes

[0336] Provide methods to determine whether potential events reported by subjects are true HAE episodes

[0337] HAE attacks

[0338] To be considered an HAE episode, the signs or symptoms reported as part of the event must include at least 1 of the following:

[0339] Peripheral angioedema: Swelling of the skin involving the extremities, face, neck, trunk, or genitourinary system

[0340] Abdominal angioedema: abdominal pain with or without bloating, nausea, vomiting, or diarrhea

[0341] Laryngeal angioedema: wheezing, difficulty breathing, difficulty speaking, difficulty swallowing, tightness in the throat, or swelling of the tongue, palate, uvula, or larynx

[0342] Despite the presence of these signs or symptoms, the event may not clinically represent an HAE episode if:

[0343] There is a diagnosis that refutes the event described

[0344] The duration of the reported event is far beyond the typical time course of seizures for the subject

[0345] There is an alternative cause

[0346] To be considered a unique HAE episode from a previously confirmed episode, the signs or symptoms must have begun more than 24 hours after the signs or symptoms of the previous episode had resolved.

[0347] Prodromal symptoms themselves are not considered an attack. Reports of an acute HAE attack using treatments designed to target a potential attack do not, by themselves, confirm an HAE attack.

[0348] Subjects’ history of HAE attacks

[0349] According to the study protocol, each subject's history of HAE episodes is recorded at the study site and entered into the eCRF. Information should include:

[0350] Typical frequency of attacks

[0351] Typical onset location and symptoms

[0352] Whether the subject has experienced signs and symptoms of laryngeal attacks

[0353] Whether the subject experiences prodromal signs and symptoms

[0354] Typical severity of attacks

[0355] Typical duration of episodes

[0356] Acute attack therapy use

[0357] Any history of preventive therapy

[0358] Number of episodes in the previous 3 months (90 days)

[0359] Complete history of HAE-related medication use within the past 90 days

[0360] Subject training diary and record of potential HAE episodes

[0361] During the screening period, site personnel will train subjects (and caregivers) on identifying seizure symptoms, and will ask subjects (and caregivers) to complete and report seizures in the diary. Site personnel will assess subject compliance with reporting requirements throughout the study and retrain subjects if necessary to maintain compliance with the protocol, as per the trial protocol.

[0362] Information on potential HAE episodes as reported by the subject

[0363] Subjects (or caregivers) should record the following information in their diary when reporting a potential HAE episode (or as soon as possible) or when discussing it with study personnel:

[0364] Date and time when signs or symptoms of the attack were first experienced

[0365] ·Description of signs and symptoms experienced, including location

[0366] Any medicines used to treat seizures

[0367] Severity of the attack

[0368] Whether assistance, medical intervention, outpatient visits, emergency room visits, or inpatient hospitalizations were required

[0369] The date and time the subject no longer experienced symptoms

[0370] Subjects did not have to wait for their symptoms to fully resolve before reporting potential HAE episodes in their diaries.

[0371] Sites may obtain information about persistent symptoms during scheduled study visits or scheduled telehealth visits or telephone contacts.

[0372] Subjects should not stop or delay any treatment they normally receive to manage their seizures in order to enter potential seizure information in the diary.

[0373] Review of potential HAE episode information by site personnel and investigators

[0374] As detailed in the trial protocol, site personnel reviewed diary information to ensure overall diary compliance. In addition, during scheduled study visits or scheduled telemedicine visits or telephone contacts, site personnel reviewed diary information with the subject or caregiver and collected additional information as needed to further document any potential HAE episodes. This additional information was considered study source documentation.

[0375] As detailed in the study protocol, the investigator or designee reviews the episode information and evaluates whether the event represents a confirmed HAE episode. If necessary, the investigator or designee may also contact the subject or caregiver to review and collect additional information for evaluation. This additional information is considered a study source document.

[0376] Reporting multiple episodes

[0377] If subjects experience signs and symptoms that they believe to be part of more than 1 unique episode, they may report such signs and symptoms as multiple episodes in the electronic diary. Based on the review of the reported potential HAE episodes by the Investigator or designee, a determination should be made as to whether separate events reported are confirmed as separate episodes.

[0378] Site contact with subjects or caregivers

[0379] Site personnel establish suggested methods and times for contacting subjects or caregivers based on their schedule of activities. At Screening and periodically throughout the duration of the study (104 weeks), sites will confirm the primary contact and, whenever possible, the contact information of alternate persons (e.g., email, cell phone, home phone).

[0380] Review of diaries and potential HAE episode information by site personnel and study staff

[0381] Complete and accurate documentation of each reported potential HAE episode facilitates the clinical evaluation of the episode by the investigator or designee. Site personnel should review diary information and ensure that the following is included in the diary or that site personnel also document and enter the following into the eCRF:

[0382] Date and time of contact with the subject

[0383] Date and time the subject first experienced signs and symptoms

[0384] Overall potential severity of the attack

[0385] Whether the potential attack involves the larynx

[0386] Medications used to treat potential attacks, including acute therapies for HAE

[0387] · Required assistance, medical intervention, outpatient visits, emergency room visits, or inpatient hospitalizations

[0388] The date and time the subject no longer experiences any symptoms of a potential attack

[0389] Whether a potential episode is considered a confirmed episode

[0390] If a potential attack is not confirmed, the reasons are as follows:

[0391] Whether the potential episode is considered an adverse event

[0392] All investigator assessments of potential and confirmed episodes will be recorded at the site and will be entered into the eCRF by site personnel.

[0393] Severity of seizures

[0394] The overall severity of a subject's potential HAE episode will be determined by the subject and site using the following guidelines:

[0395] Mild: brief or mild discomfort

[0396] Moderate: Mild to moderate limitation of activity - some assistance required

[0397] Severe: marked limitation of movement, requiring assistance

[0398] HAE episodes and adverse event reporting

[0399] As detailed in the study protocol, site personnel reviewed diary information to ensure overall diary compliance. Additionally, during scheduled study visits or scheduled telemedicine visits or telephone contacts, site personnel reviewed diary information with the subject or caregiver and collected additional information as needed to further document any potential HAE episodes. This additional information was considered study source documentation.

[0400] At each contact and scheduled study visit, site personnel will ask subjects whether they have had any episodes, adverse events, or changes in their medications.

[0401] Potential HAE episodes will be recorded in the diary and eCRF and will be evaluated by the Investigator or designee. If, after review of the potential HAE episode, the Investigator or designee makes an alternative diagnosis and the event is deemed not to be an HAE episode, the event should also be entered as an adverse event (AE) by the site in the eCRF. All AEs, regardless of severity, severity, or causal relationship to study drug, are recorded on the AE page of the eCRF. Additional AE reporting details are provided in the study protocol.

[0402] If the investigator deems a potential HAE episode as meeting any of the following criteria, the potential HAE episode is recorded as an episode in the diary and an eCRF and AE eCRF or SAE Case Report Form (CRF) must also be completed:

[0403] HAE episodes reported by the investigator and considered clinically more severe than those reported by the subject as part of their HAE episode history

[0404] The onset location is new or has never been experienced by the HAE subject based on the subject's history of onset

[0405] HAE episodes reported by the investigator and considered clinically longer in duration than those reported by the subject as part of their HAE episode history

[0406] The HAE episode required different or significantly more medical or clinical interventions than those reported by the subject as part of their HAE episode history before the episode resolved

[0407] HAE episode leading to hospitalization

[0408] Any other clinical assessment or judgment by the principal investigator (PI)

[0409] HAE episodes considered to be different and clinically significant from those reported by the subject as part of their HAE episode history

[0410] Angioedema Quality of life

[0411] The MOXIE angioedema quality of life (AE-QoL) questionnaire is a patient-reported outcome measure developed to assess QoL impairment in subjects with recurrent angioedema, regardless of their underlying cause (Weller et al., 2012). To develop the assessment, 110 angioedema patients participated in the validation of the AE-QoL. It was found that the AE-QoL had a four-dimensional structure and a valid total score. The questionnaire included four areas (function, fatigue / emotion, fear / shame, food) and contained 17 questions. Test-retesting has demonstrated good reliability for the total score and domain scores of the tool. Gender and the patient's self-rated disease activity were found to be predictors of the AE-QoL total score. This is a brief assessment that can be used in clinical research and routine patient care. The recall period for the assessment tool is 4 weeks. The assessment can be performed at desired intervals and takes less than 5 minutes to complete. It can be used to help better characterize affected patients, assist in making treatment decisions, and monitor the burden of treatment, which can be huge in HAE. In the trial provided herein, assessments were used for the initial observation period and a single post-baseline time point (week 16) within the initial observation period. Other assessments were later added, particularly the EuroQol Group EQ-5D-5L, a brief, multi-attribute, universal health status measure consisting of 5 questions; and the Work Productivity and Activity Impairment Questionnaire: General Health (WPAI:GH) assessment.

[0412] Example

[0413] Example 1. LNP particle-based composition for KLKB1 gene editing

[0414] In vitro transcription of nuclease mRNA (“IVT”)

[0415] Capped and polyadenylated mRNA containing N1-methyl pseudo-UTP was generated by in vitro transcription using conventional methods. Briefly, linearized plasmid DNA template and T7 RNA polymerase. Plasmid DNA containing T7 promoter, transcription sequence and polyadenylation region was linearized with XbaI according to the manufacturer's protocol. XbaI was inactivated by heating. The linearized plasmid was purified from enzymes and buffer salts. The IVT reaction to produce modified mRNA was performed by incubation at 37°C under the following conditions: 50 ng / μL linearized plasmid; 2-5 mM each of GTP, ATP, CTP and N1-methyl pseudo-UTP (Trilink); 10-25 mM ARCA (Trilink); 5 U / μL T7 RNA polymerase; 1 U / μL mouse RNase inhibitor (NEB); 0.004 U / μL inorganic E. coli pyrophosphatase (NEB); and 1x reaction buffer. TURBO DNase (ThermoFisher) was added to a final concentration of 0.01 U / μL, and the reaction was incubated at 37°C to remove the DNA template.

[0416] According to the manufacturer's scheme, use MegaClear transcription removal kit (ThermoFisher) or RNeasyMaxi kit (Qiagen) to purify mRNA. Alternatively, by precipitation scheme purification mRNA, in some cases, followed by purification based on HPLC. In brief, after DNA enzyme digestion, LiCl precipitation, ammonium acetate precipitation and sodium acetate precipitation are used to purify mRNA. For the mRNA purified by HPLC, after LiCl precipitation and reconstruction, by RP-IP HPLC purification mRNA (see, for example, Kariko et al. Nucleic Acids Research, 2011, Vol. 39, Phase 21e142). The fractions selected for collection are merged, and desalted by sodium acetate / ethanol precipitation as described above. In other alternative methods, mRNA is purified by LiCl precipitation method, then further purified by tangential flow filtration. RNA concentration is determined by measuring the absorbance (Nanodrop) at 260nm, and transcripts are analyzed by capillary electrophoresis by Bioanlayzer (Agilent).

[0417] Streptococcus pyogenes ("Spy") Cas9 mRNA was generated from plasmid DNA encoding an open reading frame according to the sequence listing. When the sequences cited in this paragraph are referred to below as corresponding to RNA, it should be understood that T should be replaced by U (which can be a modified nucleoside as described above). The messenger RNA used in this example contains a 5' cap and a 3' polyadenylation sequence, for example up to 100nt, and is identified in Table 3. The guide RNA is chemically synthesized by methods known in the art.

[0418] Preparation of LNP formulations containing sgRNA and Cas9 mRNA

[0419] Typically, lipid nanoparticle components were dissolved in 100% ethanol at various molar ratios. RNA cargo (eg, Cas9 mRNA and sgRNA) was dissolved in 25 mM citrate, 100 mM NaCl (pH 5.0) to a concentration of approximately 0.45 mg / mL of RNA cargo. The LNPs used contained ionizable lipid A ((9Z,12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadec-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z,12Z)-octadec-9,12-dienoate), also referred to herein as lipid A, cholesterol, DSPC, and PEG2k-DMG, respectively, in a molar ratio of 50:38:9:3. The LNPs were formulated with a molar ratio of lipid amine to RNA phosphate (N:P) of about 6 and a gRNA to mRNA ratio of 1:2 by weight. The LNPs used contained Cas9 mRNA and sgRNA.

[0420] LNPs were prepared using a cross-flow technique that utilizes an impingement jet mixing of lipid-containing ethanol with two volumes of RNA solution and one volume of water. The lipid-containing ethanol was mixed with the two volumes of RNA solution through a cross mixer. A fourth stream of water was mixed with the outlet water stream of the cross tube through an inline tee (see WO2016010840). Figure 2). The LNPs were kept at room temperature for 1 hour and further diluted with water (about 1: 1 volume / volume). The diluted LNPs were concentrated using tangential flow filtration on a flat filter cartridge (Sartorius, 100kD MWCO), and then the buffer was exchanged to 50mM Tris, 45mM NaCl, 5% (weight / volume) sucrose (pH 7.5) (TSS) using a PD-10 desalting column (GE). The resulting mixture was then filtered using a 0.2 μm sterile filter. The final LNPs were characterized to determine encapsulation efficiency, polydispersity index, and average particle size. The final LNPs were stored at 4 ° C or -80 ° C until further use. The total RNA content in the LNPs was determined using reverse phase ion pair high performance liquid chromatography (IP-RP-HPLC). Before performing IP-RP chromatography using UV detection, the lipid nanoparticles were deconjugated to release RNA. The concentration of each RNA was calculated by comparing the absorbance signal from the sgRNA or cas9 mRNA peak with the corresponding standard curve generated using the reference standard for release testing. The sum of sgRNA and cas9 mRNA concentrations is reported as total RNA concentration in mg / mL.

[0421] Next Generation Sequencing (“NGS”) and Analysis of Editing Efficiency

[0422] Genomic DNA is extracted from cells or tissues according to methods known in the art, for example, using QuickExtractDNA extraction solution (Epicentre, Cat.QE09050) or Quick Extract (Lucigen, Cat.SS000035-D2). In order to quantitatively determine the editing efficiency at the target position in the genome, sequencing is utilized to identify the presence of insertions and deletions introduced by gene editing. Design PCR primers around the target site in a gene of interest (e.g., KLKB1), and amplify the genomic region of interest. Primer sequence design is performed according to the standards in the art.

[0423] Additional PCR was performed according to the manufacturer's protocol (Illumina) to add chemicals for sequencing. The amplicons were sequenced on an Illumina MiSeq instrument. After eliminating those reads with low quality scores, the reads were aligned to a reference genome (e.g., hg38). The resulting file containing the reads was plotted onto a reference genome (BAM file), with reads overlapping the target region of interest selected, and the number of wild-type reads versus the number of reads containing insertions or deletions ("indels") calculated.

[0424] The editing percentage (eg, "editing efficiency" or "editing percentage") is defined as the ratio of the total number of sequence reads with insertions or deletions ("indels") to the total number of sequence reads including wild type.

[0425] Example 2. Selection of sgRNA targeting the KLKB1 gene (including off-target analysis)

[0426] After applying a comprehensive off-target characterization workflow combining in silico and empirical methods, an sgRNA targeting the KLKB1 gene sequence GGAUUGCGUAUGGGACACAA (SEQ ID No: 15; human genome build hg38 within chromosome locus chr4: 186251793-186251812) was selected for efficient knockout and specificity. To select for a high therapeutic index (ratio of on-target editing to off-target editing), whole genome assays and targeted sequencing were performed for guide RNA G012267 in NTLA-2002 using the empirical off-target discovery assay SITE-Seq to identify and validate candidate sgRNA off-target sites.

[0427] Biochemical, empirical CRISPR / Cas9 off-target discovery assay SITE-Seq is a cell-free biochemical method that is one of the most sensitive methods for the discovery of potential off-target editing and relies on isolated gDNA (Cameron 2017). SITE-Seq was performed on human gDNA derived from peripheral blood mononuclear cells from 2 unique male blood donors. Each gDNA sample was digested in vitro with assembled RNPs of Cas9 and the human KLKB1 sgRNA (hu-G012267) used in NTLA-2002 to induce DNA cleavage at the on-target site and potential off-target sites with homology to the sgRNA sequence. After gDNA digestion, the free gDNA fragment ends were ligated with adapters to facilitate edited fragment enrichment and NGS library construction. The NGS libraries were sequenced and the reads were analyzed to determine the genomic coordinates of the free DNA ends by bioinformatic analysis. The locations where the reads accumulated in the human genome were then annotated as potential off-target sites.

[0428] SITE-Seq discovered 61 potential off-target sites for the KLKB1 targeting guide hu-G012267. Potential off-target editing sites identified by SITE-Seq (Cameron 2017) for hu-G012267 were used as an orthogonal discovery technique to complement the computational off-target editing discovery method Cas-OFFinder (Bae 2014). SITE-Seq discovered 61 off-target sites, and Cas-OFFinder nominated 47 off-target sites. As an extra precaution, potential off-target sites discovered by SITE-Seq in 2 additional experiments using alternative hu-G012267 sgRNA synthesis chemistry were also included in the off-target editing validation, which increased the number of potential off-target sites from 108 (47 Cas-OFFinder plus 61 SITE-Seq sites) to 196.

[0429] Subsequently, PHH treated with NTLA-2002 at supersaturating doses were characterized by targeted amplicon sequencing (rhAmpSeq or AMP-Seq) for off-target insertion or deletion detection of 196 curated potential off-target editing sites identified by Cas-OFFinder and SITE-Seq. Targeted amplicon sequencing determined whether off-target editing at each potential site was validated in the relevant cell type PHH. To better understand off-target editing in the context of therapeutically relevant doses, the editing frequency in the dose-response curve (DRC) was determined for each validated off-target site.

[0430] To maximize the sensitivity of off-target editing detection, Intellia performed genome editing in vitro with a supersaturating dose of guide RNA (6nM), which is 50 times the empirically determined therapeutically relevant dose (0.12nM), where an 80% reduction in kallikrein protein in PHH was achieved. Purified gDNA from 2 PHH donors edited with supersaturating doses of NTLA-2002LNP was then characterized using rhAMPSeq, a multiplex amplicon PCR method. Due to limitations in PCR primer compatibility and technical failures in amplicon enrichment, rhAMPSeq was unable to characterize every potential off-target editing site discovered by Cas-OFFinder and SITE-Seq. Potential off-target sites were successfully characterized by rhAMPSeq or were characterized with singleplex AMP-Seq to complete the characterization of all potential off-target editing sites. rhAmpSeq and AMP-Seq were empirically determined with lower limits of insertions or deletions of 0.3% and 0.5%, respectively (TREP-0079 and TREP-0120, respectively).

[0431] Validated off-target sites were further characterized in the DRC of NTLA-2002 to correlate off-target editing validation and indel frequencies with a therapeutically relevant dose of NTLA-2002 that would reduce kallikrein protein by >80% in PHH. Two donor batches of PHH (Hu8290 and Hu8317) were treated with NTLA-2002 in the DRC and editing was assessed for on-target and off-target sites.

[0432] rhAmpSeq detected 1 validated off-target editing site in PHH batches Hu8290 and Hu8317, respectively, located in the first intron of the gene MAPK1 (chr22:21837431-21837451) at frequencies of 0.90% and 0.60% (Table 2), at a concentration 50-fold higher than the empirically determined therapeutically relevant dose, where an 80% reduction in kallikrein protein was achieved. AMP-Seq did not detect any validated off-target sites.

[0433] In the DRC experiment, at high doses, PHH from both donors achieved ≥85% on-target editing saturation levels at the KLKB1 locus ( Figure 2 The maximum MAPK1 intronic locus editing observed at doses >50-fold above the therapeutically relevant dose was 1.5%, with an 80% reduction in kallikrein protein achieved. At the therapeutically relevant dose (0.12 nM guide RNA), no detectable MAPK1 editing was observed in either batch of PHH (lower limit of detection = 0.5%).

[0434] Of the 196 potential off-target sites nominated by Cas-OFFinder and SITE-Seq, only 1 site exhibited efficient CRISPR / Cas9-mediated editing in treated PHH. This site was located in intron 1 of MAPK1. Editing at the MAPK1 off-target site was not detected at therapeutically relevant doses of NTLA-2002, indicating a low risk associated with editing at this site.

[0435] Table 2 Off-target insertion or deletion defects verified after genome editing using NTLA-2002

[0436]

[0437] Kallikrein B1

[0438] To further characterize potential effects from off-target editing of the MAPK1 intron, we used DropletDigital TM MAPK1 mRNA transcripts were quantified by PCR (ddPCR).

[0439] A guide with perfect homology to the MAPK1 intronic site hu-G018729 was designed to maximize any potential phenotype associated with editing this site. This guide, along with hu-G012267 (KLBK1 targeting guide in NTLA-2002) and ctl-G000739 (non-targeting control sgRNA), was formulated with Cas9 mRNA000042 for in vitro studies with individual LNPs: LNP-G018729 (LNP containing MAPK1 intron-targeting hu-G018729), NTLA-2002, and ctl-LNP-G000739 (LNP containing non-targeting ctl-G000739), respectively. In a dose-response analysis, PHHs were treated with each of the 3 LNPs. gDNA was extracted from these cells and sequenced to determine the insertion or deletion rate of the edited locus 3 days after treatment. 10 days after treatment, RNA was also extracted from these cells for MAPK1 expression analysis. Paired two-tailed t-tests were performed to estimate the true difference between the treatment and non-targeted control (LNP-G000739) group means using the ratio of the group mean difference to the pooled standard error for both groups. The Benjamini-Hochberg (BH) procedure was used as a tool to reduce the false discovery rate.

[0440] When treated with MAPK1-targeting LNP-G018729, PHH from both donors reached saturated editing levels at the MAPK1 locus ( Figure 3 Quantification of MAPK1 mRNA was performed on PHHs treated with all doses of NTLA-2002 and PHHs treated with MAPK1-targeted LNP-G018729 10 days after treatment, and no significant difference in MAPK1 transcripts was found compared with control samples using paired t-test with the BH procedure (Table 3).

[0441] These results, demonstrating no changes in MAPK1 mRNA transcript levels, were expected, as the off-target site is located within a noncoding intronic region of the MAPK1 gene. The intronic location of the validated off-target site, coupled with the observation that even achieving >90% editing at this locus with LNP-G018729 did not affect MAPK1 mRNA levels, and the absence of detectable editing at this locus at therapeutically relevant doses of NTLA-2002, suggests a low risk associated with off-target editing.

[0442] Table 3 MAPK1 mRNA expression in primary human hepatocytes treated with NTLA-2002 or MAPK1-targeting LNP1961

[0443]

[0444] mRNA = messenger RNA; PHH = primary human hepatocytes; i = individual p-value rank; m = number of tests; Q = false discovery rate

[0445] Example 3. Characterization of DNA structural variants in primary human hepatocytes

[0446] To characterize potential DNA structural variants (SVs), 2 complementary technologies were applied to characterize genome stability and potential DNA structural variants that may arise from genome editing with NTLA-2002: the qualified unique identifier tag fragmentation (UnIT) NGS assay and long-range PCR followed by long-read sequencing using Pacific Biosciences technology. Targeted PCR-based amplicon sequencing based on Illumina NGS has limited capabilities in characterizing and quantifying DNA structural variants (SVs), such as deletions, duplications, inversions, and translocations >100 bp.

[0447] The DNA SV discovery technology, called UnIT, was developed based on published reports using Illumina NGS (Giannoukos 2018; Klein 2011). This method is able to simultaneously measure small insertions or deletions (<100 bp) at the target site as well as potential structural variants due to rearrangements after DNA repair (such as inversions, duplications, and interchromosomal translocations).

[0448] Detect DNA SVs using split and discordant NGS alignments. When an NGS read or read pair aligns to >1 locus in the genome, the 2 fragments involved (2 fragments from the same read in a split alignment or 2 reads from the same pair in a discordant alignment) are used to classify the SV.

[0449] A complementary long-range sequencing approach was implemented that captures large deletions around the editing site that may be missed by short-read NGS sequencing. Long-range PCR followed by long-read sequencing using Pacific Biosciences technology characterized the possibility of large deletions near the on-target site that may result from DNA repair processes following genome editing with NTLA-2002.

[0450] The UniT DNA SV characterization assay was applied in triplicate to gDNA purified from 2 PHH donors after genome editing with NTLA-2002. No DNA SVs were detected above the empirically determined 0.5% detection limit.

[0451] Characterization of potential large deletions was performed on 2 unique PHH donors using long-range PCR and long-read sequencing. No large deletions above the limit of detection (0.5%) were observed in either batch of PHH.

[0452] No DNA structural variants above the empirically determined detection limit of 0.5% were identified, and no translocations associated with any known oncogenic risk were identified. Therefore, genomic rearrangements to the on-target loci do not represent a known safety risk.

[0453] Example 4. In vitro evaluation of NTLA-2002 efficacy

[0454] In vitro. NTLA-2002 and cyn-LNP-G013901 have been studied in vitro pharmacology in primary human and cynomolgus monkey hepatocytes, respectively. In vitro activity (gene editing, KLKB1 mRNA reduction, and kallikrein protein reduction) was tested in human hepatocytes. Saturating levels of NTLA-2002 resulted in ≥85% insertion or deletion formation (editing) in the KLKB1 gene, followed by ≥85% reduction in KLKB1 mRNA, and ≥99% reduction in kallikrein protein. Comparable in vitro activity of cyn-LNP-G013901 was observed in primary monkey hepatocytes. When the monkey studies were performed

[0455] The relative in vitro activities of cyn-LNP-G013901 and NTLA-2002 were considered in the pharmacokinetic (PK) / pharmacodynamic (PD) data to predict the in vivo human PD effect (kallikrein protein reduction).

[0456] Example 5. In vivo evaluation of the efficacy of NTLA-2002 in transgenic mice

[0457] The in vivo pharmacology of NTLA-2002 was functionally validated in a transgenic mouse model expressing the human KLKB1 gene (huKLKB1 mouse). The huKLKB1 mouse model contains a humanized KLKB1 locus in which the region from the start codon to the stop codon of mouse KLKB1 is replaced by the corresponding human genomic sequence. Animals were weighed and dosed in a volume specific to individual body weight. NTLA-2002 was dosed at 0.3, 0.1, 0.03, and 0.01 mg total RNA / kg body weight.

[0458] On the 13th day after LNP administration, mice were euthanized, lysed using Zymo Research Bashing BeadLysis Rack, and RNA was extracted using Qiagen RNeasy mini kit (Qiagen, Cat. 74106) according to the manufacturer's protocol. RNA was quantified using Nanodrop 8000 (ThermoFisher Scientific, catalog number ND-8000-GL). RNA samples were stored at -20°C before use.

[0459] SuperScript III Platinum One-Step qRT-PCR kit (Invitrogen, catalog number 11732-088) was used to create PCR reactions. Quantitative PCR probes targeting Hu KLKB1 and internal control Ms PPIB were used in the reaction. Quantitative PCR assays were performed according to the manufacturer's instructions, scaled to appropriate reaction volumes, and using the HuKLKB1 and Ms PPIB probes specified above. Real-time PCR reactions and transcript quantification were performed using the StepOnePlus real-time PCR system (Thermo Fisher Scientific, catalog number 4376600) according to the manufacturer's protocol.

[0460] Hu KLKB1 mRNA was quantified using a standard curve starting with 20 ng / uL pooled mRNA from the vehicle control group and ending with 0.06 ng / uL with five 3-fold dilutions. Ct values ​​were determined by the StepOnePlus Real-Time PCR System. The reduction in total secreted human prekallikrein protein in cells treated with the KLKB1 reagent was determined by ELISA as described in Example 1.

[0461] Table 4 and Figure 4 Percent editing, serum kallikrein levels as a percentage of TSS vehicle control treated mice, and mRNA transcript levels as a percentage of TSS vehicle control treated animals are shown.

[0462] Table 4 Editing percentage, KLKB1 mRNA (% of basal level) and serum kallikrein protein level (% of basal level) in Hu KLKB1 mouse model

[0463]

[0464] A proof-of-concept study was conducted to evaluate KLKB1 gene editing, total kallikrein protein expression, and vascular leakage in humanized mice. There were 6 groups (N=5, 2 male mice, 3 female mice per group). Animals were weighed and dosed in a volume specific to individual body weight. NTLA-2002 was administered via the lateral tail vein at 0.03 mg / kg, 0.1 mg / kg, or 0.3 mg / kg based on a volume of 10 ml / kg of total RNA cargo or vehicle control (TSS) per kg of body weight.

[0465] On the day before the vascular leakage study, blood was collected and processed, and secreted human prekallikrein was measured via ELISA to detect total kallikrein. The Evans blue vascular permeability assay is an established model of edema and vascular leakage, which can be used as a model for HAE research (see, for example, Bhattacharjee et al., 2013). In short, thirteen days after the dose, vascular permeability was induced using 2.5 mg / kg intraperitoneal injection of angiotensin converting enzyme (ACE) inhibitor captopril. After 15 minutes, a mixture of Evans blue dye (30 mg / kg) and dextran sulfate (0.3 mg / kg) was administered by intravenous tail injection. Animals were euthanized 15 minutes after this injection, and the dye was evaluated for infiltration into the colon by optical density (OD) at 600 nm absorbance via a Clariostar plate reader (BMGLabTech). Liver and serum were collected to quantify huKLKB1 gene editing and kallikrein protein, respectively.

[0466] The results of editing percentage, serum hu prekallikrein level and vascular leakage are shown in Table 5 and Figure 5 and Figure 6 Shown in.

[0467] Table 5. Percent Editing, Prekallikrein Levels, and Vascular Leakage in huKLKB1 Mice

[0468]

[0469] Dose-dependent increases in KLKB1 gene editing and reductions in serum kallikrein resulted in reduced captopril-induced vascular permeability. At the highest dose tested, induced permeability was similar to baseline levels.

[0470] Example 7. LNP-mediated editing in non-human primates

[0471] Cynomolgus monkeys were treated in cohorts of n=3. This study was performed using the LNP formulations according to Example 1. Each LNP formulation contained polyadenylated Cas9 mRNA (comprising SEQ ID NO: 408) and gRNA (G013901, cynomolgus monkey-specific KLKB1 guide RNA, mG*mG*mA*UUACAUAUGGGACACAAGUUUUAGAmGmCmUm AmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGU UAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 409)) at a ratio of 2:1 by weight of mRNA:gRNA. Animals were dosed at 1.5, 3, or 6 mg / kg based on total RNA cargo. Indel formation (percent editing) was measured by NGS.Total kallikrein activity and plasma kallikrein protein levels were measured as described above.

[0472] The study showed that knocking out KLKB1 (KLKB1 is part of the biological pathway that leads to bradykinin release) with G013901 produced a robust response of up to 90% reduction in kallikrein activity and even exceeded the target activity in the NHP group, showing a therapeutically meaningful effect on HAE attack rate (60% reduction in kallikrein activity; Banerji, 2017). This study showed a dose-dependent correlation between increased editing rate, reduced plasma kallikrein levels, and reduced kallikrein activity. In NHP, the response has been sustained for one year. Tables 6 and 7; and Figure 7 and Figure 8 Circulating kallikrein protein and activity levels are provided.

[0473] Table 6 Kallikrein activity (% of basal activity)

[0474]

[0475]

[0476] Table 7. Plasma kallikrein protein levels (% of basal levels)

[0477]

[0478] Testing of selected NHP samples revealed that no effects of KLKB1 knockout on coagulation pathway biomarkers in NHP were observed at either week 10 or week 15 when comparing TSS buffer controls to treatment groups (based on measurements of prothrombin, APTT, and fibrinogen (all at week 10) and factor XII (at week 15)).

[0479] The NHP study was repeated using guide G012267 (containing a guide sequence fully complementary to human KLKB1) to evaluate total kallikrein protein expression and total kallikrein activity levels in cynomolgus monkeys. The guide sequence of G012267 has one nucleotide difference when compared to G013901, which has a guide sequence fully complementary to cynomolgus monkey KLKB1. The experimental protocol and LNP formulation in this study were essentially the same as described in the above experiment except that animals (n=3) were dosed at 3 mg / kg based on total RNA cargo. Total kallikrein activity and kallikrein protein levels were measured using the methods described in Example 1.

[0480] The study showed that knocking down KLKB1 with G012267 produced up to 65% reduction in kallikrein activity in the NHP group. The response lasted for 9 months in the NHP. Tables 8 and 9; and Fig. 9 and Fig.10 Circulating kallikrein protein and activity levels are provided.

[0481] Table 8. Kallikrein activity (% of basal activity)

[0482]

[0483]

[0484] Table 9. Plasma kallikrein protein levels (% of basal levels)

[0485]

[0486] Table 10. Predicted percent reduction in kallikrein protein in humans based on modeling from non-human primate studies

[0487]

[0488] *Mean body weight of HAE patients as reported by Wang et al., Clinical and Translational Science. 2020;13(6):1208–16.

[0489] Example 8. Biodistribution and tissue editing studies

[0490] Pharmacokinetic studies were performed in NHP using the cynomolgus monkey alternative LNP formulation containing sgRNA G013901 described in the above examples. After a 3-fold increase in dose levels, the exposure of the LNP component was almost or dose-proportional in males and almost or greater than dose-proportional in females. Exposure to the components was generally similar in male and female monkeys. In studies using the alternative agent cyn-LNP-G013901, the component was cleared from the circulation in <5 days.

[0491] Tissue editing in the NHP liver (target tissue) and biodistribution to other tissues were evaluated using NTLA-2002 and its surrogate cyn-LNP-G013901. As described in the pharmacology summary, dose-dependent liver editing was observed. In sexually mature male NHPs treated with 1.5 or 4.5 mg / kg cyn-LNP-G013901, the average editing in the adrenal glands was 2.4% and 18.7%, respectively, and the average editing in the spleen was 12.2% and 18%, respectively, at those dose levels. Editing was not detected in semen and testes. In animals treated with 3, 6 or 9 mg / kg NTLA-2002, the average editing in the adrenal glands was 1.2%, 4.0% and 5.1%, respectively, and the average editing in the spleen was 2.4%, 3.1% and 6.0%, respectively, at those dose levels. Similar to males treated with cyn-LNP-G013901, males treated with NTLA-2002 showed no detectable editing in testicular tissue. In females, low-level editing ranging from 0.8-1.8% was detected in bulk ovarian tissue in some, but not all, females.

[0492] Similar results were observed in transgenic mice containing the human KLKB1 gene (huKLKB1). These results in a large number of ovarian tissues warrant further investigation into the possibility of unintentional germline transmission of genome editing events. This risk was evaluated in a GLP breeding study of transgenic huKLKB1 mice. Female huKLKB1 mice (n=70) were treated with NTLA-2002 at a dose 17 times the expected effective dose (3 mg / kg) and crossed with naive male huKLKB1 mice. The average liver editing of treated females was 78%, indicating maximal activity in the target organ. None of the 382 offspring exhibited a KLKB1-edited genotype. Therefore, this study did not reveal evidence of germline transmission of NTLA-2002-mediated editing events, supporting the inclusion of women of childbearing potential (WOCBP) in clinical studies.

[0493] Example 9. Clinical Trial

[0494] Fig.11The overall original treatment design was summarized. The treatment design was modified so that the dose for the third cohort was increased from 150 mg to 50 mg.

[0495] A. HAE dose escalation study

[0496] Introduction: Hereditary angioedema (HAE) is a rare genetic disorder characterized by recurrent, debilitating, and potentially fatal episodes of swelling. Preventive treatment targeting kallikrein, a protease encoded by the KLKB1 gene, significantly reduces the frequency of episodes. NTLA-2002 is an investigational CRISPR / Cas9-based therapy that targets KLKB1 in liver cells with the goal of achieving lifelong control of HAE episodes after a single administration.

[0497] Methods: NCT05120830 is a first-in-human Phase 1 / 2 study of NTLA-2002 in patients with HAE. Phase 1 is a single ascending dose design with the primary objective to evaluate safety and identify up to two doses to enter a randomized Phase 2 for further evaluation of efficacy and safety.

[0498] Results: Cohort 1 (25 mg; n=3) completed the 16-week initial observation period. No DLTs or clinically significant laboratory abnormalities were observed. Treatment-emergent adverse events (TEAEs) were not serious and resolved spontaneously, with the most common being infusion-related reactions (n=2; CTCAE G1). All subjects demonstrated clinically significant, durable reductions in plasma kallikrein levels and HAE attack frequency compared to baseline (mean reduction of 62±27% at Week 16), with two subjects remaining attack-free since infusion. Three subjects were treated in Cohort 2 (75 mg). Follow-up of all subjects in both cohorts is ongoing.

[0499] Conclusions: To date, a single dose of 25 mg NTLA-2002 was well tolerated and met pre-specified criteria for entry into Phase 2, with reductions in plasma kallikrein levels and maintenance of HAE flare rates through 16 weeks post-infusion. Safety, pharmacodynamics, and HAE flare rate data for both cohorts will be presented.

[0500] Queue 1, Queue 2, and Queue 3

[0501] Enrollment

[0502] Subjects were screened according to the eligibility criteria. According to the protocol, subjects were enrolled in the dose escalation cohorts 1 and 2, as follows: Fig.11Cohort 3 was enrolled using the same inclusion and exclusion criteria as Cohorts 1 and 2. The dosing regimen was modified and subjects were administered a 50 mg dose of NTLA-2002 instead of the 150 mg dose of NTLA-2002 per the original regimen.

[0503] Clinical trial design and eligibility

[0504] This article presents data from two initial cohorts (Cohorts 1 and 2) of the global, Phase 1, open-label, multicenter study. Patients were treated with a single dose of NTLA-2002, administered intravenously as 25 mg total RNA (3 subjects) or 75 mg total RNA (3 subjects). Data from these patients who were subsequently treated are also reported here. Key eligibility criteria for Part 1 included being 18 years of age or older, a documented diagnosis of HAE (Type I or Type II) confirmed by functional C1-INH levels, C1-INH antigen levels, and C4 levels OR genetic testing assessments, and a history of at least 3 HAE attacks during the 3 months (90 days) prior to the start of screening confirmed and documented by the investigator. Subjects also had to have access to and ability to use ≥1 acute medication to treat angioedema attacks; and meet laboratory criteria during the screening period, including:

[0505] a. Aspartate aminotransferase (AST), alanine aminotransferase (ALT) and total bilirubin

[0506] (See Gilbert's syndrome below for exception) ≤ upper limit of normal range (ULN) at screening.

[0507] b. For subjects with a history of Gilbert's syndrome, total bilirubin ≤ 2×ULN at the screening evaluation.

[0508] c. Serum creatinine ≤ ULN, or for subjects with serum creatinine above ULN, if the estimated glomerular filtration rate (eGFR) as measured by the Modification of Diet in Renal Disease formula at screening was > 45 mL / min / 1.73 m^2, they could be included. The lower limit was later changed to > 60 mL / min / 1.73 m^2.

[0509] d. Platelet count ≥100,000 cells / mm^3 at screening.

[0510] e. No clinically significant aPTT, international normalized ratio (INR), fibrinogen, and d-dimer levels at screening within the reference range or as determined by the principal investigator (PI).

[0511] Subjects who have been treated with certain therapeutic agents were excluded from Phase 1 studies as follows:

[0512] a. Use of ecallantide or lanariumab within 6 months before screening.

[0513] b. Use C1-INH for HAE within 5 half-lives of the agent before the start of the Phase 2 lead-in period; i.e., after using rabbit purified C1-INH (ruconest), a 24-hour washout is required before starting the lead-in period, and after using human plasma purified C1-INH (berinert), a 4-day washout is required before starting the lead-in period. During the lead-in period, C1-INH can be used to treat acute HAE attacks.

[0514] c. Subjects were exposed to angiotensin-converting enzyme (ACE) inhibitors or any systemically absorbed estrogen-containing medications within 90 days prior to study drug administration.

[0515] d. Other antithrombotic therapies other than aspirin (e.g., warfarin, dabigatran, apixaban) within 14 days prior to study drug administration.

[0516] Subjects were excluded due to the presence of certain infections or medical conditions, including:

[0517] a. Concurrent diagnosis of any other type of recurrent angioedema, including acquired or idiopathic angioedema.

[0518] b. History of thrombotic tendency, or positive factor V Leiden or prothrombin 20210 gene test.

[0519] c. History of cirrhosis.

[0520] d. Known or suspected systemic viral, parasitic, or fungal infection, including coronavirus disease (COVID)-19 or receipt of antibiotics for bacterial infection within 14 days prior to screening.

[0521] e. History of hepatitis B or hepatitis C infection or positive hepatitis B surface antigen (HBsAg) or hepatitis C virus antibody (HCVAb) test at screening.

[0522] f. History of positive human immunodeficiency virus (HIV) status.

[0523] Subjects must be willing and able to comply with other criteria, including but not limited to the use of effective contraception, and willingness to comply with study procedures, including follow-up visits and cooperation with the investigators.

[0524] The screening period for the Phase 1 portion of the trial was a maximum of 28 days (+14 days if necessary). Subjects who met all inclusion criteria and did not meet any exclusion criteria were allowed to continue dosing. Angioedema episodes were recorded during the screening period and used together with the 3-month historical episode data when evaluating the reduction in episode rate after administration of NTLA-2002.

[0525] Hereditary Angioedema (HAE) Attack Data Collection and Validation

[0526] Detailed guidance was provided to investigators and site teams to provide consistency with regard to the recording and review of episode histories, as well as the collection, review, and evaluation of events considered potential angioedema episodes. A detailed discussion of definitions and methods is provided above.

[0527] Dose escalation and dose-limiting toxicities

[0528] The Phase 1 clinical trial was designed to demonstrate the safety of NTLA-2002 and to define the appropriate dose for Phase 2 studies. Fig.11 As shown in the Table 1, Phase 1 consists of up to 3 dose escalation cohorts, of which Cohorts 1 to 3 consist of a minimum of 3 dose-limiting toxicity (DLT) evaluable subjects and a maximum of 6 DLT evaluable subjects. The study also allows up to 2 optional dose reduction cohorts, each consisting of a minimum of 3 DLT evaluable subjects and a maximum of 6 DLT evaluable subjects. Overall, a maximum of 30 DLT evaluable subjects will be enrolled in Phase 1. NTLA-2002 will be administered as follows: Fig.11 Dosing was as shown in the table “Cohort Dosing Overview” shown in , with possible modifications to increase / decrease as described.

[0529] A minimum of 3 DLT-evaluable subjects are required per cohort. DLT-evaluable subjects are those subjects who have received the full assigned dose of NTLA-2002 and completed the Day 29 assessment, as well as any subject who experiences a dose-limiting toxicity (DLT) regardless of whether the full dose was administered.

[0530] Cohort Dosing

[0531] During the single ascending dose phase, one sentinel subject per cohort will be dosed to evaluate potential acute toxicity within 14 days. If no DLT occurs in the sentinel subject, an additional 2 subjects in the cohort may be dosed in parallel. If any subject experiences a DLT while dosing up to and including the Day 15 visit assessment, the next subject in this dose cohort will be dosed after any DLT resolves to at least Grade 1 and all active subjects complete the Day 15 visit assessment. If any subject experiences a DLT after the Day 14 visit assessment and up to and including the Day 29 visit assessment, the next subject in this dose cohort will be dosed after any DLT resolves to at least Grade 1.

[0532] The last dosed subject in each cohort will be evaluated for 28 days, and dose escalation will be considered thereafter based on the criteria provided below. The sponsor, in conjunction with the investigator and the Data Monitoring Committee (DMC), will determine if an event meets the definition of a DLT and occurs within the first 28 days. The sponsor may upgrade the severity, severity, or relevance of an adverse event (AE) based on the investigator's report; the sponsor is prohibited from downgrading an AE.

[0533] If 1 of 3 subjects in any cohort has a DLT, an additional 3 subjects may be enrolled sequentially, with a minimum of 14 days between each subject at this dose level. If 2 or 3 of 3 subjects experience a DLT, enrollment in this cohort is stopped and the next lower dose cohort may be (re)opened to enroll 3 subjects. In any cohort, if 3 of 3 subjects have an aPTT ≥ 125 seconds on Day 22, the dose level will be declared the maximum evaluated dose. If these cohort closure events occur in the initial dose level 1 cohort (25 mg), a dose reduction cohort of 3 subjects will be investigated to assess whether the lower dose is safe and tolerable with evidence of pharmacological activity. Up to 6 subjects may be enrolled in the final dose cohort to confirm safety.

[0534] DLTs included the following (events occurring within the first 28 days after dosing):

[0535] Any Common Terminology Criteria for Adverse Events (CTCAE) grade 3 or higher adverse event that was possibly, probably, or definitely related to the study drug (excluding AEs related to angioedema, prolonged aPTT, or other comorbid (underlying) conditions of the patient).

[0536] Any CTCAE grade 3 laboratory abnormality (excluding prolonged aPTT) present for ≥7 days and possibly, probably, or definitely related to study drug

[0537] Any CTCAE Grade 4 laboratory abnormality possibly, probably, or definitely related to study drug

[0538] Any AE that met protocol-defined criteria for suspension of enrollment, including fatal or life-threatening adverse events; ALT or AST elevation >5×ULN for more than 4 weeks or ALT or AST >3×ULN and total bilirubin >2×ULN (without initial findings of cholestasis [elevated serum alkaline phosphatase]; Hyman's rule); or thrombosis, hemorrhage, or laboratory parameters consistent with disseminated intravascular coagulation, where the protocol-defined criteria for suspension of enrollment were determined by the investigator to be possibly, probably, or definitely related to study drug.

[0539] Any other adverse events or laboratory abnormalities that, in the opinion of the sponsor, in consultation with the investigators and DMC, would preclude further dosing.

[0540] Dose escalation, dose reduction, or completion of enrollment

[0541] Once enrollment of the dose level cohorts is complete and at least 3 subjects have been followed through the Day 29 visit assessment, the Sponsor will review all available safety and tolerability data and consult with the Investigators and the Data Monitoring Committee (DMC) (per the DMC charter) to determine next steps. The decision to dose escalate / decrease is based on the total available data, including the initial observation of DLT at 28 days post-infusion, the change in aPTT from baseline to Day 22, and safety, efficacy, and PD data.

[0542] The sponsor may recommend a dose escalation to the next planned dose level if both of the following conditions are met: the administered dose level is found to be safe and well tolerated, and a review of individual aPTTs reveals that at least 1 / 3 of the subjects in the cohort have an aPTT < 125 seconds at the Day 22 visit assessment. Based on a review of all available data, the dose escalation may be modified so that the next planned dose level is a dose between the current dose and the next regimen-specified dose. Alternatively, the sponsor may choose to open a cohort so that the next planned dose level is a dose reduction.

[0543] The sponsor will recommend a dose reduction to a dose below the current dose level if any of the following criteria are met: the dose administered in the cohort is found to be unsafe and poorly tolerated; or a review of the aPTT for the cohort indicates that all subjects in the cohort have achieved the maximum anticipated pharmacological effect (≥125 seconds) at the Day 22 visit.

[0544] Dose escalation, dose reduction, or completion of study Phase 1 enrollment, and initiation of Phase 2, will be determined by the sponsor with input from the investigators and DMC (per DMC charter). In addition to the above criteria, study enrollment may be stopped for any reason at the discretion of the sponsor and a DMC meeting may be held to protect the safety of the subjects.

[0545] Phase 1 enrollment is declared complete upon completion of the Day 29 assessment for all 3-5 planned dose cohorts; or if the maximum evaluated dose is identified; or if the study is terminated early based on the sponsor's assessment in consultation with the investigators and DMC.

[0546] To inform the selection of doses to be tested in the Phase 2 study, the sponsor performed a collective analysis of safety, tolerability, PK, PD (reduction in prekallikrein / kallikrein concentrations), and therapeutic activity (analysis of HAE flare rates from Weeks 5-16) from all Phase 1 studies. The investigators and DMC reviewed the results to determine whether to test a dose in the Phase 2 study.

[0547] Using appropriate data cutoff points, provide a summary of cumulative data to regulatory authorities or institutional review boards (IRBs) / ethics committees (ECs) based on national requirements prior to initiation of Phase 2 studies.

[0548] Phase 2

[0549] Phase 2 involves up to 25 subjects and 3 groups, including up to 2 groups receiving different doses of NTLA-2002 and 1 group receiving saline placebo. If 2 dose levels of NTLA-2002 are used in Phase 2, subjects will be randomized 2:2:1, i.e., NTLA-2002 dose level 1:NTLA-2002 dose level 2:placebo. If only 1 dose level of NTLA-2002 is used in Phase 2, up to 15 subjects will be randomized 2:1, i.e., NTLA-2002 dose level 1:placebo. The NTLA-2002 dose selected for Phase 2 is the dose determined to be safe and well tolerated in Phase 1, with a reduction of at least 60% in mean total plasma prekallikrein / kallikrein levels from baseline to nadir, and evidence of a reduction in HAE attacks.

[0550] Phase 2 involves up to 25 subjects and 3 groups, including up to 2 groups receiving different doses of NTLA-2002, 25 mg (n=10) and 50 mg (n=10) and 1 group receiving saline placebo (n=5). The primary objective is clinical efficacy against flares within Week 16, as well as other pharmacodynamic, safety, tolerability, pharmacokinetic and quality of life assessments.

[0551] Pharmacokinetics

[0552] Interim pharmacokinetic data indicate that following intravenous (IV) infusion, NTLA-2002 ionizable lipids exhibit a rapid decline from peak levels, followed by a secondary peak, and then a log-linear phase.

[0553] Example 10. CRISPR / -Cas9 editing of KLKB1 in patients with hereditary angioedema: a first human study

[0554] Cohort 1:

[0555] Data from three subjects treated with 25 mg NTLA-2002 in Cohort 1 of the Phase 1 study described in Example 9 are reported. The demographic and HAE episode characteristics in Cohort 1 are described in Table 13. The subjects completed the 16-week initial observation period. No DLTs were observed in the subjects. The subjects had no clinically significant laboratory abnormalities. TEAEs were not severe and resolved spontaneously, with the most common being infusion-related reactions (n=2; CTCAE G1). All infusion-related reactions were considered mild and resolved without clinical sequelae. No treatment-emergent SAEs or ≥ Grade 3 AEs were observed. The frequency of HAE attacks in the subjects decreased compared to baseline, with two subjects remaining attack-free since infusion (Tables 11 and 12 and Fig.15 and Fig.16A ). Cohort 1 subjects had an average reduction in seizure frequency of >90% (mean -91 ± 16% SD) during weeks 1-16 post-infusion compared to the screening period. The analysis including the 90-day historical period of patient reports resulted in a mean percent change in monthly seizure rate of -94%. Subjects also demonstrated a reduction in plasma kallikrein levels, e.g., a clinically significant, sustained reduction (mean 62 ± 27% at week 16) (see, e.g. Fig.12 ). Fig.13 Mean absolute protein reduction after infusion is depicted. Fig.14 Updated results depicting mean absolute protein reductions following infusion. To date, a single 25 mg dose of NTLA-2002 has been well tolerated and met pre-specified advancement criteria to Phase 2, with reductions in plasma kallikrein levels and maintenance of HAE flare rates through 16 weeks post-infusion.

[0556] Table 11: Seizure Rate Reduction in Cohort 1 (25 mg)

[0557]

[0558] Table 12: Reduction in Individual Seizure Rates in Cohort 1 (25 mg)

[0559]

[0560] Table 13: Cohort 1 (25 mg) Demographics and Episode Characterization

[0561]

[0562]

[0563] Cohort 2:

[0564] In Cohort 2 of the Phase 1 study described in Example 9, three subjects have been treated with 75 mg NTLA-2002.

[0565] In a subsequent analysis of cohort 2, subjects had no clinically significant laboratory abnormalities. TEAEs were not severe and resolved spontaneously, with the most common being infusion-related reactions (n=2; CTCAE G1 and n=2; CTCAE G2). All infusion-related reactions were considered mild and resolved without clinical sequelae. No grade 3 or higher TEAEs were reported. Fig.13 Mean absolute protein reduction after infusion is depicted. Fig.14 The most recent results for mean absolute protein reductions following infusion are depicted. The % reductions from baseline to nadir were 65% (25 mg) and 92% (75 mg), respectively, with both dose levels demonstrating pharmacokinetic responses expected to be associated with effective prevention of HAE attacks.

[0566] Patient demographics and characteristics are provided in Table 14. Table 15 presents patient HAE episode history and prophylaxis use for Cohorts 1 and 2 individually and overall.

[0567] Table 14: Patient demographics and characteristics

[0568]

[0569]

[0570] Table 15: History and prevention of HAE attacks

[0571]

[0572] NTLA-2002 was generally well tolerated at both dose levels. At both dose levels, the most common adverse events were fatigue and infusion-related reactions. Most treatment-emergent adverse events were mild in severity, with 67% (n=4) and 33% (n=2) of patients reporting a maximum adverse event severity of Grade 1 or 2, respectively. All infusion-related reactions were considered mild (n=4) or moderate (n=1), which resolved without leaving clinical sequelae. All patients received the full study dose of NTLA-2002.

[0573] No clinically significant laboratory findings were observed. Transient Grade 1 elevations of AST (n=3) and ALT (n=2) were observed. No increases in activated partial thromboplastin time were observed. No treatment-emergent SAEs or Grade ≥3 AEs were observed. Adverse events are summarized in Table 16 below.

[0574] Table 16: Adverse events

[0575]

[0576] All other adverse events (abdominal pain, chest injury, soft tissue injury, prodromal disease, rhinitis, diarrhea, vomiting, somnolence, myalgia, insomnia, oropharyngeal pain, viral upper respiratory tract infection) were reported by no more than one patient.

[0577] A single dose of NTLA-2002 resulted in a robust, dose-dependent, and durable reduction in total plasma kallikrein levels. Mean reductions were 65% (25 mg) and 92% (75 mg) at week 8. Mean reduction in HAE attacks in the 25 mg cohort was >90% at week 16. All patients in the 25 mg cohort achieved complete seizure control. Patients who had previously received prophylactic therapy were able to discontinue treatment and remain seizure-free.

[0578] NTLA-2002 was generally well tolerated at both dose levels; all AEs were mild or moderate in severity. The 50 mg cohort is enrolled and treating.

[0579] Cohort 3:

[0580] In Cohort 3 of the Phase 1 study described in Example 9, four subjects were treated with 50 mg NTLA-2002.

[0581] In a subsequent analysis of Cohort 3, no subjects had clinically significant laboratory abnormalities. TEAEs were mild (n=5) to moderate (n=4) at all dose levels and resolved without clinical sequelae. No increase in activated partial thromboplastin time was observed. No treatment-emergent SAEs or Grade 3 or higher TEAEs were reported. Fig.17 The most recent results of mean absolute protein reduction after infusion are depicted. Fig.18 The most recent results depict the mean percent reduction in kallikrein protein following infusion compared to baseline. All three dose levels demonstrated pharmacokinetic responses expected to be associated with effective prevention of HAE attacks.

[0582] Table 17 provides patient demographics and characteristics. Table 18 presents patient HAE episode history and prophylaxis use in Cohorts 1-3.

[0583] Table 17: Patient demographics and characteristics

[0584]

[0585]

[0586] Table 18: History and prevention of HAE attacks

[0587]

[0588] NTLA-2002 was generally well tolerated at all three dose levels. The most common adverse events at all three dose levels were fatigue and infusion-related reactions. Most treatment-emergent adverse events were mild in severity, with 50% (n=5) and 40% (n=4) of patients reporting a maximum adverse event severity of Grade 1 or 2, respectively. All infusion-related reactions were considered mild (n=5) or moderate (n=2), which resolved without leaving clinical sequelae. All patients received the full study dose of NTLA-2002.

[0589] No clinically significant laboratory findings were observed. Adverse events are summarized in Table 19 below.

[0590] Table 19: Adverse events

[0591]

[0592] All other AEs (abdominal discomfort, abdominal pain, epigastric pain, arthralgia, fatigue, chest injury, depressed mood, diarrhea, prodromal disease, low back pain, insomnia, myalgia, rhinitis, sinusitis, soft tissue injury, somnolence, vomiting) were reported in no more than one patient.

[0593] A single dose of NTLA-2002 resulted in robust, dose-dependent, and sustained reductions in total plasma kallikrein levels. Mean plasma reductions at nadir ranged from 65% (25 mg) to 92% (75 mg), and responses persisted over the duration of follow-up.

[0594] Clinically significant reductions in HAE flare rates were observed in all patients with at least 16 weeks of follow-up. 100% of patients in cohort 1 (25 mg) and cohort 2 (75 mg) had sustained flare-free intervals of 2.3 to 10.6 months; the first three patients treated had been flare-free for 5.5-10.6 months ( Fig.19 , Fig. 20A and Fig. 20B During weeks 1-16 after NTLA-2002 administration, the mean percent change from baseline in episodes was 91% for cohort 1 and 78% for cohort 2. During weeks 5-16 after NTLA-2002 administration, the mean percent change from baseline in episodes was 89% for cohort 1 and 89% for cohort 2 ( Fig.21 Patients who discontinued prophylaxis after infusion of NTLA-2002 remained seizure-free.

[0595] Consistent with earlier analyses, NTLA-2002 was generally well tolerated at both dose levels; all AEs were mild or moderate in severity.

[0596] Example 11. CRISPR / -Cas9 editing of KLKB1 in patients with hereditary angioedema: latest clinical data

[0597] A follow-up analysis of cohorts 1-3 in Example 10 is provided. Fig. 22 The most recent results of mean absolute protein reduction after infusion are depicted. Fig.23 The latest results are depicted as the mean percent reduction in kallikrein protein after infusion compared with baseline. Fig.28 The mean absolute values ​​of plasma kallikrein activity after infusion for each cohort are depicted. Fig.29 The mean percentage change from baseline in plasma kallikrein activity after infusion is depicted for each cohort. Figure 30 to Figure 32 Spaghetti graph depicting the percent change from baseline in individual patient kallikrein protein level data. Figure 33 to Figure 35 Spaghetti graphs depicting the percent change from baseline in kallikrein activity level data for individual patients. Consistent with earlier reported results, all three dose levels demonstrated pharmacokinetic responses expected to be associated with effective prevention of HAE attacks.

[0598] A single dose of NTLA-2002 resulted in robust, dose-dependent, and sustained reductions in total plasma kallikrein levels. Mean plasma reductions of 65% (25 mg), 81% (50 mg), and 92% (75 mg) were observed at nadir, and responses persisted over the duration of follow-up.

[0599] Clinically meaningful reductions in HAE flare rates were observed in all patients with at least 24 weeks of follow-up. All but one patient in cohort 1 (25 mg) had sustained flare-free intervals ranging from 3.7 to 12 months ( Figure 24 to Figure 27 ). One patient in cohort 1 (25 mg) experienced a single mild attack. In weeks 1-24 after administration of NTLA-2002, the mean percentage change in attacks from baseline was 93.8% for cohort 1 (25 mg), 83.7% for cohort 2 (75 mg), and 98.3% for cohort 3 (50 mg). During the study period after administration of NTLA-2002, the mean percentage change in attacks from baseline was 95.4% for cohort 1, 91.2% for cohort 2, and 98.3% for cohort 3 (Table 20, Table 21). Of the 6 patients who received concurrent long-term prophylaxis (Table 18), 100% were able to discontinue prophylaxis and remain seizure-free ( Fig.24The history of HAE episodes in patients in Cohorts 1-3 is listed in Table 20 (HAE episodes confirmed by investigators) and Table 21 (HAE episodes confirmed by investigators requiring acute therapy).

[0600] Consistent with earlier analyses, NTLA-2002 was generally well tolerated at all three dose levels; all AEs were mild or moderate in severity. All treatment-related TEAEs were grade 2 or less. All patients received the full study dose of NTLA-2002.

[0601] Adverse events are summarized in Table 22 below.

[0602]

[0603]

[0604]

[0605]

[0606]

[0607]

[0608] Example 12. CRISPR / -Cas9 editing of KLKB1 in patients with hereditary angioedema: latest clinical data

[0609] The data in Example 11 were used to analyze the correlation plot between plasma kallikrein protein concentration (% change from baseline) and kallikrein activity (% change from baseline) in HAE patients after administration of a single dose (25, 50, or 75 mg) of NTLA-2002 ( Fig.36 The analysis showed a strong linear correlation between the % change in kallikrein protein and the % change in kallikrein activity compared to baseline (R 2 =0.820), and the slope was 0.929 (95% CI: 0.840-1.019).

[0610] Example 13. CRISPR / -Cas9 editing of KLKB1 in patients with hereditary angioedema: latest clinical data, pharmacokinetic analysis

[0611] Blood samples were collected to assess the plasma concentration time profile before, during, and at the end of the infusion. Post-infusion samples were collected at predefined time points as indicated in the figure ( Fig.37). LP01 (lipid A) was quantified using a liquid chromatography tandem mass spectrometry (LC-MS / MS) method. Plasma samples were evaluated using a validated method in accordance with regulatory guidelines. LP01 exhibited a dose-dependent exposure and rapidly declined below the limit of quantification by day 15, with a mean t1 / 2 between 16.8h and 21.3h.

[0612] Example 14. CRISPR / -Cas9 editing of KLKB1 in patients with hereditary angioedema: latest clinical data, pharmacokinetic analysis

[0613] A follow-up analysis of cohorts 1-3 in Example 10 is provided.

[0614] Clinically meaningful reductions in HAE flare rates were observed in all patients with at least 24 weeks of follow-up. All but one patient in cohort 1 (25 mg) had sustained flare-free intervals ranging from 3.7 to 12 months ( Fig.38 ). Each row shows individual patient angioedema episode data, with the left side indicating the historical monthly episode rate prior to screening. Patients are presented in order of NTLA-2002 treatment date. The length of the colored bar indicates the duration of the episode. The arrow indicates when any concomitant long-term prophylaxis (LTP) was discontinued. Patients without arrows were not taking long-term prophylaxis while on study drug.

[0615] Six patients who were taking concurrent long-term prophylaxis at study entry, with historical attack rates ranging from 0.9 to 14.0 attacks per month, were able to discontinue their prophylaxis between 2.6 and 5.4 months after NTLA-2002 administration ( Fig.37 These patients did not report any seizures after cessation of long-term prophylaxis. Across all patients, the mean monthly seizure rate was 0.14 (SD, 0.45) compared with 3.5 (SD, 2.7) at baseline ( Fig.39 ). Monthly rates of angioedema attacks confirmed by investigators for four time periods during the study. Columns indicate medians; bars indicate interquartile ranges; each color indicates an individual patient. Baseline is defined as the screening period of up to 42 days prior to administration of NTLA-2002. Study period is defined as the time from administration of NTLA-2002 to the last angioedema attack assessment at the data cutoff date. Long-term prophylaxis is defined as any type of long-term prophylaxis for the treatment of hereditary angioedema, including NTLA-2002. Only angioedema attacks that occurred after administration of NTLA-2002 were included.

[0616] All patients demonstrated a high degree of control of angioedema episodes. Patient 1 experienced mild swelling of the hand due to a sports injury on day 343, but no medical intervention or acute therapy was required and the swelling resolved within two days.

[0617] Table 26 below presents the mean percentage change from baseline in investigator-confirmed monthly episodes when all patients in all cohorts were evaluated at different intervals.

[0618] Table 26. Percent Change from Baseline in Monthly Investigator-Confirmed Episodes

[0619]

[0620] Data are mean % change (standard deviation) from baseline. Baseline is defined as a screening period of up to 42 days before the administration of NTLA-2002. Since there is no minimum number of attacks during the screening period, only the percentage change in the monthly attack rate compared to baseline was calculated for patients who had attacks at baseline. One patient in the 50 mg cohort did not have an attack during the screening period, so the percentage change from baseline could not be determined. The study period is defined as the time from the administration of NTLA-2002 to the last angioedema attack assessment on the data cutoff date.

[0621] Consistent with earlier analyses, NTLA-2002 was generally well tolerated at all three dose levels; all AEs were mild or moderate in severity. All treatment-related TEAEs were grade 2 or below. All patients received the full study dose of NTLA-2002. Adverse events are summarized in Table 27 below.

[0622] Table 27. Treatment-emergent adverse events

[0623]

[0624] Data are n(%). COVID-19, coronavirus disease 2019; mg, milligram; TEAE, treatment-emergent adverse event.

[0625] In 10 patients with hereditary angioedema, a single dose of NTLA-2002 was well tolerated. All patients experienced robust, dose-dependent, and durable reductions in plasma kallikrein by 65-95% over the duration of follow-up, and the monthly angioedema episode rate was reduced by 95%. Patients who discontinued concomitant LTP continued to have good disease control. Based on these data, the 25 mg and 50 mg doses were selected for a randomized, double-blind, placebo-controlled Phase 2 study. These results provide further clinical validation for targeting kallikrein protein expression as a treatment modality for hereditary angioedema.

[0626] Patients enrolled in Phase 1 had varying historical monthly angioedema attack rates prior to screening. Some patients had severe baseline disease, and these patients required longer time to control attacks. In addition, the time required to achieve a steady-state reduction in plasma kallikrein (approximately 4 weeks) was associated with continued attacks in some patients early in the initial observation period. This can be inferred based on the improved attack rate reduction, which ranged from 93-98% when evaluated over the duration of follow-up, and 80-97% at Weeks 1-16.

[0627] Because treatment with NTLA-2002 results in a significant reduction in plasma kallikrein, it can be compared to individuals with congenital plasma prekallikrein deficiency or "Fletcher factor syndrome," a rare autosomal recessive disorder. These individuals are reported to be in good physical health, with the only well-established sign being a prolonged aPTT without significant clinical consequences. Despite the involvement of plasma kallikrein in coagulation, the incidence of major bleeding events in these individuals was found to be very low and comparable to that in the general population. None of the patients in the current study experienced prolonged aPTT or any thromboembolic or bleeding events.

[0628] The study was a single-arm study and allowed concurrent use of LTP after NTLA-2002, making it difficult to isolate the treatment effect of NTLA-2002. Once LTP was stopped, the monthly flare rate reached 0 in almost all patients, suggesting that the clinical benefit was solely from NTLA-2002. An ongoing randomized Phase 2 study will require washout of LTP prior to treatment with NTLA-2002 and will more precisely define its treatment effect.

[0629] Table 23: Sequence Listing

[0630]

[0631]

[0632]

[0633]

[0634]

[0635]

[0636]

[0637]

[0638]

[0639]

[0640]

[0641]

[0642]

[0643]

[0644]

[0645]

[0646]

[0647]

[0648]

[0649]

[0650]

[0651]

[0652]

[0653]

[0654]

[0655]

[0656]

[0657]

[0658]

[0659]

[0660]

[0661]

[0662]

[0663]

[0664]

[0665]

[0666]

[0667]

[0668]

[0669]

[0670]

[0671]

[0672]

[0673]

[0674]

[0675]

[0676]

[0677]

[0678]

[0679]

[0680]

[0681]

[0682]

Claims

1. A method of treating hereditary angioedema (HAE) in a human subject, comprising systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene in the liver.

2. A method of preventing an HAE attack in a human subject, comprising systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene in the liver.

3. A method of reducing the frequency of angioedema attacks in a human subject suffering from HAE, comprising systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene in the liver.

4. A method for editing the kallikrein (KLKB1) gene in vivo in a human subject with HAE, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding Cas nuclease, and ii. a guide RNA targeting the KLKB1 gene; and b. editing the KLKB1 gene at the site targeted by the guide RNA in the hepatocytes of the subject; Wherein administration of the composition results in a clinically significant improvement in the subject's clinical indicator level compared to a baseline level.

5. A method for treating hereditary angioedema (HAE) in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding Cas nuclease, and ii. a guide RNA targeting KLKB1, wherein the guide RNA comprises a targeting sequence comprising the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15), wherein administration of the composition reduces total plasma kallikrein protein levels relative to baseline total plasma kallikrein protein levels.

6. A method of treating hereditary angioedema (HAE) in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding Cas nuclease, and ii. a guide RNA targeting the KLKB1 gene in the liver; b. determining a first level of a clinical indicator of the subject prior to administration; c. determining a second level of the clinical indicator in the subject within a period of time after administration; and d. evaluating the change between the first level and the second level of the clinical indicator, wherein administration of the composition results in an improvement in the change in the clinical indicator level of the subject compared to a baseline level, thereby treating HAE.

7. A method of treating hereditary angioedema (HAE) in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding Cas nuclease, and ii. a guide RNA targeting the KLKB1 gene in the liver; b. determining a first level of a biosafety indicator of the subject prior to administration; c. determining a second level of the biosafety indicator in the subject within a period of time after administration; and d. evaluating the change between the first level and the second level of the biosafety indicator, wherein administration of the composition results in an acceptable change in the subject's biosafety indicator level compared to a baseline level.

8. A method of treating hereditary angioedema (HAE) in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene, Wherein administration of the composition results in a clinically significant improvement in the subject's clinical indicator level compared to a baseline level of the clinical indicator.

9. A method for treating HAE in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene, wherein the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene are administered at a combined dose of about 25 mg to about 75 mg.

10. A method for treating HAE in a human subject, comprising: a. systemically administering to the human subject an LNP composition comprising a therapeutically effective amount of: i. mRNA encoding Cas nuclease, and ii. Guide RNA targeting the KLKB1 gene, Wherein the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene are administered at a combined dose of about 50 mg to about 75 mg.

11. The method of any one of claims 1 to 10, wherein kallikrein protein levels are reduced by at least 60% following administration of the composition.

12. The method of any one of claims 1 to 11, further comprising a reduction in kallikrein activity levels by at least 60% after administration of the composition.

13. The method of any one of claims 1 to 4 or 6 to 12, wherein the guide RNA comprises a targeting sequence comprising the nucleotide sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15).

14. The method of any one of claims 1 to 13, wherein the guide RNA further comprises a scaffold sequence comprising the nucleotide sequence GUUUUAGAGC UAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 387).

15. The method of any one of claims 1 to 14, wherein the guide RNA is a modified guide RNA comprising or consisting of the nucleotide sequence mG*mG*mA*UUGCGUA UGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 391), wherein m indicates a 2'-O-methyl modified nucleotide, and * indicates a phosphorothioate linkage between nucleotides.

16. The method of any one of claims 1 to 15, wherein the subject is treated prophylactically with HAE while the LNP composition is systemically administered to the human subject.

17. The method of claim 16, wherein the HAE prevention comprises an agent selected from the group consisting of a C1 esterase inhibitor (C1-INH) replacement (recombinant or plasma derived), a B2 bradykinin receptor (B2R) inhibitor (icatibant), a kallikrein inhibitor (ecallantide, lanariumab, berotator), an attenuated androgen (danazol, oxandrolone, stanozolol), or an antifibrinolytic agent.

18. The method of claim 17, wherein the HAE prevention comprises an agent selected from berotelostat and danazol.

19. The method of any one of claims 1 to 18, wherein the subject has an attack frequency of at least 2 confirmed HAE attacks within 90 days immediately prior to systemic administration of the LNP composition to the human subject.

20. The method of any one of claims 1 to 18, wherein immediately prior to systemic administration of the LNP composition to the human subject, the subject had an attack frequency of at least 3 confirmed HAE attacks per 90 days.

21. The method of any one of claims 1 to 18, wherein immediately prior to systemic administration of the LNP composition to the human subject, the subject had an average attack frequency of at least 6 confirmed HAE attacks per 90 days.

22. The method of any one of claims 19 to 21, wherein at least 90 days immediately following systemic administration of the LNP composition to the human subject, optionally at least 6 months immediately following systemic administration of the LNP composition to the human subject, the subject's confirmed seizure frequency is reduced by at least 50%.

23. The method of any one of claims 19 to 21, wherein at least 90 days immediately following systemic administration of the LNP composition to the human subject, optionally 6 months immediately following systemic administration of the LNP composition to the human subject, the subject-confirmed seizure frequency is reduced by at least 80%.

24. The method of any one of claims 19 to 21, wherein 90 days immediately following systemic administration of the LNP composition to the human subject, optionally 6 months immediately following systemic administration of the LNP composition to the human subject, the subject has no confirmed attack.

25. The method of any one of claims 19 to 21, wherein the subject-confirmed seizure frequency is reduced by at least 80% on days 29 to 112 following systemic administration of the LNP composition to the human subject, optionally on days 29 to 216 following systemic administration of the LNP composition to the human subject.

26. The method of any one of claims 19 to 21, wherein the subject-confirmed seizure frequency is reduced by at least 90% on days 29 to 112 following systemic administration of the LNP composition to the human subject, optionally on days 29 to 216 following systemic administration of the LNP composition to the human subject.

27. The method of any one of claims 19 to 21, wherein the subject has no confirmed attack on day 29 to 112 after systemic administration of the LNP composition to the human subject, optionally on day 29 to 216 after systemic administration of the LNP composition to the human subject.

28. The method of any one of claims 16 to 27, wherein prophylaxis is stopped simultaneously with systemic administration of the LNP composition to the human subject.

29. The method of any one of claims 16 to 28, wherein prevention is discontinued on or after day 36 following systemic administration of the LNP composition to the human subject.

30. The method of any one of claims 1 to 29, wherein the subject uses acute therapy for treating HAE attacks less frequently.

31. The method of any one of claims 1 to 30, wherein the subject has a reduced frequency of hospitalizations associated with HAE attacks compared to a control, e.g., the subject prior to treatment with the composition.

32. The method of any one of claims 1 to 31, wherein the severity of the subject's confirmed HAE episode is reduced.

33. The method of any one of claims 1 to 32, wherein the subject has a reduced frequency of confirmed severe HAE attacks.

34. The method of any one of claims 1 to 32, wherein the subject has a reduced frequency of confirmed HAE attacks with laryngeal edema.

35. The method of any one of claims 1 to 34, wherein the subject's quality of life improves, optionally as determined by a suitable quality of life (QoL) assessment.

36. The method of any one of claims 1 to 35, wherein the subject is intolerant to long-term treatment with attenuated androgens or has an average attack frequency of at least 1 per 90 days while on attenuated androgens.

37. The method of any one of claims 1 to 36, wherein the subject is a child, a pregnant woman, a subject with liver disease, a subject with breast cancer, a subject with prostate cancer, a subject with cardiovascular risk factors, and a subject with hepatocellular carcinoma.

38. The method of claim 37, wherein the subject is a pregnant woman.

39. The method of any one of claims 1 to 38, wherein the subject is a female of childbearing potential.

40. The method of any one of claims 1 to 39, wherein the subject has had at least one confirmed HAE episode with laryngeal edema.

41. The method of any one of claims 1 to 40, wherein the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadec-9,12-dienoate.

42. The method of any one of claims 1 to 41, wherein the LNP comprises a PEG lipid.

43. The method of claim 42, wherein the PEG lipid comprises 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene glycol 2000.

44. The method of any one of claims 1 to 43, wherein the LNP comprises a neutral lipid.

45. The method of claim 44, wherein the neutral lipid comprises 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

46. ​​The method of any one of claims 1 to 45, wherein the LNP composition has an N / P ratio of about 5-7.

47. The method of any one of claims 1 to 46, wherein the guide RNA and the mRNA encoding the Cas nuclease are present in a ratio ranging from about 5: 1 to about 1:5 by weight.

48. The method of any one of claims 1 to 47, wherein the mRNA encodes a Cas9 nuclease.

49. The method of any one of claims 1 to 48, wherein the mRNA encodes Streptococcus pyogenes Cas9.

50. The method of any one of claims 1 to 49, wherein the mRNA encoding the Cas nuclease is codon optimized.

51. The method of any one of claims 1 to 50, wherein the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 25-75 mg of total RNA.

52. The method of any one of claims 1 to 51, wherein the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 25 mg of total RNA.

53. The method of any one of claims 1 to 51, wherein the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 50 mg total RNA.

54. The method of any one of claims 1 to 51, wherein the effective amount of the mRNA encoding the Cas nuclease and the guide RNA targeting the KLKB1 gene is a combined dose of about 75 mg total RNA.

55. The method of any one of claims 1 to 54, wherein administration of the composition reduces total plasma kallikrein protein levels by 60%-95%, 60%-90%, 70%-95%, 70%-90% or 80%-95% compared to baseline total plasma kallikrein levels prior to administration of the composition.

56. The method of any one of claims 1 to 55, wherein administration of the composition reduces plasma kallikrein activity by 60%-95%, 60%-90%, 70%-95%, 70%-90% or 80%-95% compared to a baseline plasma kallikrein activity level prior to administration of the composition.

57. The method of any one of claims 55 to 56, wherein the plasma kallikrein level is determined at least 28 days after administration of the LNP composition.

58. The method of any one of claims 55 to 57, wherein the plasma kallikrein level is determined at least 56 days after administration of the LNP composition.

59. The method of any one of claims 1 to 58, wherein administration of the composition results in an acceptable change in the subject's biosafety indicator level compared to a baseline level of the biosafety indicator.

60. The method of claim 59, wherein the biological safety indicator is activated partial thromboplastin time (aPTT).

61. The method of claim 59 or 60, wherein the biological safety indicator is alanine aminotransferase (ALT).

62. The method of any one of claims 59 to 61, wherein the biological safety indicator is aspartate aminotransferase (AST).

63. The method of any one of claims 59 to 62, wherein the change in the biosafety indicator resolves within 14 days.

64. The method of any one of claims 59 to 63, wherein the biosafety index is level 3 or lower.

65. The method of any one of claims 1 to 64, wherein the composition is administered with a second therapy to treat HAE.

66. The method of claim 65, wherein the second treatment is a HAE prophylactic treatment.

Images