A method for enhancing the anti-tumor effect of oncolytic virus M1

By combining albendazole with oncolytic virus M1, the expression of VEGF and PD-1 is inhibited, the tumor-killing toxicity of lymphocytes is enhanced, the immunosuppression problem of oncolytic virus M1 in tumor treatment is solved, a more efficient tumor treatment effect is achieved, and the drug resistance of CTLA4 antibody is overcome.

CN119837865BActive Publication Date: 2025-12-16SUN YAT SEN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510217757.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2024-04-30
Filing Date
2025-02-26
Publication Date
2025-12-16
Estimated Expiration
2045-02-26

AI Technical Summary

Technical Problem

Oncolytic virus M1 is limited in tumor treatment due to the immunosuppressive properties of the tumor microenvironment and immune escape mechanisms, resulting in poor treatment efficacy. Furthermore, the poor water solubility of albendazole affects its clinical efficacy.

Method used

Combining albendazole with oncolytic virus M1 enhances the intratumoral infiltration and tumor-killing toxicity of lymphocytes by inhibiting VEGF and PD-1 expression, and enhances the antitumor effect by combining with CTLA4 antibody.

Benefits of technology

It significantly enhances the antitumor effect of oncolytic virus M1, overcomes the drug resistance of CTLA4 antibody, improves the response rate of tumor treatment, and has low toxicity and low price.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005287908000000011
    Figure HDA0005287908000000011
  • Figure HDA0005287908000000012
    Figure HDA0005287908000000012
  • Figure HDA0005287908000000021
    Figure HDA0005287908000000021
Patent Text Reader

Abstract

The application belongs to the technical field of tumor treatment, and discloses a method for enhancing the anti-tumor effect of an oncolytic virus M1, and specifically discloses application of albendazole in preparation of a product for enhancing the anti-tumor effect of the oncolytic virus M1. The application first proposes that ABZ can increase the therapeutic effect of OVM1 in treating tumors, and has small toxicity and low price. It is proved through experiments that OVM1 combined with ABZ treatment can significantly promote the activity inhibition of tumors in vitro, and the anti-tumor effect of the combined treatment on immune-competent mice is far greater than that on immune-deficient mice; further detection finds that this process depends on CD8 + T cells play a synergistic anti-tumor effect. At the same time, ABZ and OVM1 combined with CTLA4 antibody can not only further enhance the anti-tumor effect, but also overcome the drug resistance of ICB treatment based on CTLA4. The application provides a new strategy for synergistic oncolytic virus treatment and overcoming ICB drug resistance.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of tumor treatment, and particularly relates to a method for enhancing the anti-tumor effect of Oncolytic Virus M1. BACKGROUND

[0002] In the field of tumor treatment, Oncolytic Viruses (OVs) have attracted much attention due to their unique anti-tumor mechanism. As an effective tumor treatment method, Oncolytic Virus M1 (OVM1) selectively infects and destroys tumor cells, while activating the host's immune system and enhancing the immune response to tumors. However, the application of OVM1 in clinical practice is affected by various factors, including the immunosuppressive properties of the tumor microenvironment and immune escape mechanisms. For example, while OVM1 targets and kills tumors, it also produces antiviral immunity in the body, limiting the virus's survival time in the body. In addition, during OVM1 treatment, MDSCs accumulate in the tumor tissue and promote tumor progression. More specifically, MDSCs can produce Arg-1, iNOS, IL-6, IL-10, TGF-β, and COX-2 to inhibit the proliferation and function of T cells. In addition to immunosuppressive functions, MDSCs also promote tumor progression by remodeling the TME. Furthermore, previous studies have found that while OVM1 safely and effectively kills tumors, it also promotes the expression of vascular endothelial growth factor (VEGF) and PDL1 mRNA in tumor tissue at an early stage. These factors limit the effectiveness of tumor treatment.

[0003] In recent years, immune checkpoint inhibitors have made significant progress in tumor treatment, with the PD-1 / PD-L1 axis being an important immune regulation target. High expression of PD-L1 is closely related to tumor immune escape, and blocking the PD-1 / PD-L1 axis can enhance the immune system's ability to attack tumors. However, single-drug therapy often faces low response rates and drug resistance issues, so combination therapy strategies have become an important way to improve treatment effectiveness.

[0004] Albendazole (ABZ) has a molecular structure of: It has been recognized as an effective apoptosis inducer and tumor growth inhibitor. However, due to the poor water solubility of albendazole, the effective absorption of the drug in the body is limited, which reduces the clinical efficacy. Currently available research aims to solve the solubility problem or targeted delivery of albendazole to improve efficacy. SUMMARY

[0005] The first aspect of the present application aims to provide the use of albendazole in the preparation of a product for enhancing the anti-tumor effect of Oncolytic Virus M1.

[0006] The second aspect of the present application aims to provide a product.

[0007] The third aspect of the present application aims to provide the use of the product of the second aspect of the present application.

[0008] The fourth aspect of the present application aims to provide the use of OVM1 and ABZ in the preparation of a product for eliminating CTLA4 antibody resistance.

[0009] To achieve the above-mentioned purposes, the technical solutions adopted by the present application are as follows:

[0010] The first aspect of the present application provides the use of albendazole in the preparation of a product for enhancing the anti-tumor effect of oncolytic virus M1.

[0011] In some embodiments of the present application, the tumor comprises at least one of prostate cancer, glioma, melanoma, lung cancer, breast cancer, colorectal cancer, and pancreatic cancer.

[0012] In some preferred embodiments of the present application, the tumor is prostate cancer and / or glioma.

[0013] In some embodiments of the present application, the tumor is glioma.

[0014] In some embodiments of the present application, the albendazole achieves the purpose of enhancing the anti-tumor effect of oncolytic virus M1 by inhibiting the up-regulation of VEGF and / or PD-1 expression caused by oncolytic virus M1.

[0015] In some embodiments of the present application, the albendazole achieves the purpose of enhancing the anti-tumor effect of oncolytic virus M1 by improving the intratumoral infiltration and tumor-killing toxicity of lymphocytes during OVM1 oncolytic virus treatment.

[0016] In some embodiments of the present application, the source of the lymphocytes includes but is not limited to the spleen, tumor-draining lymph nodes, or intratumoral.

[0017] The second aspect of the present application provides a product comprising albendazole and oncolytic virus M1.

[0018] In some embodiments of the present application, the product comprises 0.1-3 μM albendazole and 0.01-10 MOI oncolytic virus M1.

[0019] In some preferred embodiments of the present application, the product comprises 0.1-2 μM albendazole and 0.01-5 MOI oncolytic virus M1.

[0020] In some more preferred embodiments of the present application, the product comprises 0.1-1 μΜ albendazole and 0.01-1 MOI oncolytic virus Ml.

[0021] In some embodiments of the present application, the product comprises 15-50 mg / kg albendazole and 0.5 x 10Λ8-1.5 x 10Λ8 pfu / kg oncolytic virus Ml.

[0022] In some embodiments of the present application, the product further comprises a CTLA4 antibody.

[0023] In some preferred embodiments of the present application, the product further comprises 5-15 mg / kg CTLA4 antibody.

[0024] In some more preferred embodiments of the present application, the product further comprises 5-10 mg / kg CTLA4 antibody.

[0025] In a third aspect of the present application, there is provided use of the product of the second aspect of the present application in at least one of (1)-(10):

[0026] (1) preparing an anti-tumor drug;

[0027] (2) increasing the secretion of granzyme B, IFN-γ and / or TNFα in lymphocytes;

[0028] (3) preparing a product that increases the secretion of granzyme B, IFN-γ and / or TNFα in lymphocytes;

[0029] (4) promoting apoptosis of tumor cells;

[0030] (5) preparing a product that promotes apoptosis of tumor cells;

[0031] (6) enhancing the cleavage and activation of Caspase 3;

[0032] (7) preparing a product that enhances the cleavage and activation of Caspase 3;

[0033] (8) promoting the proliferation of CD8 + T cells;

[0034] (9) preparing a product that promotes the proliferation of CD8 + T cells;

[0035] (10) preparing a product that promotes the infiltration of T cells into tumors.

[0036] In some embodiments of the present application, the tumor in (1), (4), (5) and (10) comprises at least one of prostate cancer, glioma, melanoma, lung cancer, breast cancer, colorectal cancer and pancreatic cancer.

[0037] In some preferred embodiments of the present application, the tumor is prostate cancer and / or glioma.

[0038] In some embodiments of the present application, the source of the lymphocytes of any one of (2)-(3) includes, but is not limited to, spleen, tumor-draining lymph node, or intratumor.

[0039] In a fourth aspect of the present application, there is provided an application of albendazole and oncolytic virus M1 in preparing a product for eliminating CTLA4 antibody resistance.

[0040] The beneficial effects of the present application are:

[0041] The present application first proposes to increase the therapeutic effect of OVM1 in treating tumors by ABZ, and has small toxicity and low price. It is proved by experiments that OVM1 combined with ABZ treatment significantly promotes the inhibition of tumor activity in vitro, and the anti-tumor effect of the combined treatment of immunocompetent mice is much greater than that in immunodeficient mice; further detection found that this process depends on CD8 + T cells play a synergistic anti-tumor effect. At the same time, ABZ and OVM1 combined with CTLA4 antibody not only can further enhance the anti-tumor effect, but also can overcome the resistance of ICB treatment based on CTLA4. The present application provides a new strategy for synergistic oncolytic virus treatment and overcoming ICB resistance. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 ABZ inhibits OVM1-induced VEGF expression; wherein A is the mRNA expression level of CD274 (PD-L1) in tumor tissue; B is the mRNA expression level of VEGF in tumor tissue; C is the protein expression detection result of VEGF and PD-L1; D is the gray analysis statistics in figure C.

[0043] Figure 2 OVM1 combined with ABZ synergistically inhibits the activity of part of tumors; wherein A is the activity of RM-1; B is the activity of GL261; C is the activity of B16F10; D is the activity of MC38; E is the activity of LLC; F is the activity of EMT6; G is the activity of KPC1199; H is the activity of Pan02.

[0044] Figure 3OVM1 combined with albendazole promotes tumor cell apoptosis; wherein, A is the protein expression of Cleaved Caspase-3 after RM-1 cells are treated with 0.01 MOI of OVM1 and different concentrations (0.3 μM and 1 μM) of ABZ for 24 h; B is the protein expression of Cleaved Caspase-3 after GL261 cells are treated with 0.1 MOI of OVM1 and different concentrations (0.3 μM and 1 μM) of ABZ for 24 h; C is the gray scale statistical analysis of Figure A; D is the gray scale statistical analysis of Figure B; E is the flow cytometry detection of Annexin V and PI positive rates; F~G are the data statistics of Figure E.

[0045] Figure 4 OVM1 combined with ABZ significantly inhibits the growth of tumors in immune-competent mice; wherein, A is the administration mode diagram of RM-1 or GL261 immune-competent mouse subcutaneous tumor model; B is the tumor growth curve diagram of RM-1 tumor-bearing mice, n = 6 for the ABZ group and n = 7 for the other three groups; C is the tumor growth curve diagram of GL261 tumor-bearing mice, n = 7; D is the survival curve diagram of RM-1 tumor-bearing mice, n = 6 for the ABZ group and n = 7 for the other three groups; E is the survival curve diagram of GL261 tumor-bearing mice, n = 7; F is the tumor display diagram of RM-1 tumor-bearing mice, n = 8; G is the tumor weight statistical diagram of RM-1 tumor-bearing mice, n = 8; H is the tumor display diagram of GL261 tumor-bearing mice, n = 5; I is the tumor weight statistical diagram of GL261 tumor-bearing mice, n = 5.

[0046] Figure 5 OVM1 combined with ABZ has good anti-tumor activity; wherein, A is the tumor relative growth rate (T / C%) of RM-1 tumor-bearing mice, n = 6 for the ABZ group and n = 7 for the other three groups; B is the tumor relative growth rate (T / C%) of GL261 tumor-bearing mice, n = 7.

[0047] Figure 6 OVM1 combined with ABZ has no damaging effect on the liver and kidney of immune-competent mice, and the mouse liver and kidney HE staining diagram observed under a microscope at 4x magnification.

[0048] Figure 7 ABZ has no obvious synergistic effect on OVM1 treatment in immune-deficient mice; wherein, A is the tumor growth curve of RM-1 tumor-bearing nude mice, n = 6; B is the tumor growth curve of GL261 tumor-bearing nude mice, n = 6; C is the survival curve of RM-1 tumor-bearing nude mice, n = 6; D is the survival curve of GL261 tumor-bearing nude mice, n = 6; E is the body weight curve diagram of RM-1 tumor-bearing nude mice, n =; F is the body weight curve diagram of GL261 tumor-bearing nude mice, n = 6.

[0049] Figure 8OVM1 and ABZ combination enhanced the tumor killing effect of lymphocytes; wherein, A is a schematic diagram of lymphocytes co-cultured with tumor cells; B is MTT method for detecting the tumor toxicity of lymphocytes in RM-1 tumor-bearing mice, n = 6; C is MTT method for detecting the tumor toxicity of lymphocytes in GL261 tumor-bearing mice, n = 6.

[0050] Figure 9 OVM1 combined with ABZ treatment enhanced the secretion of lymphocyte killing factors; wherein, A is ELISA detection of the secretion of cytotoxic factors IFN-γ, granzyme B and TNF-α in the supernatant of co-culture of spleen draining lymphocytes and tumor; B is ELISA detection of the secretion of cytotoxic factors IFN-γ and granzyme B in the supernatant of co-culture of lymphocytes and tumor in tumor draining lymph nodes; C is ELISA detection of the secretion of TNF-α in the supernatant of co-culture of lymphocytes and tumor in tumor draining lymph nodes.

[0051] Figure 10 ABZ promoted the infiltration of CD8 + T cells in OVM1 treated mice tumor and spleen; wherein, A is the proportion of CD45 + CD3 + T and CD8 + T cells in tumor cells; B is the proportion of ki67 + CD8 + T cells in tumor cells; C is the mean fluorescence intensity of two indicators of CD8 + T cell activation in tumor, CD44 and CD69; D is the mean fluorescence intensity of two indicators of CD8 + T cell exhaustion in tumor, CTLA4 and PD1; E is the proportion of CD45 + CD3 + T and CD8 + T cells in spleen; F is the proportion of ki67 + CD8 + T cells relative to spleen cells; G is the mean fluorescence intensity of CD8 + T cell CD44 and CD69 in spleen, which are two indicators of CD8 + T cell activation; H is the mean fluorescence intensity of two indicators of CD8 + T cell exhaustion in spleen, CTLA4 and PD1.

[0052] Figure 11ABZ can regulate the expression of anti-tumor immune related genes in the tumor tissues of C57BL / 6 mice treated with OVM1; wherein, A is the mRNA expression level of T cell related chemotactic factor; B is the mRNA expression level of T cell activation related genes (including IL-12 or IFNG); C is the mRNA expression level of immune suppression related genes, including VEGF, Arg1 and IL-6.

[0053] Figure 12 ABZ combined with OVM1 can relieve the drug resistance of CTLA4 antibody treatment; wherein, A is the tumor growth curve of different groups of RM-1 tumor-bearing mice, n = 7; B is the tumor survival curve of different groups of RM-1 tumor-bearing mice, n = 7; C is the tumor growth curve of each mouse, n = 7.

[0054] Figure 13 ABZ combined with OVM1 can relieve the drug resistance of CTLA4 antibody treatment; wherein, A is the tumor growth curve of different groups of RM-1 tumor-bearing mice, n = 7; B is the tumor survival curve of different groups of RM-1 tumor-bearing mice, n = 7; C is the tumor growth curve of each mouse, n = 7.

[0055] Figure 14 ABZ can significantly down-regulate the expression of PD-1 on CD8 + T cells in a dose-dependent manner; wherein, A is the fluorescence intensity of CD8 + T cell surface PD-1 of activated T cells co-cultured with tumor cells (E:T = 2.5) treated with albendazole, detected by flow cytometry; B is the fluorescence intensity of CD8 + T cell surface PD-1 of activated T cells co-cultured with tumor cells (E:T = 2.5) treated with albendazole, detected by flow cytometry. DETAILED DESCRIPTION

[0056] The content of the present application will be further described in detail by specific examples.

[0057] It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application.

[0058] In order to make the purpose, technical solutions and advantages of the embodiments of the present application more clear, the technical solutions in the embodiments of the present application will be described clearly and completely. The specific conditions not mentioned in the embodiments are carried out according to the conventional conditions or the conditions suggested by the manufacturer. The reagents or instruments not mentioned by the manufacturer are all conventional products that can be purchased in the market.

[0059] The features and properties of the present application will be further described in detail in the following examples.

[0060] The cell lines used in the examples: RM-1 mouse prostate cancer cell line, B16F10 mouse melanoma cell line, LLC mouse non-small cell lung cancer cell line, EMT6 breast cancer cell line were purchased from Guangzhou Sike Biotechnology Co., Ltd., MC38 mouse colorectal cancer cell line and Pan02 mouse pancreatic cancer cell line were purchased from Guangzhou Genview Biotechnology Co., Ltd. GL261 was from Tianjin Medical University, and KPC1199 was from Shanghai Jiaotong University.

[0061] The OVM1-GFP virus (denoted M1-GFP) used in the cell experiments is a virus strain in which the natural alphavirus M1 genome is genetically modified to express jellyfish green fluorescent protein (GFP) in our laboratory. The OVM1 used in animal experiments was provided by Guangzhou Wiliansu Pharmaceutical Technology Co., Ltd. Albendazole drug was purchased from MCE, with the item number HY-B0223.

[0062] The antibodies used in the examples Caspase3 Antibody, Cleaved Caspase3 Antibody, GAPDH (14C10) Rabbit mAb were purchased from Cell Signaling Technology; Anti-VEGF Antibody, Goat Anti-Mouse IgG (H+L) were purchased from Abeam, PDL1 / CD271 Monoclonal Antibody, HRP-conjugated Affinipure Goat Anti-Rabbit were purchased from Proteintech; InVivoMAb anti-mouse CTLA-4 (CD152), InVivoMAb mouse IgG2b isotype control were purchased from Bioxcell; CD45 Monoclonal Antibody (30-F11), FITC, eBioscience TM , CD4 Monoclonal Antibody (GK1.5), APC-eFluor TM 780, eBioscience TM , CD11b Monoclonal Antibody (M1 / 70), APC-eFluor TM 780, eBioscience TM , F4 / 80 Monoclonal Antibody (BM8), PE-Cyanine7, eBioscience TMCD163 Monoclonal Antibody (TNKUPJ), APC, eBioscience TM Invitrogen; PerCP / Cyanine 5.5 anti-mouse CD3 epsilon Antibody, Brilliant Violet 650 TM anti-mouse CD80 Antibody, PE / Cyanine 7 anti-mouse / human CD44 Antibody, APC anti-mouse CD69 Antibody, PE anti-mouse CD274 (B7-H1, PD-L1) Antibody, Brilliant Violet 650 TM anti-mouse / human Ki-67 Antibody, Brilliant Violet 421 TM anti-mouse CD274 (B7-H1, PD-L1) were purchased from Biolegend; BD Horizon TM PE-CF594 Rat Anti-Mouse CD279 (PD-1), BD Pharmingen TM PE Rat anti-Mouse Foxp3 Brilliant Violet 605 TM anti-mouse CD152 Antibody, Purified Rat Anti-Mouse CD16 / CD32 (Mouse BD Fc Block™) were purchased from BD.

[0063] The 6-8-week-old immunocompetent mice C57BL / 6J used in the animal experiments were purchased from Guangdong Medical Laboratory Animal Center (Laboratory Animal Production License SCXK (Yue) 2023-0067) and were raised in the SPF barrier environment of Leikang (Guangzhou) Technology Co., Ltd.

[0064] Primer sequences in the examples:

[0065] CD274-F / R (5'-3'): TGCTGCATAATCAGCTACGG (SEQ ID NO: 1) / ATGCTCAGAAGTGGCTGGAT (SEQ ID NO: 2);

[0066] VEGF-F / R (5'-3'): ATTAACCATGTGCCCGAGAA (SEQ ID NO: 3) / TCTTGCAAACTGCAGGAATG (SEQ ID NO: 4);

[0067] GAPDH-F / R (5'-3'): CATCACTGCCACCCAGAAGACTG (SEQ ID NO: 5) / ATGCCAGTGAGCTTCCCGTTCAG (SEQ ID NO: 6);

[0068] Q3S1-F / R (5'-3'): GGGATTCACTACACCTGCTTAGAC (SEQ ID NO: 7) / GCTGACTCTGTCTGCGTAACC (SEQ ID NO: 8);

[0069] CXCL9-F / R (5'-3'): ACGGAGATCAAACCTGCCTA (SEQ ID NO: 9) / TTTTCCCCCTCTTTTGCTTT (SEQ ID NO: 10);

[0070] CXCL10-F / R (5'-3'): AAGTGCTGCCGTCATTTTCT (SEQ ID NO: 11) / GTGGCAATGATCTCAACACG (SEQ ID NO: 12);

[0071] CXCL11-F / R (5'-3'): AGCTGCTCAAGGCTTCCTTA (SEQ ID NO: 13) / CTGCATTATGAGGCGAGCTT (SEQ ID NO: 14);

[0072] IL-12-F / R (5'-3'): GCAGTAGCAGTTCCCCTGAC (SEQ ID NO: 15) / AGTCCCTTTGGTCCAGTGTG (SEQ ID NO: 16);

[0073] IL-6-F / R (5'-3'): CCGGAGAGGAGACTTCACAG (SEQ ID NO: 17) / CAGAATTGCCATTGCACAAC (SEQ ID NO: 18).

[0074] Example 1 OVM1 in combination with albendazole inhibits tumor activity

[0075] Cell treatment: RM-1, GL261, B16F10, LLC, MC38, EMT6, KPC1199 and Pan02 cells in logarithmic growth phase were selected and seeded at 2000 cells per well in 48-well plates for overnight culture. On the second day, 0.01 MOI of M1-GFP was added to RM-1, EMT6 and Pan02 cells, 0.1 MOI of OVM1-GFP was added to GL261, LLC and KPC1199 cells, 10 MOI of M1-GFP was added to MC38 cells, and 0.0001 MOI of M1-GFP was added to B16F10 cells. All cells were treated with different concentrations of albendazole (0.1 μM, 0.3 μM and 1 μM) for 48 h, and cell viability was detected by MTT.

[0076] MTT method for detecting cell viability: After OVM1 and albendazole treatment for 48 h, the supernatant was discarded, and the MTT stock solution (10x) was diluted with RPMI1640 medium or DMEM medium (according to the specific medium used for the cells) to 1x MTT solution. 200 μL of 1x MTT solution was added to each well, and incubation was performed in a 37°C incubator for 2 h. Since succinate dehydrogenase in living cells can oxidize MTT to formazan, blue-purple crystals can be observed on the bottom of the well. The liquid in the well was carefully aspirated, 200 μL of DMSO was added to each well to dissolve the blue-purple crystals, and the mixture was placed in a microplate shaker for 3-5 min to fully dissolve the crystals. The OD value at 490 nm was detected by a microplate reader.

[0077] Western blotting method for detecting protein expression level in tumor cells: RM-1 and GL261 cells in logarithmic growth phase were selected and seeded at 50x10 4 cells per well in 6-well plates for overnight culture. On the second day, 0.01 MOI of M1-GFP was added to RM-1, and 0.1 MOI of M1-GFP was added to GL261. At the same time, 0.3 μM and 1 μM of albendazole were added for 24 h. The supernatant was collected in a 2 mL centrifuge tube, and after centrifugation at 1600 rpm and 4°C for 5 min, the supernatant was discarded. The cells in the 6-well plate were washed with cold PBS for 2 times, and 100 μL of RIPA containing protease inhibitors was added to each well for lysis at 4°C for 2 min. The sample was added to the corresponding centrifuge tube, 25 μL of 5x loding buffer was added, and after vortex mixing, the mixture was heated in a metal bath at 100°C for 5 min, and then stored at -20°C.

[0078] Immunoblotting to detect protein expression: Equal amount of protein was added into pre-made gel in electrophoresis solution for protein separation, after transfer, 5% milk was used to block for 1 hour, the corresponding protein to be detected was incubated with prepared primary antibody, incubated overnight at 4℃, and the primary antibody was recovered. The PVDF membrane was placed on a shaker and washed with TBST for 5 times, 5 min each time. After incubating the corresponding secondary antibody at room temperature for 1 hour, the PVDF membrane was placed on a shaker and washed with TBST for 5 times, 5 min each time. Chemiluminescence solution was added on the PVDF membrane to detect the protein expression level in the developer.

[0079] Flow cytometry to detect apoptosis: 10000 cells of RM-1 and GL261 in logarithmic growth phase were inoculated in a 12-well plate overnight, on the second day, 0.01 MOI of M1-GFP was added to the RM-1 cells, and 0.1 MOI of M1-GFP was added to the GL261 cells, at the same time, they were treated with 0.3 μM and 1 μM of albendazole for 48 hours. After trypsin digestion, the cells were collected in a flow tube, centrifuged at 500 x g, 4℃ for 5 min, the supernatant was discarded, and the cells were washed once with PBS, and then resuspended with 200 μL of PBS. Staining was performed using Annexin V-APC / PI Apoptosis Kit (Lianke Biological Technology Co., Ltd.), 5 μL of Annexin V and 10 μL of PI were added to each tube, and staining was performed at room temperature for 5 min in the dark, and then flow cytometry was used for direct detection.

[0080] qPCR: Real-time quantitative PCR kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used according to the instructions.

[0081] Results:

[0082] The experimental results found that the mRNA expression levels of VEGF and PDL1 in tumor tissues were significantly up-regulated in the early stage of oncolytic virus M1 treatment (3 days) Figure 1 A and B). We detected RM-1 cells treated with OVM1 combined with ABZ in vitro, and found that OVM1 could indeed up-regulate the expression of VEGF protein, ABZ alone could significantly inhibit the expression of VEGF in tumor cells, and the combination could significantly reduce the up-regulation of VEGF by OVM1, but had no significant effect on the protein expression level of PDL1 Figure 1 C and D). This suggests that oncolytic virus combined with ABZ may enhance the anti-tumor effect. Further evaluation in vitro whether the combination of OVM1 and ABZ enhances the inhibition of tumor cell viability. MTT experiment was performed on tumor cells treated with OVM1 or ABZ, and it was found that OVM1 or ABZ alone could effectively inhibit the activity of brain glioma GL261 or prostate cancer RM-1, especially ABZ alone showed dose-dependent inhibitory activity on the two cell lines Figure 2(A and B). The combination of ABZ further enhanced the inhibitory effect of OVM1 on both tumor cell lines in a dose-dependent manner. Figure 2 (A and B). For melanoma B16F10, colon cancer MC38, non-small cell lung cancer LLC, breast cancer EMT6, pancreatic cancer KPC1199, and pancreatic cancer Pano2, both OVM1 infection and ABZ treatment significantly inhibited tumor activity; however, combination therapy was not more effective than monotherapy in inhibiting tumor activity. Figure 2 (C, D, E, F, G, and H). This indicates that different tumor types have varying sensitivities to the synergistic effect of OVM1 combined with ABZ in inhibiting tumor activity.

[0083] The effects of OVM1 combined with ABZ on tumor cell apoptosis were investigated. Caspase-3 is the most crucial effector protease in the apoptosis signaling pathway; cleavage and activation of Caspase-3 indicate the onset of apoptosis. We examined the cleavage of Caspase-3 protein in tumor cells by OVM1 combined with ABZ. The results showed that treatment of RM-1 or GL261 tumor cells with OVM1 or ABZ alone significantly promoted the expression of cleaved Caspase-3 protein, and combined treatment further enhanced the expression level of cleaved Caspase-3 protein. Figure 3 (A, B, C, and D). This indicates that OVM1 combined with ABZ treatment of tumor cells can indeed enhance the cleavage and activation of Caspase 3. Further examination of Annexin V expression in tumor cells was conducted. The results showed that 48 hours after combined treatment with OVM1 and ABZ, the percentage of Annexin V-positive cells was significantly higher than that treated with OVM1 or ABZ alone, and this was dose-dependent. Figure 3 (E, F, and G). These results indicate that both OVM1 and ABZ alone can induce tumor cell apoptosis, and the combination of the two further enhances tumor cell apoptosis.

[0084] Example 2: OVM1 combined with ABZ treatment significantly inhibited tumor growth in mice.

[0085] Establishment of animal tumor models

[0086] Cell preparation: When the cells are in the logarithmic growth phase, the cells are trypsinized for about 30 seconds, and after the cells are partially detached from the bottom of the culture dish, the digestion is terminated with the complete RPMI 1640 medium or the complete DMEM medium corresponding to the cell culture, and then the cells are centrifuged at 500g for 5 minutes, the supernatant is discarded, and the cells are resuspended in RPMI-1640 or DMEM medium without 10% FBS, 100 μg / mL streptomycin, and 100 U / mL penicillin. The cells are counted using an automatic cell counter, and the RM-1 mouse prostate cancer cell suspension is adjusted to 3 x 10 7 cells / mL with 1640 medium, and the GL261 mouse glioma cell suspension is adjusted to 1 x 10 7 cells / mL with DMEM medium.

[0087] Subcutaneous tumor inoculation: First, the cell suspension is thoroughly mixed, and the right back of an 8-week-old C57 BL / 6 mouse or a nude mouse is inoculated with the cell suspension, 100 μL of the cell suspension is injected into each mouse, i.e., 3 x 10 6 cells / mouse of RM-1 mouse prostate cancer and 1 x 10 6 cells / mouse of GL261 mouse glioma.

[0088] Grouping of tumor-bearing mice and treatment regimen: After tumor inoculation, the mice are observed for tumor formation, and about 3 days after tumor inoculation, the tumor length (A) and width (B) are carefully measured using a vernier caliper, and the tumor volume is calculated according to the following formula: Tumor volume = A x B 2 / 2. When the average tumor volume of the mice is 50 mm 3 ~ 100 mm 3 , the mice are randomly divided into the Control group, the OVM1 treatment group, the ABZ treatment group, and the combination group. The Control group is not treated. The OVM1 treatment group is injected with OVM1 300 μL (dose: 3 x 10 6 pfu / mouse) via the tail vein once a day, and after 5 days of continuous treatment, the tumor-bearing mice are continued to be raised. The ABZ treatment group is injected with 200 μL (dose: 50 mg / mL / mouse) intraperitoneally once every two days until the tumor reaches the humane endpoint (2000 mm 3 ), and then the administration is stopped. The combination group is injected with OVM1 300 μL (dose: 3 x 10 6pfu / mouse) once daily for 5 consecutive days, while intraperitoneally injecting 200 μL ABZ (dosing dose 50 mg / mL / mouse) once every other day until the mice reached the humane endpoint (tumor volume of 2000 mm 3 ) and drug administration was stopped, and the mice were executed by cervical dislocation. During this period, the tumor volume was measured every other day.

[0089] Relative tumor proliferation rate T / C ratio: According to the measured results, the relative tumor volume (RTV) was calculated, and the calculation formula was: RTV = V t / V0. Wherein V0 is the tumor volume measured at the time of caging (i.e. D0), and Vt is the tumor volume at each measurement. The evaluation index of anti-tumor activity is the relative tumor proliferation rate T / C (%), and the calculation formula is: T / C = T RTV / C RTV × 100% (TRTV: RTV of the treatment group; CRTV: RTV of the negative control group). The evaluation criteria are: T / C (%) > 40% is invalid; T / C (%) ≤ 40%, and P < 0.05 by statistical processing is effective.

[0090] HE staining: On the 7th day after the mice were treated in the above manner, the mice were executed, and the mouse liver and kidney tissues were stripped and soaked in 4% paraformaldehyde for fixation. The tissues were sent to the company for paraffin embedding, slicing, and then HE staining was performed, and then observed and photographed under a microscope

[0091] Statistical method: All data were statistically analyzed and plotted using Graphpad Prism 8.0 software. Quantitative data produced in this study that meet the normal distribution and variance homogeneity are expressed as mean ± standard deviation. The comparison of two groups of data uses t test or one-way ANOVA. P < 0.05 is considered to have statistical difference, * represents P < 0.05, ** represents P < 0.01, *** represents P < 0.001, and **** represents P < 0.0001.

[0092] Results:

[0093] To verify whether OVM1 and ABZ have anti-tumor effects in mice, we evaluated their anti-tumor effects on RM-1 and GL261 using immunocompetent mouse models. The schematic diagram of drug treatment is shown in Figure 4 A. Drug administration started on the 7th day after tumor inoculation. It was found that in the two models tested, the tumor growth of mice treated with OVM1 or ABZ alone could be significantly inhibited, and the combination of OVM1 and ABZ further delayed the growth rate of RM-1 or GL261 tumors Figure 4(B and C). Meanwhile, we recorded the humane survival of mice with RM-1 and GL261 after OVM1 combined with ABZ treatment. We found that OVM1 or ABZ alone significantly prolonged the median survival of RM-1 tumor-bearing mice, and the combination of both further prolonged the median survival. Figure 4 (D and E). Next, the study demonstrated tumor growth and weight after treatment with OVM1 in combination with ABZ, finding that both OVM1 and ABZ alone significantly reduced the weight of RM-1 or GL261 tumors. OVM1 combined with ABZ further reduced the weight of both types of tumors compared to monotherapy. Figure 4 The results (F~I) are consistent with the tumor quantification curve results mentioned above. This indicates that the combined use of ABZ can indeed further enhance the antitumor efficacy of OVM1 in immunocompetent mice.

[0094] The evaluation index for antitumor activity was the relative tumor proliferation rate (T / C%). The results showed that in RM-1 ( Figure 5 (A) and GL261 ( Figure 5 In the B) model, the T / C ratio of mice treated with OVM1 or ABZ alone exceeded 40% on any day. However, the T / C ratio after combined treatment with OVM1 and ABZ did not exceed 40%, which was significantly better than either OVM1 or ABZ alone. This indicates that OVM1 combined with ABZ has good antitumor activity.

[0095] Many chemotherapy drugs damage the liver or kidneys to varying degrees during tumor treatment. The presence or absence of liver and kidney damage is an indicator of whether the drug has serious side effects. Therefore, we further evaluated whether there was significant damage to the liver and kidney tissues of immunocompetent mice after combined treatment with OVM1 and ABZ following tumor-bearing mice. Hematoxylin and eosin (HE) staining was performed on the liver and kidney tissues of each treated group of mice. Compared with the control group, the liver and kidney tissues of mice treated with OVM1 alone, ABZ alone, or in the combined treatment group remained intact in morphology and structure, without lesions. Figure 6 This indicates that OVM1 combined with ABZ has no significant toxic side effects in mice when used to treat tumors.

[0096] To further evaluate whether the enhanced antitumor efficacy of ABZ against OVM1 depends on enhanced antitumor immunity, we conducted experiments using athymic nude mice inoculated with RM-1 or GL261 tumors. Figure 4 The same grouping and administration methods were used in group A. Results showed that OVM1 alone significantly inhibited the growth of RM-1 or GL261 tumors in nude mice. ABZ alone had no inhibitory effect on RM-1-bearing nude mice, but significantly inhibited tumor growth in GL261-bearing nude mice. Figure 7B). OVM1 combined with ABZ treatment showed a trend of enhanced tumor inhibition compared with single treatment group, but it was not statistically significant. Therefore, the combination of ABZ and OVM1 did not significantly improve the tumor inhibition effect in RM-1 or GL261 tumor-bearing nude mice. At the same time, OVM1 combined with ABZ did not significantly prolong the median survival of RM-1 tumor-bearing nude mice compared with OVM1 alone Figure 7 C). Compared with the treatment effect of RM-1 tumor-bearing mice in immunocompetent mice, there was no significant combination treatment effect in nude mice, indicating that anti-tumor immunity plays an important role in the RM-1 model. In the GL261 nude mouse model, OVM1 or ABZ alone did not significantly prolong the median survival of tumor-bearing mice compared with the untreated group. However, the median survival was significantly prolonged after combination therapy compared with OVM1 or ABZ alone Figure 7 D). However, its treatment effect was weaker than that of GL261 tumor-bearing mice in immunocompetent mice. This indicates that anti-tumor immunity may be involved in the treatment of GL261. The body weight of mice remained stable during the treatment of OVM1 and ABZ in these two tumors, indicating that OVM1 combined with ABZ treatment had no significant side effects on mice, which is consistent with the non-toxic side effects of liver and kidney in immunocompetent mice Figure 7 E and F). The results of the above studies show that the anti-tumor effect of OVM1 combined with ABZ varies in different tumors, with direct drug killing and the participation of anti-tumor immunity.

[0097] Example 3 ABZ enhances the tumor-killing toxicity of lymphocytes during OVM1 oncolytic virus treatment

[0098] This example establishes a subcutaneous tumor-bearing model in immunocompetent mice. After combination therapy, lymphocytes are isolated and co-cultured with tumor cells to evaluate the killing effect of lymphocytes on tumor cells. Further, by detecting the toxic killing factors secreted by lymphocytes, the reason for the enhanced killing function of lymphocytes is verified. The specific experimental process is as follows:

[0099] Tumor cell subculture, establishment of animal tumor model, grouping of tumor-bearing mice and treatment regimen, MTT detection of cell activity are the same as in Examples 1-2.

[0100] Lymphocyte cytotoxicity assay: RM-1 / GL261 tumor cells were seeded at 5000 cells / well in 48-well plates overnight. Isolated lymphocytes (isolated from the mice in the above experiment using conventional methods) were co-cultured with the same tumor cells at E:T = 25:1, 20:1 or 10:1 overnight for 48 h, and wells without lymphocytes (only tumor cells) were set up in parallel as controls. After 48 h of co-culture, the supernatant of each group of co-cultured cells was collected, centrifuged at 500 g for 5 min, and the supernatant after centrifugation was removed and stored at -80°C. After removing the supernatant from the co-culture wells, the cells on the plate were washed with PBS, and the lymphocytes and dead cells were washed away, and washed twice. After washing, 10% MTT solution was added to the wells in double RPMI 1640 medium (i.e. the MTT treatment concentration was 1 mg / mL), and incubated in the cell incubator for 2 h. After incubation, the plates were placed in an enzyme-linked immunosorbent assay instrument, and the absorbance of each well was measured at OD 490 nm. Lymphocyte cytotoxicity = (A 肿瘤细胞 -A 肿瘤细胞 + lymphocytes) / (A 肿瘤细胞 ) x 100%

[0101] The contents of toxic cytokines (IFN-γ, granzyme B and TNF-α) and tumor necrosis factor (TNF-α) in the co-culture supernatant were detected by ELISA.

[0102] Statistical method: All data were analyzed and plotted using Graphpad Prism 8.0 software, and the comparison between multiple groups in this study was analyzed by one-way ANOVA, P<0.05 was considered to be statistically different, * represents P<0.05, ** represents P<0.01, *** represents P<0.001, **** represents P<0.0001, and ns represents no difference.

[0103] Results:

[0104] To further investigate whether OVM1 combined with ABZ treatment enhances the ability of T cells to kill tumor cells in vivo, we isolated lymphocytes from the spleen and tumor-draining lymph nodes (TDLN) of tumor-bearing mice (RM-1 or GL261 cell implanted) on day 10 after oncolytic virus combined with ABZ treatment, and co-cultured them with the corresponding tumor cells in vitro for 48 h Figure 8 A). Subsequently, the killing ability of lymphocytes was evaluated by MTT assay of tumor cell activity. It was observed that the tumor toxicity of lymphocytes from the spleen and TDLN of mice was significantly enhanced after treatment with OVM1 alone, and further significantly enhanced after treatment with ABZ in combination Figure 8(B and C). Except for lymphocytes in the spleen of RM-1 tumor-bearing mice, lymphocytes treated with ABZ alone also showed significantly enhanced tumor toxicity. Figure 8 (B and C). This result further confirms the activating effect of ABZ on lymphocytes. Moreover, after OVM1 combined with ABZ treatment, almost all lymphocyte samples showed further enhanced tumor-killing cytotoxicity compared with ABZ treatment alone, and the higher the E:T ratio, the stronger the killing rate. Figure 8 (B and C). This indicates that the combination of OVM1 and ABZ enhances the anti-tumor effect by increasing the killing effect of T cells.

[0105] Interferon-gamma (IGG) and granzyme B are the most recognized immunotoxic factors used by lymphocytes to eliminate tumors. The secretion of these two factors in the supernatant of co-culture samples from each group was detected using ELISA. The results showed that in the co-culture experiment, OVM1 treatment alone increased the secretion of granzyme B and IFN-γ in the spleen and TDLN-derived lymphocytes of RM-1 tumor-bearing mice, and ABZ combination treatment further increased this secretion. Figure 9 (A and B). Tumor necrosis factor (TNF-α) can also directly kill tumor cells by inducing apoptosis. Interestingly, although neither OVM1 treatment alone nor ABZ treatment alone could affect TNF-α levels in spleen-derived lymphocytes, their combination therapy could significantly enhance TNF-α secretion. Figure 9 (A). When TDLN-derived lymphocytes kill tumors, OVM1 alone can significantly increase TNF-α secretion (E:T = 100:1), and combined use with ABZ can further significantly enhance TNF-α secretion. Figure 9 (C)

[0106] Example 4: OVM1 combined with ABZ promotes the infiltration and proliferation of T cells in tumor and spleen tissues.

[0107] This embodiment established a subcutaneous tumor-bearing mouse model with intact immune systems. By detecting the number and function of T cells in different tissues, the effect of combined treatment on in vivo anti-tumor T cell immunity was explored, thereby further identifying the potential mechanism by which ABZ enhances OVM1 anti-tumor immunity in vivo, as detailed below:

[0108] The establishment of the mouse subcutaneous model was the same as that of the animal tumor model in Example 2.

[0109] Grouping and treatment of tumor-bearing mice: After tumor inoculation, the tumor formation in mice was observed. The length (A) and width (B) of the tumor were carefully measured using calipers. The tumor volume was calculated using the following formula: Tumor volume = A × B 2 / 2. Wait for the average tumor volume in mice to grow to 50 mm.3 ~100 mm 3 The mice were randomly divided into the following groups: Control group, OVM1 treatment group, ABZ treatment group, and combination group. The Control group was not treated. The OVM1 treatment group was injected with OVM1 300 μL (dose: 3 x 10 6 pfu / mouse) via the tail vein once a day, and the tumor-bearing mice were continuously bred after 5 days of continuous treatment. The ABZ treatment group was injected with 200 μL (dose: 50 mg / mL / mouse) via the abdominal cavity once every two days. The combination group was injected with OVM1 300 μL (dose: 3 x 10 6 pfu / mouse) via the tail vein once a day, and 200 μL of ABZ (dose: 50 mg / mL / mouse) was injected via the abdominal cavity once every two days. The first day of administration was considered Day 1, and the samples were taken on Day 10 of treatment. The immune cell infiltration and phenotype were detected by flow cytometry.

[0110] Flow cytometry detection of cells:

[0111] (1) Lysis of red blood cells: The tumor single-cell suspension, spleen single-cell suspension, and blood obtained by separation were placed in a flow tube and centrifuged at 500 g for 5 min. After centrifugation, the supernatant was discarded, and 3 times the volume of red blood cell lysis solution was added, mixed well, and incubated at room temperature for 5 min. Then, the cells were centrifuged at 500 g for 5 min. After centrifugation, the supernatant was discarded, and 3 mL of PBS was added to resuspend the cells, which were then centrifuged at 500 g for 5 min. After centrifugation, the supernatant was discarded, and the cells were ready for the next step.

[0112] (2) Tumor suspension staining with dead / live dye: 3 mL of PBS was added, and the cells were centrifuged at 500 g for 5 min and washed once; the cells were resuspended in PBS, and the concentration of the cell suspension was adjusted to 1-10 x 10 6 cells / mL. 1 μL of dead / live dye (1:1000) was added to each 1 mL of cell suspension, mixed well, and incubated at room temperature for 15 min; then, the cells were washed twice with PBS containing 2% FBS and once with PBS without FBS. The centrifugation conditions were 500 g for 5 min.

[0113] (3) Flow cytometry blocking antibody incubation: According to the recommended dilution ratio in the instructions, the CD26 / CD32 blocking antibody was diluted with PBS, mixed in 100 μL / tube, and added to the cells for blocking, mixed well, and incubated at 4°C for 15 min. The cells were washed once with PBS.

[0114] (4) Flow cytometry staining of cell surface antibodies: Discard the supernatant, and dilute the CD45, CD3, CD8, CD4, CD11b, CD80, CD163, CD69, CD44, CD25, PDL1, PD1, and CTLA4 flow cytometry antibodies with PBS according to the dilution ratio recommended in the manufacturer's instructions. Mix 100 μL / tube, add the solution to the flow cytometry tube to resuspend the cells, and incubate at 4°C in the dark for 30 min. Add 1 mL of PBS, centrifuge at 500 g for 5 min at 4°C, and repeat the washing twice.

[0115] (5) Flow cytometry gating strategy: Flow cytometry gating analysis was performed using CyExpert software, which is compatible with the Beckman flow cytometer.

[0116] qPCR detection: Same as in Example 1.

[0117] Statistical method: Same as in Example 2.

[0118] result:

[0119] To elucidate the immune mechanism by which ABZ enhances the antitumor effect of OVM1, this study used flow cytometry to analyze immune cells in tumor tissues of mice subcutaneously inoculated with RM-1 tumors. The results showed that during OVM1 treatment, ABZ combination therapy significantly increased the number of T cells in the tumor, particularly CD8 cells. + T cells ( Figure 10 (A). Consistent with this, ABZ increased CD8 levels during OVM1 treatment. + Ki67 in T cells + Cell ratio ( Figure 10 (B). These results suggest that ABZ may promote CD8 during OVM1 treatment. + T cell proliferation. CD8+ in mice treated with a combination of ABZ and OVM1. + In T cells, the expression of CD44 and CD69 is significantly increased. Figure 10 In the middle C), PD1 expression was significantly reduced, while CTLA4 expression remained unchanged. Figure 10 (D). This indicates that CD8 in TME + The function of T cells has improved.

[0120] The spleen, as the largest peripheral immune organ in the human body, plays a crucial role in the body's defense system, especially in anti-tumor immunity. Therefore, this embodiment further investigated the proportion of T cells in the spleen and found that during OVM1 treatment, ABZ combination therapy did not affect the number of T lymphocytes and CD8+ cells in the spleen. + The proportion of T cells ( Figure 10 (E). However, after combination therapy with ABZ, CD8 + Ki67 in T cells +The proportion of cells increased significantly Figure 10 Meanwhile, combination therapy also upregulated the expression of immune checkpoint molecule CTLA4 in the tumor microenvironment Figure 10 H). Similar to the situation in the tumor microenvironment, the proportion of CD8 + T cells in the spleen was not changed after ABZ combination therapy Figure 10 H). However, the activation markers CD44 and CD69 did not show significant changes Figure 11 G).

[0121] In summary, during OVM1 treatment, combination therapy with ABZ can stimulate an increase in the number of T cells in the tumor microenvironment, especially CD8 + T cells. The detection of molecular markers showed that ABZ combination therapy can reduce the exhaustion of CD8 + T cells in the tumor (PD1) and promote their proliferation (Ki67) and activation indicators (CD44 and CD69). The spleen showed an increase in CTLA4, the proportion of T cells was unchanged, and the levels of activation markers such as CD44 and CD69 were stable. This suggests that there may be a negative feedback regulation within the spleen secondary to the overactivation of immune cells.

[0122] Since OVM1 combined with ABZ significantly promoted the infiltration of T cells, it enhanced the anti-tumor effect. Chemokines and cytokines play a crucial role in anti-tumor immunity. Therefore, this example analyzed the mRNA expression of these genes in the tumor. The results showed that, in addition to ABZ treatment alone increasing the expression level of CXCL10, neither OVM1 treatment alone nor ABZ treatment alone significantly affected the expression of T cell-related chemokines Figure 11 A). However, during OVM1 treatment, the combination therapy of ABZ significantly enhanced the expression of CXCL11, which has been shown to be a more potent CXCR3 ligand than CXCL9 and CXCL10 Figure 11 A). IL-12 can exert an anti-tumor effect by inducing T cells to produce IFN-γ. Further detection of the mRNA expression of IL-12 and IFN-γ in tumor tissue found that either OVM1 treatment alone or ABZ treatment alone can enhance the expression of IL-12 or IFN-γ. However, the combination therapy did not further improve the expression levels of these genes Figure 11Figure 6. IL-6 expression in tumor tissues. (A) IL-6 expression in tumor tissues was evaluated by qRT-PCR. (B) IL-6 expression in tumor tissues was evaluated by ELISA. (C) IL-6 expression in tumor tissues was evaluated by flow cytometry. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Figure 11 Figure 7. Arg1, PD-L1, and VEGF expression in tumor tissues. (A) Arg1 expression in tumor tissues was evaluated by qRT-PCR. (B) PD-L1 expression in tumor tissues was evaluated by flow cytometry. (C) VEGF expression in tumor tissues was evaluated by ELISA. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0123] In addition, this example also evaluated the mRNA expression of other immune-related genes in tumor tissues, such as arginase 1 (Arg1), PD-L1, and VEGF. Arg1 in tumors is usually produced by MDSC, which can suppress T cell responses in tumor patients, thus promoting tumor progression. The results showed that neither OVM1 treatment alone nor ABZ treatment alone affected the expression of Arg1, but their combination significantly reduced the expression level of Arg1 in tumor tissues Figure 11 Figure 7. Arg1, PD-L1, and VEGF expression in tumor tissues. (A) Arg1 expression in tumor tissues was evaluated by qRT-PCR. (B) PD-L1 expression in tumor tissues was evaluated by flow cytometry. (C) VEGF expression in tumor tissues was evaluated by ELISA. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Figure 12 Figure 7. Arg1, PD-L1, and VEGF expression in tumor tissues. (A) Arg1 expression in tumor tissues was evaluated by qRT-PCR. (B) PD-L1 expression in tumor tissues was evaluated by flow cytometry. (C) VEGF expression in tumor tissues was evaluated by ELISA. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0124] Example 5 OVM1 combined with ABZ treatment can overcome CTLA4 resistance

[0125] Through previous experiments, it was found that OVM1 combined with ABZ treatment enhanced the expression of T cell-related chemokines in tumors, promoted the infiltration of CD8 + T cells in tumors, and enhanced the expression of CD8 +Proliferation of T cells and expression of activation markers. The enhancement of ABZ on the anti-tumor effect of OVM1 was dependent on CD8 + T cells. In addition, OVA combined with ABZ treatment down-regulated the expression of PD1 in CD8 + T cells, but up-regulated the expression of CTLA4 in the spleen. CTLA4 is also one of the indicators of exhaustion of CD8 + T cells, so this example wants to evaluate whether the CTLA4 antibody can further enhance the anti-tumor effect of OVM1 and ABZ treatment. This example uses the RM-1 tumor-bearing immunocompetent mouse model to detect the therapeutic effect of this immunocombination therapy, as follows:

[0126] Establishment of animal tumor model: same as Example 2.

[0127] Grouping of tumor-bearing mice and treatment regimen: After RM-1 tumor was inoculated subcutaneously in mice, the mice were observed for tumor formation, and the length (A) and width (B) of the tumor were measured with a vernier caliper, and the tumor volume was calculated according to the following formula: Tumor volume = A x B 2 / 2. When the average tumor volume of the mice reached 50 mm 3 ~ 100 mm 3 , the mice were randomly divided into 4 groups: Control + IgG2b group, Control + Anti-CTLA4 treatment group, OVM1 + ABZ + IgG2b treatment group, and OVM1 + ABZ + CTLA4 treatment group. The administration method was OVM1 300 μL (dose: 3 x 10 6 pfu / mouse) was injected intravenously in the tail of the mice, once a day, for 5 consecutive days. ABZ was injected intraperitoneally 200 μL (dose: 50 mg / mL / mouse), once every two days, IgG2b was injected intraperitoneally 200 μL (dose: 200 μg / mouse), once every three days. Anti-CTLA4 antibody was injected intraperitoneally 200 μL (dose: 200 μg / mouse), once every three days. The same day, the isotype control IgG2b, Anti-CTLA4 antibody, OVM1 or ABZ were administered, and the day of administration was considered Day 1. The tumor was measured once every two days. The statistical method was the same as in Example 2.

[0128] Results:

[0129] High expression of immune checkpoint molecules determines good clinical response to ICB therapy. As mentioned above, the combination of OVM1 with ABZ did not affect the expression of CTLA4 on T cells in TME, but significantly increased the expression of CTLA4 in the spleen. Therefore, we treated tumor-bearing mice with CTLA4 antibody in combination with OVM1 and ABZ to evaluate whether the triple combination can further enhance the anti-tumor efficacy. The results showed that the CTLA4 antibody alone had little therapeutic effect on RM-1 tumor-bearing mice, and there was no significant difference in tumor size and median survival time, indicating that the RM-1 tumor was not sensitive to CTLA4 antibody therapy Figure 12 A-C), similar to the ICB resistance frequently occurring in clinical practice. However, after the combination of CTLA4 antibody with OVM1 + ABZ, the tumor size of RM-1 tumor-bearing mice was significantly smaller, and the survival time of mice was significantly prolonged Figure 14 A-C). This indicates that OVM1 combined with ABZ can serve as a way to improve the sensitivity of drug-resistant cancer to CTLA4 antibody therapy, providing a solution to overcome CTLA4 therapy resistance.

[0130] Example 6

[0131] Lymphocytes were isolated from mouse spleen, and then T cells were activated by co-stimulation with CD3 and CD28 antibodies for 48 hours. After treatment of activated T cells with 0.3 μM and 1 μM albendazole for 24 h, the fluorescence intensity of CD8 + T cell surface PD1 was detected by flow cytometry. After activation with CD28 / CD3, T cells were co-cultured with tumor cells RM1 (E:T = 2.5). After treatment with albendazole for 24 h, the fluorescence intensity of CD8 + T cell surface PD1 was detected by flow cytometry. After activation with CD28 / CD3, T cells were co-cultured with tumor cells RM1 (E:T = 2.5). After treatment with albendazole for 24 h, the fluorescence intensity of CD8

[0132] Results:

[0133] In the co-culture model of RM-1 tumor cells and T cells, albendazole can significantly down-regulate the expression of PD-1 on CD8 + T cells in a dose-dependent manner. In contrast, the expression of PD-1 in T cells that were not co-cultured with RM-1 tumor cells failed to be down-regulated by albendazole Figure 13 This result suggests that the mechanism by which albendazole enhances T cell immunity in vivo may involve VEGF-dependent signal cross-talk between tumor cells and T cells, and promotes the improvement of T cell-related immune function by changing the expression of downstream effector molecules such as PD-1.

[0134] In summary, the present application explores the combined application of antiparasitic drug albendazole and OVM1. In the present application, albendazole and OVM1 are combined and applied to mouse prostate cancer (RM-1) or glioma (GL261) models, and it is found that the combined therapy significantly enhances the anti-tumor effect of immune-competent mice, but the effect is not obvious in immune-deficient mice. This enhanced anti-tumor effect is not achieved by increasing the replication of OVM1, but by increasing the number of CD8 + T cells in the tumor, reducing the expression of PD1 on CD8 + T cells, up-regulating the expression of activation markers such as Ki67, CD44 and CD69, and promoting the secretion of cytotoxic factors such as interferon-γ (IFN-γ), granzyme B and tumor necrosis factor-α (TNF-α) (. ​ ) In addition, the combined therapy also enhances the in vitro lymphocyte killing activity of tumor cells.

[0135] In addition, the present application also finds that the combined treatment of albendazole and OVM1 can increase the expression of CTLA4 in the spleen, and the addition of CTLA4 antibody further enhances the in vivo anti-tumor effect. This indicates that albendazole can produce a synergistic effect with OVM1 by activating CD8 + T cells, and the albendazole / OVM1 combined therapy can overcome the resistance of CTLA4-based immune checkpoint blockade therapy. The present application provides a new strategy and possibility for tumor treatment.

[0136] The embodiments of the present application are described in detail above in combination with the drawings, but the present application is not limited to the above-mentioned embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. The use of albendazole in the preparation of drugs that enhance the antitumor effect of oncolytic virus M1, wherein the tumor is prostate cancer and / or glioma.

2. The application according to claim 1, characterized in that, The albendazole enhances the antitumor effect of oncolytic virus M1 by inhibiting the upregulation of VEGF and / or PD-1 expression induced by oncolytic virus M1; and / or, the albendazole enhances the antitumor effect of oncolytic virus M1 by increasing the intratumoral infiltration and tumor-killing toxicity of lymphocytes during oncolytic virus M1 treatment.

3. An antitumor pharmaceutical composition, characterized in that, The pharmaceutical composition comprises 0.1–3 μM albendazole and 0.01–1 MOI oncolytic virus M1, wherein the tumor is prostate cancer and / or glioma.

4. The pharmaceutical composition according to claim 3, characterized in that, The pharmaceutical composition also includes a CTLA4 antibody.

5. The use of the pharmaceutical composition according to any one of claims 3 to 4 in the preparation of an antitumor drug, wherein the tumor is prostate cancer and / or glioma.

6. The use of albendazole and oncolytic virus M1 in the preparation of drugs to overcome tumor resistance to CTLA4 antibodies.

Citation Information

Patent Citations

  • Application of albendazole in preparation of medicines for treating glioblastoma

    CN108078987A

  • Application of albendazole to reduction of PD-L1 expression

    CN115702895A