Application of polyphenol compound in preparation of African swine fever virus inhibitor

Abstract

The invention discloses application of a polyphenol compound in preparation of an African swine fever virus inhibitor. The technical problem to be solved by the invention is to inhibit African swine fever virus. The invention provides application of a polyphenol compound or pharmaceutically acceptable salt thereof, namely application in preparation of an African swine fever virus inhibitor. Application in inhibition of African swine fever virus; the invention also relates to an application in preparation of a product for treating and / or preventing diseases caused by African swine fever virus infection. The invention also relates to an application in treating and / or preventing diseases caused by African swine fever virus infection. The inventor of the invention finds that penthorum chinense pursh glycoside A targets African swine fever virus pA104R protein and is specifically combined with the African swine fever virus pA104R protein, so that the combination of the pA104R protein and DNA (Deoxyribose Nucleic Acid) is inhibited, and the activity of resisting the African swine fever virus is exerted. The invention has important application value for resisting the African swine fever virus.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to the application of a polyphenol compound in the preparation of an African swine fever virus inhibitor. Background Art

[0002] African swine fever is an acute, extensively hemorrhagic, and highly lethal infectious disease caused by infection with the African swine fever virus (ASFV). However, the disease only spreads among pigs and does not infect humans. Since the discovery of the African swine fever virus, there is still no effective treatment and prevention measure, and it still poses a potential threat to related industries in other countries where the epidemic has not occurred. For the prevention and control of infectious diseases, the development of vaccines and specific drugs is a relatively safe and effective strategy, but the vaccine is still in a slow development process. Therefore, the screening and development of specific drugs for African swine fever virus has become a top priority for the prevention of domestic pig diseases.

[0003] African swine fever virus is a large enveloped virus with an icosahedral shape. The internal nucleic acid is a linear double-stranded DNA of 170-193kb. The ASFV genome has 151-167 open reading windows, which can encode nearly 200 viral proteins. Since its discovery in 1921, after years of research, we now have a relatively in-depth understanding of its morphological structure, genome, encoded proteins, life cycle, and host immune response. Based on these research results, anti-African swine fever virus drugs targeting key links in the life cycle of African swine fever virus have been studied and developed, especially drugs targeting several enzyme-active proteins such as E165R enzyme, ASFV-Topo II enzyme, and pS273R. However, due to safety issues, the above-mentioned drugs are only in the preclinical research stage, and there are currently no safe, stable, and effective anti-African swine fever virus drugs on the market. Therefore, it is urgent to find new targets and new strategies to fill the gaps in the current lack of anti-ASFV drugs.

[0004] The pA104R protein is a histone-like protein encoded by A104R, which is highly conserved among ASFV isolates and has a sequence homology of 25% to 30% with the bacterial HU / IHF family. The pA104R protein has similar biological functions to the HU / IHF family proteins. It can bind to DNA and cooperate with the viral topoisomerase II pP1192R to help DNA form a supercoiled structure that can be packaged into viral particles, and this binding is not sequence specific. At the same time, the pA104R protein can bind to DNA in an ATP-independent manner over a wide range of temperatures, pH and salt concentrations. In the highly dynamic process of viral packaging, the virus may use a pA104R-centered mechanism to quickly complete the compression of DNA. Studies have shown that the pA104R protein plays a vital role in the replication and packaging of the virus and is A promising anti-African swine fever virus drug screening Target selection has gradually become a research hotspot in recent years. Summary of the invention

[0005] The technical problem solved by the present invention is to inhibit African swine fever virus.

[0006] The invention provides a new use of Thonningianin A or a pharmaceutically acceptable salt thereof.

[0007] The present invention provides the use of chaetocanthal glycoside A or a pharmaceutically acceptable salt thereof, which is as follows (a) or (b):

[0008] (a) Use in the preparation of African swine fever virus inhibitors;

[0009] (b) Application in inhibiting African swine fever virus.

[0010] The present invention also provides the use of chrysanthemum glycoside A or a pharmaceutically acceptable salt thereof, which is as follows (c) or (d):

[0011] (c) Use in the preparation of products; the use of the products is to treat and / or prevent diseases caused by African swine fever virus infection;

[0012] (d) Use in the treatment and / or prevention of diseases caused by African swine fever virus infection.

[0013] The present invention also provides the use of chrysanthemum glycoside A or its pharmaceutically acceptable salt, which is as follows (e) or (f):

[0014] (e) Application in the preparation of African swine fever virus pA104R protein inhibitors;

[0015] (f) Application in inhibiting the DNA binding activity of pA104R protein of African swine fever virus.

[0016] The African swine fever virus pA104R protein inhibitor is used to inhibit the DNA binding activity of the pA104R protein of the African swine fever virus.

[0017] The present invention also provides a medicinal compound, characterized in that the active ingredient of the medicinal compound is chrysanthemum glycoside A or a pharmaceutically acceptable salt thereof.

[0018] The medicinal compound is used to inhibit African swine fever virus.

[0019] The medicinal compound is used for treating and / or preventing diseases caused by African swine fever virus infection.

[0020] The medicinal compound is used for inhibiting the DNA binding activity of the pA104R protein of the African swine fever virus.

[0021] The present invention also provides a method for inhibiting African swine fever virus infection in animals, comprising the following steps: administering cypermethrin A or a pharmaceutically acceptable salt thereof to a recipient animal to inhibit African swine fever virus infection in the animal.

[0022] The present invention also provides a method for treating and / or preventing diseases caused by African swine fever virus infection, comprising the following steps: administering cyperus scutellariae A or a pharmaceutically acceptable salt thereof to a recipient animal to treat and / or prevent diseases caused by African swine fever virus infection.

[0023] Chlorophyll glycoside A is the compound represented by formula (Ⅰ).

[0024] In the present invention, the virus inhibition may also be referred to as antiviral.

[0025] Specifically, the binding site of the pA104R protein to DNA is located in the BDR region of the pA104R protein.

[0026] Specifically, the pA104R protein of African swine fever virus is the protein shown in SEQ ID NO: 1.

[0027] Specifically, the pA104R protein of African swine fever virus is a protein obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein shown in SEQ ID NO: 1 and having the same function.

[0028] Specifically, the pA104R protein of the African swine fever virus is derived from the African swine fever virus and is identical to SEQ ID NO: 1 Tool Proteins that are more than 98% identical and have the same function.

[0029] Specifically, the pA104R protein of the African swine fever virus is a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO: 1.

[0030] Specifically, the fusion protein is shown in SEQ ID NO:3.

[0031] The labels may be specifically shown in Table 1.

[0032] Table 1 Tag sequences

[0033] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0034] In the present invention, the term "pharmaceutically acceptable salt" refers to salts that are suitable for contact with human and lower animal tissues without excessive toxicity, irritation, allergic reaction, etc., and are commensurate with a reasonable effect / risk ratio within the scope of sound medical judgment. Pharmaceutically acceptable salts are well known in the art. For example, SM Berge, et al., J. Pharmaceutical Sciences, 1977, 66: 1 describes pharmaceutically acceptable salts in detail.

[0035] Any of the above products can be a drug, a vaccine or a pharmaceutical preparation.

[0036] Any of the above products, in addition to containing the polyphenol compounds or their pharmaceutically acceptable salts, may also contain suitable carriers or excipients. The carrier materials here include but are not limited to water-soluble carrier materials (such as polyethylene glycol, polyvinyl pyrrolidone, organic acids, etc.), poorly soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), enteric carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.). Among them, water-soluble carrier materials are preferred. These materials can be made into a variety of dosage forms, including but not limited to tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents, buccal tablets, suppositories, freeze-dried powder injections, etc. It can be a common preparation, a sustained-release preparation, a controlled-release preparation and various microparticle delivery systems. In order to make the unit dosage form into tablets, various carriers known in the art can be widely used. Examples of carriers include diluents and absorbents, such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, aluminum silicate, etc.; wetting agents and binders, such as water, glycerol, polyethylene glycol, ethanol, propanol, starch paste, dextrin, syrup, honey, glucose solution, acacia paste, gelatin paste, sodium carboxymethylcellulose, shellac, methylcellulose, potassium phosphate, polyvinyl pyrrolidone, etc.; disintegrants. , such as dry starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitan fatty acid esters, sodium lauryl sulfate, methyl cellulose, ethyl cellulose, etc.; disintegration inhibitors, such as sucrose, tristearate, cocoa butter, hydrogenated oil, etc.; absorption promoters, such as quaternary ammonium salts, sodium lauryl sulfate, etc.; lubricants, such as talc, silicon dioxide, corn starch, stearate, boric acid, liquid paraffin, polyethylene glycol, etc. The tablets can also be further made into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or double-layer tablets and multi-layer tablets. In order to make the unit dosage form into a pill, various carriers known in the art can be widely used. Examples of carriers include diluents and absorbents, such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinyl pyrrolidone, Gelucire, kaolin, talc, etc.; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste or flour paste, etc.; disintegrants such as agar powder, dry starch, alginate, sodium dodecyl sulfate, methyl cellulose, ethyl cellulose, etc. In order to prepare the unit dosage form into a suppository, various carriers known in the art can be widely used. Examples of carriers include, for example, polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, semi-synthetic glycerides, etc. In order to prepare the unit dosage form into an injectable preparation, such as a solution, emulsion, freeze-dried powder injection and suspension, all diluents commonly used in the art can be used, for example, water, ethanol, polyethylene glycol, 1,3-propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol fatty acid esters, etc.In addition, in order to prepare isotonic injections, an appropriate amount of sodium chloride, glucose or glycerol can be added to the injection preparation. In addition, conventional cosolvents, buffers, pH adjusters, etc. can also be added. In addition, if necessary, colorants, preservatives, spices, flavoring agents, sweeteners or other materials can also be added to the pharmaceutical preparation. The above dosage forms can be administered by injection, including subcutaneous injection, intravenous injection, intramuscular injection and intracavitary injection, etc.; cavity administration, such as rectal and vaginal; respiratory tract administration, such as nasal cavity; mucosal administration.

[0037] The inventors of the present invention have found that chaetocanthal A targets the African swine fever virus pA104R protein and specifically binds to it, thereby inhibiting the binding of the pA104R protein to DNA (the binding site is located in the BDR region of the pA104R protein), thereby exerting anti-African swine fever virus activity. The present invention has important application value for anti-African swine fever virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the SDS-PAGE image of the ASFV-pA104R-His6 protein solution in Example 1.

[0039] Figure 2 The electrophoresis diagram in Example 4 and the statistical results of the relative DNA binding activity.

[0040] Figure 3 This is the result diagram of Example 5.

[0041] Figure 4 This is the result diagram of Example 6.

[0042] Figure 5 This is the result diagram of Example 7. DETAILED DESCRIPTION

[0043] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0044] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources. Unless otherwise specified, the quantitative tests in the following examples are set up for three repeated experiments, and the results are averaged. The protein concentration is measured by the BCA protein assay kit (Pierce). Unless otherwise specified, the cell culture conditions are: 5% CO2, 37°C.

[0045] Thonningianin A A), namely compound No. 46, CAS No. 271579-11-4, structure The formula is shown in formula (I), which belongs to the polyphenolic compound. Huangcaoside A: TargetMol Chemicals Inc., product number T3S0218.

[0046]

[0047] The compound SD4 used as a positive control in the examples has the full name of MtbHU-IN-1, CAS No. 59736-84-4, TargetMol Chemicals Inc., and product No. T12121.

[0048] Example 1. Expression and purification of pA104R protein of ASFV

[0049] 1. Expression of ASFV pA104R protein

[0050] 1. Insert ASFV pA104R DNA (ASFV pA104R DNA is a double-stranded DNA molecule shown in SEQ ID NO: 2, encoding the pA104R protein shown in SEQ ID NO: 1) between the BamHI and NotI restriction sites of pET-21a (+) to obtain a recombinant plasmid named ASFV-pA104R recombinant plasmid. In the ASFV-pA104R recombinant plasmid, the upstream of ASFV pA104R DNA is connected to the following DNA molecule "ATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGC GGATCC ", connect the following DNA molecules downstream GCGGCCGC ACTCGAGCACCACCACCACCACCACTGA", forming a fusion gene to express the ASFVpA104R protein with a His6 tag (called ASFV-pA104R-His6 protein, as shown in SEQ ID NO: 3).

[0051] 2. Introduce the ASFV-pA104R recombinant plasmid into Escherichia coli BL21 (DE3) competent cells to obtain recombinant bacteria.

[0052] 3. Inoculate the recombinant bacteria obtained in step 2 into liquid LB medium containing 100 μg / ml ampicillin, and culture at 37°C and 200 rpm until OD 600nm Value = 0.6-1.0, then IPTG was added to make its concentration in the system 0.5 mM, and then cultured with shaking at 16°C and 200 rpm for 16-20 hours.

[0053] 4. After completing step 3, collect the bacteria by centrifugation and resuspend them in a buffer solution (containing 10 mM HEPES, 100 mM NaCl, 50 mM imidazole, and the balance is ddH2O). Ultrasonicate the bacterial solution, then centrifuge at 4°C and 12,000 rpm for 5 min, and collect the supernatant.

[0054] 5. Take the supernatant obtained in step 4 and use Ni-trinitrotriacetic acid affinity chromatography (1 ml HisTrap from Cytiva) TM Excel column, catalog number 17371205) and ion exchange chromatography (1ml HiTrap from Cytiva) TM Q FF column, catalog number 17505301) for purification, and then size exclusion chromatography (Superdex TM 200Increase 10 / 300GL column, catalog number 28990944) was used for concentration and liquid exchange to obtain an ASFV-pA104R-His6 protein solution. The protein concentration in the ASFV-pA104R-His6 protein solution was 3-5 mg / mL, and the buffer system composition of the ASFV-pA104R-His6 protein solution (7.4) contained 10 mM HEPES and 100 mM NaCl, and the balance was ddH2O.

[0055] 6. Take the ASFV-pA104R-His6 protein solution prepared in step 5 and perform SDS-PAGE.

[0056] Electrophoresis diagram Figure 1 , showing a protein band of the expected molecular weight (expected molecular weight is 12KD).

[0057] The ASFV-pA104R-His6 protein solution prepared in this example was used in the subsequent examples. When used subsequently, the protein concentration was adjusted with a PBS buffer (pH 7.5, 10 mM) containing 50 mM NaCl.

[0058] Example 2: Screening of compounds that inhibit the binding of ASFV-pA104R to DNA using a gel shift assay

[0059] Electron migration assay (EMSA) is commonly used to study the interaction between DNA binding proteins and their target DNA.

[0060] The DNA binding protein in this example is the ASFV-pA104R-His6 protein prepared in Example 2.

[0061] The preparation method of the probe (probe, i.e., dsDNA with a fluorescent label) in this embodiment is as follows: a single-stranded oligonucleotide 1 with a FAM label at the 5' end is synthesized by AZENTA, and it is mixed with a single-stranded oligonucleotide 2 in equal moles, and then annealed to obtain a double-stranded oligonucleotide (dsDNA). Single-stranded oligonucleotide 1 (30 nt): 5'-CCAACTTCCCTAACCCAGCTGCGATCCGTA-3'. Single-stranded oligonucleotide 2 (30 nt): 5'-TACGGATCGCAGCTGGGTTAGGGAAGTTGG-3'.

[0062] Principle: When there is only dsDNA in the reaction system (blank control), a fluorescent band will be displayed at a specific position on the gel after electrophoresis; when there are only ASFV-pA104R-His6 protein and dsDNA in the reaction system (negative control), the migration speed will decrease after the two are combined, and no fluorescent band will be displayed at the same position on the gel as the blank control after electrophoresis; when there are ASFV-pA104R-His6 protein, dsDNA and test compounds in the reaction system, if the test compound binds to the ASFV-pA104R-His6 protein, dsDNA will be released, and a fluorescent band will be displayed at the same position on the gel as the blank control after electrophoresis.

[0063] Test compounds: dozens of test compounds (named sequentially from Compound 1 to Compound N) or compound SD4 (positive control). The test compound stock solution consists of the test compound and DMSO. EMSA / Gel-Shift Kit: Bio-Time, product catalog number GS002; the kit provides EMSA / Gel-Shift binding buffer (5X), EMSA / Gel-Shift loading buffer (colorless, 10X) and EMSA / Gel-Shift loading buffer (blue, 10X).

[0064] The reaction was carried out in 8-tube strips of 0.2 ml, with one reaction system in each tube and each reaction system of 10 μl.

[0065] The test tube reaction system consists of 2 μl EMSA / Gel-Shift binding buffer (5X), 6 μl ASFV-pA104R-His6 protein solution (protein concentration is 0.5 mg / ml), 1 μl probe and 1 μl test compound stock solution. In the reaction system, the concentration of the probe is 100 μM and the concentration of the test compound is 100 μM.

[0066] Negative control tube reaction system: replace the test compound solution with an equal volume of DMSO, and the rest is the same as the test wells.

[0067] Reaction system of blank control tube: replace ASFV-pA104R-His6 protein solution with an equal volume of ddH2O and replace the test compound solution with an equal volume of DMSO, and the rest is the same as the test wells.

[0068] The reaction system was incubated in the dark for 30 minutes. Then 1 μl EMSA / Gel-Shift loading buffer (colorless, 10X) and 1 μl EMSA / Gel-Shift loading buffer (blue, 10X) were added to each well, and the samples were added to the wells of 7% non-denaturing polyacrylamide gel. Electrophoresis was performed in 1×TBE solution under ice bath and dark conditions (constant voltage 100V). The results were then collected using a chemiluminescent gel imaging system.

[0069] The probe migration position of the blank control well was recorded as meanP, and the probe fluorescence area measured by ImageJ was recorded as meanA. The area of ​​probe fluorescence at meanP in each test well was measured by ImageJ and recorded as sampleA.

[0070] Relative DNA binding activity = (1-sampleA÷meanA)×100%.

[0071] The relative DNA binding activity corresponding to compound No. 46 is less than 10%, that is, for a concentration of 100 μM, compound No. 46 has an inhibitory effect of more than 90% on the binding of ASFV-pA104R-His6 to DNA. The relative DNA binding activity corresponding to most of the other compounds tested is about 100%, that is, these compounds have no inhibitory effect on the binding of ASFV-pA104R-His6 to DNA.

[0072] Example 4: The inhibitory effect of the compound on the binding of ASFV-pA104R to DNA has a good dose dependence

[0073] The test compounds are: Compound No. 46 or Compound SD4 (positive control). The test compound stock solution consists of the test compound and DMSO.

[0074] The method is basically the same as in Example 3.

[0075] In the reaction system, the concentration of the test compound was 12.5 μM-100 μM (2-fold gradient).

[0076] The electropherograms and statistical results of the relative activity of DNA binding are shown in Figure 2 . Figure 2 In the figure, DMSO represents the negative control well and MOCK represents the blank control well. Compound No. 46 showed a dose-dependent inhibitory effect on the binding of ASFV-pA104R-His6 to DNA.

[0077] Example 5: The inhibitory effect of the compound on ASFV has good dose dependence

[0078] The African swine fever virus strain ASFV CN / GS / 2018 (belonging to genotype II) was obtained from the African swine fever virus regional laboratory of the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences. Porcine alveolar macrophages (PAMs) were isolated from Landrace pigs (about 75 days old, weighing 30-35 kg) by bronchoalveolar lavage and obtained from the African swine fever regional laboratory of the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences. They are all recorded in the following documents: MGF360-9L Is a Major Virulence Factor Associated with the African Swine Fever Virus by Antagonizing the JAK / STAT Signaling Pathway; AMERICAN SOCIETY FOR MICROBIOLOGY, January / February 2022 Volume 13 Issue 1e02330-21. The experiment in this example was carried out in the Animal Biosafety Level 3 Laboratory (ABSL-3) of the Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0079] Complete medium for porcine alveolar macrophage culture: contains 10% fetal bovine serum and the remainder is RPMI 1640 Training Culture medium (Gibco, product catalog number 31800-022).

[0080] Test compound: Compound No. 46. The test compound stock solution consists of the test compound and DMSO.

[0081] 1. Inoculate porcine alveolar macrophages into 24-well plates (about 1×10 6 cells / well), cultured with complete medium for 12 h, then discarded the supernatant, and washed three times with PBS buffer to remove suspended cells.

[0082] 2. Group processing

[0083] Test well: After completing step 1, discard the supernatant, inoculate the African swine fever virus strain ASFV CN / GS / 2018 (MOI=0.01), incubate at 37°C for 1 hour with complete medium, then discard the supernatant, wash 3 times with PBS buffer, then add complete medium containing the test compound and culture for 48 hours. The concentrations of the test compounds in the complete medium were set to: 4nM, 40nM, 0.4μM, 4μM or 40μM. Preparation method of complete medium containing test compounds: Mix the mother solution of the test compound and the complete medium.

[0084] Negative control wells: After completing step 1, discard the supernatant, inoculate the African swine fever virus strain ASFV CN / GS / 2018 (MOI = 0.01), incubate at 37°C for 1 hour with complete medium, then discard the supernatant, wash 3 times with PBS buffer, then add complete medium containing DMSO and culture for 48 hours. Complete medium containing DMSO: Use DMSO instead of the test compound stock solution, and the rest is the same as the medium containing the test compound.

[0085] Three replicate wells were set up.

[0086] 3. Detection

[0087] After completing step 2, the cell culture supernatant was collected, inactivated, and DNA was extracted using a DNA extraction kit (Qiagen, product catalog number 51306). qPCR was then performed using a specific primer probe set to obtain the Ct value, which was substituted into the standard curve equation to obtain the gene copy number.

[0088] Method for preparing the standard curve equation: Using the DNA of the African swine fever virus strain ASFV CN / GS / 2018 as a template, a specific primer probe set was used for qPCR to obtain a standard curve equation with Ct value and gene copy number as variables.

[0089] The specific primer probe set is as follows (the target is located in the conserved p72 gene fragment of the ASFV genome):

[0090] ASFV-P72-R: 5'-CTGCTCATGGTATCAATCTTATCGA-3';

[0091] ASFV-P72-F: 5'-GATACCACAAGATCAGCCGT-3';

[0092] TaqMan probe: 5-CCACGGGAGGAATACCAACCCAGTG-3'.

[0093] The kit used for qPCR was Pro Taq HS premixed probe qPCR kit (Accurate Biology, product catalog number AG11712).

[0094] The average value of the virus copy number detected in the negative control wells (expressed with DMSO) (n=3) was taken as the reference 100%, and the relative value of the virus copy number in the test wells, ie, the relative DNA level, was calculated.

[0095] Results Figure 3The gene copy number of ASFV in cells added with the test compound was significantly lower than that in cells added with DMSO, indicating that the test compound can inhibit the expression and replication of African swine fever virus. The test compound showed a dose-dependent inhibitory effect on ASFV, and the EC 50 The value is 0.068μM.

[0096] Example 6: The antiviral activity of the compound is not related to its cytotoxicity

[0097] In order to exclude non-specific differences caused by compound toxicity, the Cell Counting Kit-8 (CCK-8) (Meilunbio, catalog number MA0218) was used to evaluate the effects of compounds on cell growth. CCK-8 is a kit for detecting cell proliferation, cell survival and cytotoxicity. It is a widely used rapid and highly sensitive detection kit based on WST-8 (water-soluble tetrazolium salt, chemical name: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonylbenzene)-2H-tetrazolyl monosodium salt), which is an alternative to the MTT method. The water-soluble tetrazolium salt WST-8 used in the kit can be reduced by some dehydrogenases in mitochondria to generate orange-yellow formazan in the presence of electron coupling reagents. The more and faster the cell proliferation, the darker the color; the greater the cytotoxicity, the lighter the color; for the same cells, the depth of the color and the number of cells show a good linear relationship.

[0098] Test compound: Compound No. 46. The test compound stock solution consists of the test compound and DMSO.

[0099] 1. Inoculate Vero cells into 96-well plates (8×10 4 cells / well) and cultured in EMEM medium for 24 hours.

[0100] 2. Group processing

[0101] Test wells: After completing step 1, discard the supernatant and culture for 48 hours using a medium containing the test compound. The concentration of the test compound in the medium is set to 1.5625 μM-200 μM (2-fold gradient). Preparation of the medium containing the test compound: Mix 1 volume of the test compound stock solution with 100 volumes of DMEM medium.

[0102] Blank control wells: After completing step 1, discard the supernatant and culture in medium containing DMSO for 48 hours. Medium containing DMSO: Replace the mother solution of the test compound with an equal volume of DMSO, and use the same medium containing the test compound for other purposes.

[0103] Three replicate wells were set up.

[0104] 3. After completing step 2, discard the supernatant and culture in DMEM medium containing 10% CCK-8 reagent for 1 hour.

[0105] 4. After completing step 3, record the optical density (OD) value of each well at 450 nm on a microplate reader (Thermo, Varioskan Flash).

[0106] The blank control well OD 450nm The value was used as a reference (representing 100% cell viability) to calculate the OD of the test wells. 450nm Values ​​are relative values, that is, relative cell viability.

[0107] Results Figure 4 The CC50 value of compound No. 46 for Vero cells was 10.6±0.7μM.

[0108] Example 7: In vitro determination of the binding ability of compounds to ASFV-pA104R protein

[0109] Test compound: Compound No. 46. The test compound was dissolved in DMSO to obtain a 10 mM test compound stock solution, which was then diluted with PBS buffer to obtain each test compound solution. In the test compound solution, the concentration of the test compound was 6.25 μM, 12.5 μM, 25 μM, 50 μM or 100 μM.

[0110] Test protein: ASFV-pA104R-His6. The ASFV-pA104R-His6 protein solution prepared in Example 2 was diluted using PBS buffer as a solvent to obtain a test protein solution.

[0111] Using Octet RED96 platform (ForteBio, Inc.) was used to determine the interaction between ASFV-pA104R-His6 and the compounds.Binding kinetics. The entire experiment was carried out at 30°C with an oscillation speed of 1000 rpm. First, the test protein solution (protein concentration of approximately 160 μg / ml) was loaded onto the Ni-NTA (NTA) biosensor (Cat. No.: 18-5101, Sartorius) for 90 seconds until the loading curve reached saturation to ensure that sufficient protein could stably bind to the sensor. In the KD assay, the sensor tip was immersed in a well containing a test compound solution (compound concentrations were 2-fold serial dilutions from 100 μM to 6.25 μM, respectively). Each analysis cycle included baseline acquisition (60 seconds), compound binding for determining Kon (180 seconds), and dissociation of the compound in the buffer for measuring Koff (180 seconds). A separate sensor was used for each compound concentration. The analyte buffer was PBS buffer containing 2% DMSO. In order to correct the baseline shift, a blank well without compound was used in the experiment, and only buffer was used for blank binding cycles. In addition, control experiments were performed using reference sensors without protein loading and incubated only in buffer to monitor nonspecific binding. Finally, double reference subtraction was used to eliminate the effects of baseline drift and nonspecific binding. Kinetic parameters (kon, koff, KD, R2) were calculated using a 1:1 global fit model. Experimental data were analyzed using ForteBio Data Analysis 9.0. The dissociation rate constant KD = K off / K on .

[0112] Results Figure 5 , the horizontal axis is the reaction time (in seconds), and the vertical axis is the signal intensity (in nm). Compound No. 46 can bind to the ASFV-pA104R-His6 protein, and the fitted KD value is 7.58±0.41μM.

[0113] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. The use of chrysanthemum glycoside A or its pharmaceutically acceptable salt is as follows (a) or (b): (a) Use in the preparation of African swine fever virus inhibitors; (b) Application in inhibiting African swine fever virus.

2. The use of chrysanthemum glycoside A or its pharmaceutically acceptable salt is as follows (c) or (d): (c) Use in the preparation of products; the use of the products is to treat and / or prevent diseases caused by African swine fever virus infection; (d) Use in the treatment and / or prevention of diseases caused by African swine fever virus infection.

3. The use of chrysanthemum glycoside A or its pharmaceutically acceptable salt is as follows (e) or (f): (e) Application in the preparation of African swine fever virus pA104R protein inhibitors; (f) Application in inhibiting the binding activity of pA104R protein of African swine fever virus to DNA.

4. A pharmaceutical compound, characterized in that: The active ingredient of the medicinal compound is chrysanthemum glycoside A or a pharmaceutically acceptable salt thereof.

5. The pharmaceutical compound according to claim 4, characterized in that: The medicinal compound is used to inhibit African swine fever virus.

6. The pharmaceutical compound according to claim 4, characterized in that: The medicinal compound is used for treating and / or preventing diseases caused by African swine fever virus infection.

7. The pharmaceutical compound according to claim 4, characterized in that: The medicinal compound is used for inhibiting the binding activity of the pA104R protein of the African swine fever virus with DNA.

8. A method for inhibiting African swine fever virus infection in animals, comprising the following steps: administering cypermethrin A or a pharmaceutically acceptable salt thereof to a recipient animal to inhibit African swine fever virus infection in the animal.

9. A method for treating diseases caused by African swine fever virus infection, comprising the following steps: administering cyperus scutellariae A or a pharmaceutically acceptable salt thereof to a recipient animal to treat diseases caused by African swine fever virus infection.

Images