An amylase signal peptide variant and its application

Abstract

The present invention discloses an amylase signal peptide variant mutant SEQ ID NO: 2 or 3 generated by a natural language model. The encoding gene thereof is fused with a bovine lactoferrin gene or a thaumatin gene and expressed in Aspergillus. The variant mutant can improve the secretion and expression of bovine lactoferrin and / or thaumatin by Aspergillus and enhance the production economy of bovine lactoferrin or thaumatin.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to an amylase signal peptide variant and application thereof in improving the secretion and expression of bovine lactoferrin and / or thaumatin by Aspergillus. Background Art

[0002] Bovine lactoferrin (BLF) and thaumatin (African tartrate sweetener, samatin) have broad application prospects in the pharmaceutical, food, and cosmetics industries. Fermentation with engineered microorganisms is a promising method for producing bovine lactoferrin and thaumatin. Patent publication number CN1171815A discloses genetic engineering technology for producing lactoferrin by fermentation with engineered Aspergillus species, particularly Aspergillus awamori, Aspergillus niger, and Aspergillus oryzae. However, efficient secretory expression of lactoferrin in microbial expression systems has been a key issue limiting their large-scale production and application.

[0003] Signal peptides, as key elements guiding protein secretion, play an important role in protein secretion efficiency. For example, patent publication number CN104004760A discloses a genetically engineered Aspergillus oryzae strain that has been introduced with a signal peptide coding sequence that promotes exogenous protein expression, capable of secreting and expressing exogenous acidic and neutral amylase proteins. Patent publication number CN107353327A discloses an engineered Aspergillus niger strain that has been introduced with the Aspergillus oryzae TAKA amylase signal peptide gene and the Escherichia coli phytase gene, capable of secreting and expressing large quantities of phytase.

[0004] Traditional signal peptide optimization methods are often based on limited experimental attempts and known biological rules, and have certain blindness and limitations.

[0005] With the development of artificial intelligence technology, natural language models have shown great potential in biological sequence analysis and design. By learning from large amounts of biological sequence data, natural language models can discover the underlying laws and patterns hidden in the sequences, thus providing new approaches and methods for generating signal peptide variants with excellent performance. This is expected to break through the bottleneck of traditional signal peptide optimization and significantly improve the efficiency of protein secretion expression. Summary of the Invention

[0006] We used natural language models to generate a large number of amylase signal peptide variants and fused them to the bovine lactoferrin or thaumatin genes. By expressing them in Aspergillus niger or Aspergillus oryzae, we screened for several amylase signal peptide variants that significantly increased the secretory expression levels of both target proteins, helping to reduce the fermentation production costs of these two proteins. This invention expands the application scope of natural language models and provides a model and practical experience for innovation in genetic engineering technology based on artificial intelligence. Therefore, the present invention includes the following technical solutions.

[0007] The first aspect of the present invention provides an amylase signal peptide variant, which is a polypeptide selected from the following:

[0008] (a) a polypeptide having an amino acid sequence of MMVAWWSLFLYGLAVAAPALAA (SEQ ID NO: 2), which is a Q14A mutant of the α-amylase signal peptide having an amino acid sequence of MMVAWWSLFLYGLQVAAPALAA (SEQ ID NO: 1) derived from Aspergillus oryzae, designated herein as SP2;

[0009] (b) A polypeptide having an amino acid sequence of MMVAWWSLFLLGLQVAAPALAA (SEQ ID NO: 3), which is a Y11L mutant of the α-amylase signal peptide having an amino acid sequence of MMVAWWSLFLYGLQVAAPALAA (SEQ ID NO: 1) derived from Aspergillus oryzae, and is designated herein as SP3.

[0010] The second aspect of the present invention provides genes encoding the amylase signal peptide variants SP2 and SP3.

[0011] In one embodiment, the gene encoding the amylase signal peptide variant SEQ ID NO: 2, i.e., SP2, is a polynucleotide having a nucleotide sequence of SEQ ID NO: 4, or a polynucleotide having 90% or more, preferably 92% or more, preferably 95% or more, more preferably 97% or more, more preferably 98% or more, and more preferably 99% or more homology to SEQ ID NO: 4;

[0012] The gene encoding the amylase signal peptide variant SEQ ID NO: 3, i.e., SP3, is a polynucleotide represented by the nucleotide sequence SEQ ID NO: 5, or a polynucleotide having 90% or more, preferably 92% or more, preferably 95% or more, more preferably 97% or more, more preferably 98% or more, and more preferably 99% or more homology to SEQ ID NO: 5.

[0013] Another aspect of the present invention provides a DNA molecule comprising the gene as described above, for example, an expression cassette / expression frame of the amylase signal peptide variant SEQ ID NO: 2 or SEQ ID NO: 3.

[0014] Another aspect of the present invention provides the use of the above-mentioned amylase signal peptide variants SP2 and SP3 or their encoding genes in improving the secretory expression of bovine lactoferrin and / or thaumatin by Aspergillus.

[0015] Preferably, the Aspergillus is Aspergillus niger, such as Aspergillus niger ATCC1015, or Aspergillus oryzae, such as Aspergillus oryzae ATCC11488.

[0016] In a preferred embodiment, the gene encoding the above-mentioned amylase signal peptide variant SP2 or SP3 is fused with the bovine lactoferrin gene or the thaumatin gene and expressed in Aspergillus.

[0017] Optionally, the nucleotide sequence of the bovine lactoferrin gene is SEQ ID NO: 6;

[0018] The nucleotide sequence of the thaumatin gene is SEQ ID NO: 7.

[0019] Another aspect of the present invention provides an integration fragment for expressing bovine lactoferrin or thaumatin in Aspergillus, which comprises the above-mentioned encoding gene of the amylase signal peptide variant SP2 or SP3 and the above-mentioned bovine lactoferrin gene located downstream, or

[0020] The encoding gene of the above-mentioned amylase signal peptide variant SP2 or SP3 and the above-mentioned thaumatin gene located downstream.

[0021] Another aspect of the present invention provides an engineered Aspergillus niger or Aspergillus oryzae for producing bovine lactoferrin, wherein the above-mentioned integration fragment is integrated into its genome.

[0022] For example, the above-mentioned Aspergillus niger engineered bacteria or Aspergillus oryzae engineered bacteria can be constructed by a method comprising the following steps:

[0023] 1) Fusion gene construction: Use gene editing technology (such as Gibson assembly or traditional restriction endonuclease digestion-ligation method or overlap PCR technology) to fuse the amylase signal peptide variant gene sequence with the bovine lactoferrin gene or thaumatin gene; ensure the accuracy and stability of the fusion site.

[0024] 2) Expression vector construction: The constructed fusion gene is inserted into and fused with a promoter, terminator, and selectable marker suitable for Aspergillus, preferably Aspergillus niger or Aspergillus oryzae. The construct should include a strong promoter (e.g., saccharifying enzyme promoter, gpd promoter, etc.), an efficient terminator, an appropriate selectable marker (e.g., antibiotic resistance gene), and elements that facilitate gene expression regulation (e.g., enhancers, silencers, etc.). The correctness of the expression vector construction is verified by enzyme digestion and sequencing to ensure that the fusion gene is correctly inserted into the appropriate position of the vector and that all other elements of the vector are intact.

[0025] 3) Preparation and transformation of Aspergillus cell protoplasts: Aspergillus cells, preferably Aspergillus niger or Aspergillus oryzae, are prepared using an appropriate enzymatic hydrolysis method (e.g., snailase, cellulase, etc.). The enzymatic hydrolysis conditions (e.g., enzyme concentration, hydrolysis time, temperature, osmotic pressure stabilizer, etc.) are optimized to obtain protoplasts with high activity and high yield. The recombinant plasmid constructed in step 2) is then introduced into the protoplasts via PEG-mediated protoplast transformation. The cells are cultured on a regeneration medium containing a corresponding selection marker (e.g., antibiotic resistance) to screen for preliminary transformants.

[0026] 4) Transformant Identification and Verification: PCR is used to amplify the transformants screened in step 3) to verify successful integration of the fusion gene into the host genome. Western blot or enzyme-linked immunosorbent assay (ELISA) is used to determine the expression and secretion of the target protein (bovine lactoferrin or thaumatin) to ensure that the transformants are capable of stably and efficiently expressing and secreting the target protein.

[0027] Another aspect of the present invention provides use of the above-mentioned engineered Aspergillus niger or engineered Aspergillus oryzae in producing bovine lactoferrin or thaumatin.

[0028] Experimental data show that compared with the control group using the wild-type amylase signal peptide (SP0) or the control group without signal peptide optimization, the amylase signal peptide variant SP2 or SP3 fusion strategy generated by the natural language model of the present invention can increase the secretory expression level of bovine lactoferrin in the Aspergillus engineered bacteria by more than 191%, and the secretory expression level of thaumatin can be increased by more than 44%, effectively improving the fermentation production efficiency of bovine lactoferrin and thaumatin, laying the foundation for industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This image shows agarose gel electrophoresis of PCR-based detection of integration of the amylase signal peptide variant SP2 or SP3 fusion gene with bovine lactoferrin into the Aspergillus niger or Aspergillus oryzae genome. This image demonstrates integration verification of the lactoferrin expression cassette sequence AoBLF. Primers Pamy2-F / TglaA(Ptub)-R were used, and the positive band is approximately 3 kb. In the image, lanes 1-8 were generated using Aspergillus niger transformants as a template, with lanes 1-4 representing transformants harboring the SP2-fused bovine lactoferrin expression cassette, and lanes 5-8 representing transformants harboring the SP3-fused bovine lactoferrin expression cassette. Lanes 9-16 were generated using Aspergillus oryzae transformants as a template, with lanes 9-12 representing transformants harboring the SP2-fused bovine lactoferrin expression cassette, and lanes 13-16 representing transformants harboring the SP3-fused bovine lactoferrin expression cassette.

[0030] Figure 2This image shows agarose gel electrophoresis images of PCR-detected integration of the amylase signal peptide variant SP2 or SP3 fusion gene with thaumatin into the Aspergillus niger or Aspergillus oryzae genome. This image demonstrates integration verification of the thaumatin expression cassette AoTha. Primers Pamy2-F / TglaA(Ptub)-R were used, and the positive band is approximately 1.5 kb. In the image, lanes 1-8 were generated using Aspergillus niger transformants as a template, while lanes 9-16 were generated using Aspergillus oryzae transformants. Lanes 1-8 were generated using Aspergillus niger transformants as a template, with lanes 1-4 representing transformants harboring the SP2 fusion thaumatin expression cassette and lanes 5-8 representing transformants harboring the SP3 fusion thaumatin expression cassette. Lanes 9-16 were generated using Aspergillus oryzae transformants as a template, with lanes 9-12 representing transformants harboring the SP2 fusion thaumatin expression cassette and lanes 13-16 representing transformants harboring the SP3 fusion thaumatin expression cassette.

[0031] Figure 3 The following is a photo of the color development of the Histag ELISA kit standard sample and the standard curve. DETAILED DESCRIPTION

[0032] To improve the fermentation of bovine lactoferrin and thaumatin, we selected the improvement of the amylase signal peptide as a breakthrough. Based on the established optimization goals—improving secretion efficiency in Aspergillus niger or Aspergillus oryzae and enhancing the compatibility of the signal peptide with the target protein—we used a trained natural language model to generate a series of amylase signal peptide variant sequences. Using the model's predictive capabilities, we conducted a preliminary screening of the generated variant sequences, selecting those with the highest potential for improved secretion efficiency for subsequent experimental verification.

[0033] Based on bioinformatics statistics, we determined that the amino acid sequence of the wild-type α-amylase signal peptide from Aspergillus oryzae (herein numbered SP0, amino acid sequence SEQ ID NO: 1) should be modified in order to enhance the secretory expression of exogenous bovine lactoferrin and / or thaumatin by Aspergillus niger and / or Aspergillus oryzae.

[0034] As used herein, the terms "(bovine lactoferrin / thaumatin fermentation level) increase", "enhance", "enhance" or "increase" refer to an increase of at least 20% or more compared to a reference level, for example, an increase of at least 30% or more, at least 50% or more, at least 80% or more, at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, or at least about 5-fold compared to a reference level.

[0035] As used herein, the term "and / or" as used in "A and / or B," "A and / or B," is intended to include both A and B; A or B; A (alone); and B (alone). Likewise, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0036] An effective method for achieving co-expression of amylase signal peptide variants and bovine lactoferrin or thaumatin in Aspergillus is to use fusion gene expression, that is, forming a fusion gene by combining the amylase signal peptide variant encoding gene with the downstream bovine lactoferrin gene or thaumatin gene.

[0037] The construction of the fusion gene begins with gene cloning and modification. The bovine lactoferrin and thaumatin genes are amplified using PCR technology, and the amylase signal peptide variant sequence obtained by screening is also amplified. During the amplification process, suitable restriction enzyme recognition sites are introduced into the primer design to facilitate subsequent gene ligation operations. The amplified gene fragments are purified and quantitatively analyzed. The fusion gene is then constructed, and the amylase signal peptide variant sequence is fused to the bovine lactoferrin or thaumatin gene using gene editing techniques such as the Gibson assembly method, Overlap-PCR technology, or traditional restriction enzyme digestion-ligation methods to ensure the accuracy and stability of the fusion site. In the design of the fusion gene, the connecting peptide sequence between the signal peptide and the target protein is considered, and appropriate amino acid residues are selected to form the connecting peptide to ensure that the signal peptide can effectively guide the secretion of the target protein while not affecting the functional structure of the target protein. Finally, the fusion gene fragment is constructed and further fused with a strong promoter (such as the glucoamylase promoter, gpd promoter, etc.), an efficient terminator, a suitable selection marker (such as an antibiotic resistance gene), and elements that facilitate gene expression regulation (such as enhancers and silencers) to form an expression cassette. The correctness of the expression vector construction was verified by enzyme digestion identification and sequencing to ensure that the fusion gene was correctly inserted into the appropriate position of the vector and that other elements of the vector were intact.

[0038] We used the trained natural language model to generate a series of amylase signal peptide variant sequences and experimentally validated these variant sequences. First, host cell transformation and screening were performed. Protoplasts were prepared and transformed. For Aspergillus niger or Aspergillus oryzae, appropriate enzymatic hydrolysis methods (such as snailase or cellulase) were used to prepare protoplasts. Hydrolysis conditions (such as enzyme concentration, hydrolysis time, temperature, and osmotic stabilizers) were optimized to obtain protoplasts with high activity and high yield. The constructed recombinant expression vector was introduced into the A. niger or A. oryzae protoplasts via PEG-mediated protoplast transformation. The cells were cultured on regeneration medium containing the appropriate selection marker (such as antibiotic resistance) to screen for preliminary transformants. Transformants were then identified and verified. Transformants obtained from the preliminary screening were amplified using PCR to verify successful integration of the fusion gene into the host genome. The expression level and secretion of the target protein (bovine lactoferrin or thaumatin) were further assayed by Western blot or enzyme-linked immunosorbent assay (ELISA) to ensure that the transformants were able to stably and efficiently express and secrete the target protein.

[0039] After experimental comparison, it was found that two variants of wild amylase signal peptide, SP2 (SEQ ID NO: 2) and SP3 (SEQ ID NO: 3), were relatively ideal mutants.

[0040] The amylase signal peptide variants SP2 and SP3 of the present invention each consist of only 22 amino acids, and the amino acid sequences of bovine lactoferrin and thaumatin are well-defined. Therefore, those skilled in the art can easily obtain fusion genes, expression cassettes (DNA molecules) and plasmids containing these fusion genes, and transformants containing these plasmids. These fusion genes, expression cassettes, plasmids, and transformants can be obtained through genetic engineering methods well known to those skilled in the art.

[0041] The present invention also achieves the following beneficial effects:

[0042] This invention innovates the signal peptide optimization method. This invention, for the first time, applies a natural language model to the generation of amylase signal peptide variants, breaking through the limitations of traditional signal peptide optimization methods and opening up a new avenue for the optimized design of biological signal peptide sequences. This method has important theoretical innovation significance and broad application potential, and is expected to promote technological development in the field of genetic engineering.

[0043] The fermentation production costs of bovine lactoferrin and thaumatin are reduced, thus expanding their application prospects. The efficient secretory expression of bovine lactoferrin and thaumatin significantly reduces the cost and difficulty of separating and purifying downstream products. Simultaneously, Aspergillus niger or Aspergillus oryzae as hosts offer advantages such as ease of cultivation, rapid growth, and low fermentation costs, further reducing production costs and improving product market competitiveness. The present invention provides reliable technical support for the widespread application of bovine lactoferrin and thaumatin in the fields of food, medicine, and cosmetics, while also providing a useful reference for the efficient production of other bioactive substances.

[0044] The present invention will be further described in detail below with reference to specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0045] Example

[0046] The examples involve the addition amounts, contents and concentrations of various substances, wherein the percentages mentioned are by mass unless otherwise specified.

[0047] In the examples herein, if no specific description is given for laboratory temperature or operating temperature, the temperature generally refers to room temperature (15-30° C.).

[0048] Materials and methods

[0049] The whole gene synthesis, primer synthesis and sequencing in the examples were all completed by Suzhou Jinweizhi Biotechnology Co., Ltd.

[0050] The molecular biology experiments in the examples, including plasmid construction, enzyme digestion, ligation, competent cell preparation, transformation, culture medium preparation, etc., were performed primarily with reference to Molecular Cloning: A Laboratory Manual (3rd edition), edited by J. Sambrook and D.W. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. Specific experimental conditions can be determined by simple experiments when necessary.

[0051] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. These conditions can be adjusted through simple experiments if necessary.

[0052] The strains used included Aspergillus niger ATCC1015 and Aspergillus oryzae ATCC11488, both of which were purchased from the American Type Culture Collection (ATCC).

[0053] The experimental steps include:

[0054] 1. Natural Language Model Construction and Signal Peptide Variant Generation

[0055] 1. Data Collection and Organization: We collected a large number of amylase gene sequences and related functional data from public databases (such as GenBank and Uniprot) and published literature, and performed cleaning, denoising, and normalization to construct a high-quality biological sequence database. We ultimately selected the α-amylase signal peptide from Aspergillus oryzae (SEQ ID NO: 1) to promote the secretory expression of bovine lactoferrin and thaumatin in Aspergillus oryzae, abbreviated as SP0.

[0056] 2. Model training: Select an appropriate natural language model architecture (such as the Transformer model and its variants) and use the preprocessed database as training data to train the model. During training, optimize the model's hyperparameters, such as the learning rate, batch size, and number of iterations, to improve the model's accuracy and generalization capabilities.

[0057] 3. Signal Peptide Variant Generation: Based on the preset optimization goal (improving the expression of bovine lactoferrin and thaumatin in Aspergillus niger) and constraints, a trained natural language model was used to generate a series of amylase signal peptide variant sequences. The generated sequences were initially screened, and sequences that clearly did not conform to biological rules and requirements were removed. Candidate sequences with potential application value were retained for subsequent experimental verification.

[0058] 2. Gene Fusion and Expression Vector Construction

[0059] 4. Gene cloning: Bovine lactoferrin and thaumatin genes, as well as screened amylase signal peptide variant sequences including SP1-SP6, were obtained through PCR amplification technology. Homologous regions were introduced into primer design to facilitate subsequent gene connection operations.

[0060] 5. Fusion gene construction: Use overlap extension PCR technology to fuse the amylase signal peptide variant with the bovine lactoferrin or thaumatin gene. Design and introduce an optimized linker peptide coding sequence at the fusion site to ensure the integrity and correctness of the fusion gene.

[0061] 6. Construction of recombinant non-expression cassette: The correctly sequenced fusion gene will be further fused with other elements (such as promoter, terminator, selection marker, etc.) to form an expression cassette.

[0062] 3. Host Cell Transformation and Screening

[0063] 7. Protoplast preparation: For Aspergillus niger or Aspergillus oryzae, use enzymatic hydrolysis methods (such as snail enzyme, cellulase, etc.) to prepare protoplasts, and optimize enzymatic hydrolysis conditions (such as enzyme concentration, enzymatic hydrolysis time, temperature, osmotic pressure stabilizer, etc.) to obtain protoplasts with high activity and high yield.

[0064] 8. Transformation operation: The constructed recombinant expression vector is introduced into Aspergillus niger or Aspergillus oryzae protoplasts by PEG-mediated protoplast transformation, cultured on a regeneration medium containing a corresponding selection marker (such as an antibiotic resistance gene), and preliminary transformants are screened.

[0065] 9. Transformant identification: Use PCR technology to amplify the transformants obtained from the preliminary screening to detect whether the fusion gene has been successfully integrated into the host genome.

[0066] 4. Fermentation culture and testing

[0067] 10. Fermentation with engineered bacteria: The correctly identified positive transformants, i.e., engineered Aspergillus niger and engineered Aspergillus oryzae, are inoculated into a fermentation medium for fermentation.

[0068] 11. Product Detection: Samples were collected periodically during the fermentation process of the engineered Aspergillus niger and Aspergillus oryzae strains, and the expression level of bovine lactoferrin was detected by enzyme-linked immunosorbent assay (ELISA) or Western blot to evaluate the expression and secretion of the fusion gene in Aspergillus niger or Aspergillus oryzae.

[0069] Example 1: Construction of integration fragments

[0070] The amylase promoter and a synthetic amylase signal peptide or variant thereof, as well as bovine lactoferrin, a histag tag, a terminator sequence, and the selectable marker amdS gene were spliced ​​together by overlap. The wild-type amylase signal peptide was selected from the α-amylase signal peptide derived from Aspergillus oryzae, with the amino acid sequence MMVAWWSLFLYGLQVAAPALAA (SEQ ID NO: 1), designated herein as SP0.

[0071] The PCR amplification primers for some gene fragments in this example are listed in Table 1.

[0072] Primer Sequence(5’-3’) Pamy2-F agaattcatggtgttttgatc Pamy2(AoB)-R tgggagatggtgcaccagcgcacattcttacgtggagctgcagccaaagcaggtgccgc AoBLF-F gctccacgtaagaatgtgcgctg AoBLF(TglaA)-R cgaaatggattgattgtttagtgatgatggtgatgatggcgggtcaggaaggcgcaagc TglaA(AoB)-F gccttcctgacccgccatcatcaccatcatcactaaacaatcaatccatttcgctatag TglaA(Ptub)-R ttacatcccaaaaagcatcaccaccatcaccatcaccggtgtctgtatttccggatatc Ptubulin(T)-F ccgacggaattgaggatatccggaaatacagacaccggtgatggtgatggtggtgatgc Ptubulin-R gcttatcagcggccagttcttcccaggattgaggcattgtgccgggtagattgaagggg amdS-F tttcaataccttcaaccccttcaatctacccggcacaatgcctcaatcctgggaagaac amdS-R gcgtgaatgtaagcgtgacataactaattacatgactatggagtcaccacatttcccag Tcyc(amdS)-F gtggggaagttgctgggaaatgtggtgactccatagtcatgtaattagttatgtcacgc Tcyc1-R cttgcatgcaggcctctgcagtcgacgggcccgggatccgcaaattaaagccttcgagc Pamy2(AoT)-R acggtgtagctacaacggttgacaatctcaaatgtcgctgcagccaaagcaggtgccgc AoTha-F gcgacatttgagattgtcaac AoTha(TglaA)-R cgaaatggattgattgtttagtgatgatggtgatgatgcgccgtggggcagaaggtgac TglaA(AoT)-F ttctgccccacggcgcatcatcaccatcatcactaaacaatcaatccatttcgctatag

[0073] In Table 1, "-F" in the name stands for forward direction; "-R" stands for reverse direction.

[0074] Some gene sequences in this example are listed in Table 2.

[0075]

[0076]

[0077]

[0078]

[0079] Using the synthetic amylase promoter and signal peptide (Aspergillus oryzae alpha-amylase II promoter + signal peptide sequence in Table 2) as a template and primers Pamy2-F / Pamy2(AoB)-R, PCR amplification was performed to obtain the Pamy2 fragment. Using the synthetic bovine lactoferrin (the codon-optimized BLF gene fragment sequence in Table 2, SEQ ID NO: 6) as a template and primers AoBLF-F / AoBLF(TglaA)-R, PCR amplification was performed to obtain the AoBLF fragment. Using the Aspergillus niger CBS513.88 genome as a template and primers TglaA(AoB)-F / TglaA(Ptub)-R, PCR amplification was performed to obtain the TglaA fragment. The PCR fragment was recovered using a gel recovery kit. 1 μl of each of the three PCR products (Pamy2, AoBLF, TglaA) was mixed as a template, and Pamy2-F / TglaA(Ptub)-R was used as primers for Overlap PCR amplification to obtain the Pamy2-AoBLF-TglaA fragment.

[0080] Using the Aspergillus niger CBS513.88 genome as a template and Ptubulin(T)-F / Ptubulin-R as primers, PCR amplification was performed to obtain the Ptubulin fragment. Using the Aspergillus nidulans genome as a template and amdS-F / amdS-R as primers, PCR amplification was performed to obtain the amdS fragment. Using the Saccharomyces cerevisiae genome as a template and Tcyc(amdS)-F / Tcyc1-R as primers, PCR amplification was performed to obtain the Tcyc1 fragment. PCR fragments were recovered using a gel recovery kit. A 1 μL mixture of each of the three PCR products (Ptubulin, amdS, Tcyc1) was used as a template, and Ptubulin(T)-F / Tcyc1-R as primers was used to perform overlap PCR amplification to obtain the Ptubulin-amdS-Tcyc1 fragment.

[0081] A 1 μl mixture of each of the above PCR products, Pamy2-AoBLF-TglaA and Ptubulin-amdS-Tcyc1, was used as a template. Overlap PCR amplification was performed using Pamy2-F / Tcyc1-R primers to obtain the final integration fragment, namely, the integration fragment of the fusion gene of the wild amylase signal peptide SP0 and the bovine lactoferrin located downstream thereof: Pamy2-AoBLF-TglaA-Ptubulin-amdS-Tcyc1.

[0082] Example 2: Transformation and selection of positive clones

[0083] Aspergillus niger CBS513.88 or Aspergillus oryzae Rib40 spores were inoculated from glycerol stocks onto potato dextrose agar (PDA) plates (200 g / L potato, 20 g / L glucose, 15 g / L agar powder) and incubated at 30°C for 4-5 days to promote mycelial growth and spore production. Fresh spores were eluted with 0.85% sodium chloride and 0.02% Tween 80. The spore suspension was diluted to 2 × 10 8 The spores were inoculated into 250 ml of complete liquid medium (CM) at a concentration of 1000 spores / ml and incubated overnight (16-18 hours) at 30°C and 50 rpm. Germinated spores were collected by filtration through three layers of Mirabrax (previously cut and sterilized, purchased from Millipore), washed with SMC solution (1.33 mol / L sorbitol, 50 mmol / L calcium chloride, 20 mmol / L MES buffer, pH 5.8), and then digested with an enzyme solution (200 mg of lyase in 10 ml of SMC solution) at 30°C and 75 rpm for 3 hours. During the digestion process, the quality and quantity of the protoplasts were examined microscopically. Before protoplast collection, 10 ml of STC solution (1.33 mol / L sorbitol, 50 mmol / L calcium chloride, 10 mmol / L Tris / HCl, pH 7.5) was added to increase the amount of protoplasts released. The digested protoplasts were filtered through three layers of Mirabella to separate them from the cell wall debris. The filtrate was centrifuged at 10°C and 3500 rpm for 10 minutes. The supernatant was discarded, and the protoplasts were washed 1-2 times with 1 ml of STC solution at 10°C and 4500 rpm for 5 minutes each time. The protoplasts were then resuspended in STC solution. The volume of STC solution was set according to the number of transformations (100 μl for each transformation). The final concentration of the protoplasts should exceed 7×10 6 / ml. Prepare several 50 ml sterile centrifuge tubes according to the number of transformation experiments. For each transformation, add 100 microliters of protoplast suspension, 8-10 micrograms of plasmid DNA and 25 microliters of polyethylene glycol 6000 (25% polyethylene glycol 6000, dissolved in a 65°C water bath for 10 minutes) to an empty 50 ml centrifuge tube and mix gently. Subsequently, add 1 ml of polyethylene glycol 6000 and mix it evenly into the mixture. Then, place the centrifuge tube on ice and incubate for 5 minutes. Add 2 ml of STC solution to the suspension and mix it slightly. Next, add 10 ml of upper culture medium containing acetamide (20 mmol / L) to the suspension and mix it evenly. Cover the mixture on the lower culture medium containing acetamide (20 mmol / L) and culture the culture plate at 30°C for 5-7 days to allow the transformants to grow.

[0084] PCR verification: Using the transformant on the plate as a template and Pamy2-F / TglaA(Ptub)-R as primers, PCR amplification obtained a 3.0 Kb fragment, which was positive, indicating that the transformant was an engineered Aspergillus niger strain expressing amylase signal peptide SP0 and bovine lactoferrin.

[0085] Figure 1 Agarose gel electrophoresis showing the integration of the fusion gene of amylase signal peptide variant SP2 and bovine lactoferrin into the Aspergillus niger genome using PCR

[0086] According to methods similar to those in Example 1 and Example 2, an Aspergillus niger engineered bacterium expressing one of the amylase signal peptide variants SP1-SP6 and bovine lactoferrin was constructed; an Aspergillus oryzae engineered bacterium expressing an amylase signal peptide or one of its variants SP0-SP6 and bovine lactoferrin was constructed; an Aspergillus niger engineered bacterium expressing an amylase signal peptide or one of its variants SP0-SP6 and thaumatin was constructed; and an Aspergillus oryzae engineered bacterium expressing an amylase signal peptide or one of its variants SP0-SP6 and thaumatin was constructed.

[0087] Example 3: Fermentation detection of extracellular proteins

[0088] For example, a strain of Aspergillus niger expressing bovine lactoferrin was used. Positive transformants were resuspended in 500 μl of sterile distilled water, plated on potato dextrose agar (PDA) plates, and cultured at 30°C for 4-5 days to promote mycelial growth and spore production. 25 ml of fermentation medium was added to the cultured colonies, and the spores were scraped aseptically with an inoculation loop. The spore concentration was 1.3 × 10 7 A suspension containing 100 cells / mL of culture medium was used as the inoculum for the fungal culture. In a 500 mL Erlenmeyer flask, 100 mL of fermentation medium was added. The culture was incubated at 30°C on a shaker (180 rpm) for 3 days. Samples were collected at 24-hour intervals, centrifuged at 8000 × g for 5 minutes, and the supernatant was collected for analysis. Fermentation medium (%): ammonium nitrate 0.5%; potassium dihydrogen phosphate 0.1%; magnesium sulfate 0.05%; potassium chloride 0.05%; ferrous sulfate 0.001%; ​​maltose 1.0%; starch 1.0%; pH 6.2.

[0089] The His Tag ELISA Detection Kit (GenScript Cat. No.: L00436) was used to analyze bovine lactoferrin in the fermentation broth. The specific procedure is as follows:

[0090] 1. Add 50 μl of His-tag standard or diluted sample containing His-tagged protein to each well of the His-tag plate.

[0091] 2. Add 50 μl of anti-His monoclonal antibody to all wells.

[0092] 3. Cover the plate with sealing film and incubate at room temperature (20-25°C) for 30 minutes.

[0093] 4. Wash the plate four times with 260 μl of 1× washing buffer.

[0094] 5. Pat the plate with a paper towel to remove any remaining liquid in the wells.

[0095] 6. Add 100 μl of Antibody Tracker to all wells.

[0096] 7. Cover the plate with sealing film and incubate at room temperature for 30 minutes.

[0097] 8. Wash the plate four times with 260 μl of 1× washing buffer.

[0098] 9. Pat the plate with a paper towel to remove any remaining liquid in the wells.

[0099] 10. Add 100 μl of TMB substrate to all wells and incubate at room temperature for 10-15 minutes.

[0100] 11. Add 50 μl of stop solution to all wells to stop the enzyme reaction. Read the absorbance of the plate at 450 nm on a microplate reader.

[0101] 12. Draw a standard curve with absorbance as the ordinate and His-tag standard concentration as the abscissa.

[0102] 14. The amount of His-tagged protein in the sample was determined by extrapolating its optical density value to the standard curve.

[0103] Figure 2 A colorimetric photograph and a standard curve of the Histag ELISA assay are shown.

[0104] The target proteins in the fermentation broths of Aspergillus oryzae engineering bacteria expressing bovine lactoferrin, Aspergillus niger engineering bacteria expressing thaumatin, and Aspergillus oryzae engineering bacteria expressing thaumatin were analyzed and detected using similar methods. The results are listed in Table 3.

[0105] Table 3. Detection results of bovine lactoferrin and thaumatin fermentation levels by Aspergillus engineering bacteria

[0106]

[0107]

[0108] As can be seen from Table 3, compared with the wild-type amylase signal peptide variant SP0, some amylase signal peptide variants generated using natural language models, such as SP1 and SP4-6, not only have no promoting effect on the expression of exogenous target proteins bovine lactoferrin and thaumatin by Aspergillus (including Aspergillus oryzae and Aspergillus niger), but instead reduce the secretory expression of the target proteins. However, two amylase signal peptide variants, SP2 and SP3, promoted the secretion expression of bovine lactoferrin and thaumatin. SP2 increased the secretion expression level of bovine lactoferrin by 67.9% in Aspergillus niger, increased the secretion expression level of bovine lactoferrin by 108.8% in Aspergillus oryzae, increased the secretion expression level of thaumatin by 44.3% in Aspergillus niger, and increased the secretion expression level of thaumatin by 45.3% in Aspergillus oryzae; SP3 increased the secretion expression level of bovine lactoferrin by 86.8% in Aspergillus niger, increased the secretion expression level of bovine lactoferrin by 151% in Aspergillus oryzae, increased the secretion expression level of thaumatin by 47.8% in Aspergillus niger, and increased the secretion expression level of thaumatin by 26.9% in Aspergillus oryzae.

[0109] discuss

[0110] The results of the examples show that the amylase signal peptide variants SP2 and SP3 generated by the present invention using natural language models can effectively increase the secretory expression levels of bovine lactoferrin and thaumatin in Aspergillus niger or Aspergillus oryzae through fusion technology. This is likely due to the unique sequence structure advantages of the amylase signal peptide variants SP2 and SP3 generated by the natural language models, which enable them to better adapt to the expression systems of Aspergillus niger or Aspergillus oryzae. They also produce a synergistic effect with the bovine lactoferrin or thaumatin genes during expression and secretion, promoting the secretion of the target protein. However, the specific molecular mechanism requires further in-depth research, for example, through methods such as protein structure analysis and gene expression regulatory network analysis to reveal the expression regulation mechanism and protein interaction relationship of the fusion gene in host cells.

[0111] During the experiment, we also found that different amylase signal peptide variants generated by the natural language model, as well as different fusion strategies and fermentation conditions, significantly affected expression. Therefore, future research can further expand the scope and depth of application of the natural language model, explore more signal peptide variant combinations and fusion methods, and combine more advanced fermentation process optimization technologies, such as AI-based intelligent fermentation process control and multi-scale metabolic flux analysis, to achieve higher levels of secretory expression and improved production efficiency.

Claims

1. An amylase signal peptide variant, which is a polypeptide selected from the following: (a) a polypeptide having an amino acid sequence of MMVAWWSLFLYGLAVAAPALAA (SEQ ID NO: 2); (b) A polypeptide having the amino acid sequence MMVAWWSLFLLGLQVAAPALAA (SEQ ID NO: 3).

2. A gene encoding the amylase signal peptide variant according to claim 1.

3. The gene according to claim 2, wherein The gene encoding the amylase signal peptide variant SEQ ID NO: 2 is a polynucleotide having a nucleotide sequence as shown in SEQ ID NO: 4, or a polynucleotide having 90% or more homology to SEQ ID NO: 4; The gene encoding the amylase signal peptide variant SEQ ID NO: 3 is a polynucleotide having a nucleotide sequence as shown in SEQ ID NO: 5, or a polynucleotide having 90% or more homology with SEQ ID NO:

5.

4. A DNA molecule, characterized in that Comprising the gene according to claim 2.

5. Use of the amylase signal peptide variant according to claim 1 or the gene according to claim 2 in increasing the secretion and expression of bovine lactoferrin and / or thaumatin by Aspergillus niger, wherein the Aspergillus niger is Aspergillus niger ( Aspergillus niger ) or Aspergillus oryzae ( Aspergillus oryzae ).

6. The use according to claim 5, characterized in that The amylase signal peptide variant encoding gene according to claim 2 is fused with a bovine lactoferrin gene or a thaumatin gene and expressed in Aspergillus.

7. An integrated fragment, characterized in that For expressing bovine lactoferrin or thaumatin in Aspergillus, comprising the amylase signal peptide variant encoding gene as claimed in claim 2 and a bovine lactoferrin gene located downstream, or The method comprises the amylase signal peptide variant encoding gene according to claim 2 and a thaumatin gene located downstream.

8. An engineered Aspergillus niger or Aspergillus oryzae strain for producing bovine lactoferrin, characterized in that: The integration fragment as claimed in claim 7 is integrated into its genome.

9. Use of the engineered Aspergillus niger or Aspergillus oryzae according to claim 8 in producing bovine lactoferrin or thaumatin.

Images