Cell penetrating peptide Phage-Dec and antibacterial application thereof

Abstract

The invention belongs to the field of medicines, and particularly relates to a cell penetrating peptide Phage-Dec and an application thereof in antibiosis. The cell penetrating peptide Phage-Dec has excellent cell penetrating power and antibacterial activity, and can effectively permeate cell membranes and target and inhibit bacterial growth, so that the antibacterial purpose is achieved. Researches show that the Phage-Dec has a remarkable inhibition effect on a plurality of pathogenic bacteria and can effectively reduce the breeding speed of the bacteria. The use of the cell penetrating peptide provides a new thought for antibacterial treatment, has a good clinical application prospect, and lays a solid foundation for developing novel antibacterial drugs based on bacteriophage sources.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine, and specifically relates to a phage-derived cell-penetrating peptide Phage-Dec and its application in antibacterial treatment. Background Art

[0002] Cell-penetrating peptides (CPPs) are a class of short peptides that can effectively penetrate cell membranes and transport bioactive molecules such as endogenous macromolecules (such as proteins, DNA, and RNA). These peptides are usually composed of 10 to 30 amino acids and have strong cationic and hydrophilic properties, which enable them to interact with cell membranes. However, existing CPPs still have certain limitations in selectivity and efficiency, which has promoted the development of new cell-penetrating peptides.

[0003] In recent years, bacteriophages have attracted widespread attention as an excellent natural carrier. Bacteriophages can infect bacteria and proliferate inside their cells. Different phages have diverse surface proteins that help them bind to and enter bacterial membranes. These characteristics make phages an excellent source for the development of new cell-penetrating peptides. Through phage display technology, researchers can screen peptides with excellent penetration properties. For example, a series of small peptides can be screened using high-throughput screening methods and their differences in cell membrane penetration ability can be evaluated. With the help of the properties of these penetrating peptides, scientists can design systems that can effectively deliver drugs, genetic materials or other bioactive molecules, overcoming many defects in traditional drug delivery systems, such as poor biocompatibility and insufficient targeting. In addition, phage-derived cell-penetrating peptides are also selective and targeted, and their affinity for specific cell types can be enhanced by modifying their sequence or structure. This property makes them potentially useful in the development of precision medicine, gene therapy, and anti-infective drugs. Phages can not only serve as therapeutic carriers, but also increase the flexibility of targeted drug delivery strategies through their high affinity and specificity.

[0004] Since Gram-negative bacteria have an outer cell membrane, it is difficult for phage lytic enzymes to penetrate the outer cell membrane and contact the peptidoglycan layer, so they cannot play a lytic role. Therefore, there are few studies on phage lytic enzymes for Gram-negative bacteria, and most phage lytic enzymes come from land. As the largest living organism on earth, the ocean has a much larger number of bacteria than land. Therefore, the development and application of new cell-penetrating peptides derived from marine phages provide new ideas and technical means for research in multiple fields such as drug delivery, gene therapy and cell engineering. At present, in-depth research on these peptides is still in progress, in order to achieve more efficient and targeted biological treatment strategies and promote the development of biomedicine. Summary of the invention

[0005] In view of the deficiencies of the prior art, the present invention provides a cell-penetrating peptide Phage-Dec derived from marine bacteriophages and its application in antibacterial treatment, so as to overcome the deficiencies of the prior cell-penetrating peptides in terms of efficiency, selectivity and stability. It also lays a certain technical foundation for the research and development and application of the drug, food industry, health care product industry and functional supplements that facilitate the prevention or treatment of Gram-negative bacterial infections.

[0006] In view of the deficiencies in the prior art, the present invention provides a marine phage-derived cell-penetrating peptide Phage-Dec.

[0007] Another object of the present invention is to provide a method for preparing the above-mentioned cell-penetrating peptide.

[0008] Another object of the present invention is to provide use of the cell-penetrating peptide.

[0009] The object of the present invention is achieved by the following technical scheme: a marine-derived phage cell penetrating peptide, named Phage-Dec, whose amino acid sequence is shown in SEQ ID NO. 1. Its amino acid sequence is only 77.78% similar to the reported amino acid sequence, and is a new peptide with a novel sequence.

[0010] SEQ ID NO.1: KAKKRRQRRRPPFSSSSNNNNLQK.

[0011] A gene encoding the above-mentioned marine phage-derived cell-penetrating peptide, whose nucleotide sequence is as shown in SEQ ID NO.2.

[0012] SEQ ID NO.2:

[0013] AAAGCGAAAAAACGCCGCCAGCCGCCGCCGCCCGCCGTTTAGCAGCAGCAACAACAACAACCTGCAGAAA.

[0014] An expression vector containing the above coding gene. An engineered yeast expression system, the genome of which contains the above coding gene; preferably, the cells of which contain the above expression vector.

[0015] Application of the above marine phage-derived cell-penetrating peptide in inhibiting bacteria.

[0016] The bacteria include at least one of E. coli and S. typhi.

[0017] Application of the above cell penetrating peptide in the preparation of antibacterial products.

[0018] An antimicrobial agent comprising the above-mentioned cell-penetrating peptide.

[0019] Beneficial effects:

[0020] Compared with the prior art, the present invention has the following advantages and effects:

[0021] (1) The present invention aims to solve the problem that there are few studies on phage-derived cell-penetrating peptides for Gram-negative bacteria. The present invention successfully heterologously expresses a cell-penetrating peptide Phage-Dec derived from a marine phage and uses it to act on Gram-negative bacteria.

[0022] (2) The cell-penetrating peptide Phage-Dec in the present invention is not easy to induce bacterial resistance, has a lower effective concentration, can be applied in daily life scenarios, and has broad industrial application prospects.

[0023] (3) The cell-penetrating peptide Phage-Dec prepared by the present invention can be compounded with an outer membrane permeabilizer to improve its antibacterial effect and effectively kill Escherichia coli on various surfaces, and has a wide range of application value in the preparation of antibacterial products. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0025] Figure 1 It is the cytotoxicity graph of Phage-Dec.

[0026] Figure 2 It is a graph of the cell penetration ability of Phage-Dec.

[0027] Figure 3 It is the antibacterial (S. typhimurium 14028) activity of Phage-Dec.

[0028] Figure 4 It is the antibacterial (S. aureus 29213) activity of Phage-Dec.

[0029] Figure 5 It is the secondary structure of Phage-Dec. DETAILED DESCRIPTION

[0030] The following is a detailed description of an embodiment of the present invention. This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and a specific operation process are given, but the protection scope of the present invention is not limited to the following embodiment.

[0031] Materials and reagents: Plasmid pPICZαA-Phage-Dec was synthesized by Sangon Biotech (Shanghai) Co., Ltd.; empty plasmid pPICZαA was stored in this laboratory; plasmid extraction kit, Sangon Biotech (Shanghai) Co., Ltd.; in the following examples, the chemical reagents used were purchased from regular chemical reagent suppliers and were of analytical purity.

[0032] Example 1 Components of Phage-Dec recombinant expression vector

[0033] The gene Phage-Dec of the cell-penetrating peptide of the present invention is derived from the marine bacteriophage M-PHM1SY-11, and is obtained by PCR amplification of the conserved fragment in the conserved region and reverse PCR amplification. The cell-penetrating peptide gene of the present invention contains 69 base sequences and encodes 23 amino acid sequences. Using the Basic Local Alignment Search Tool (Blast) in the National Center for Biotechnology Information (NCBI), it was found that the similarity between its amino acid sequence and the reported amino acid sequence was only 77.78%, and it was a new peptide with a novel sequence.

[0034] The nucleotides used for the subsequent recombinant expression of the cell-penetrating peptide Phage-Dec of the present invention are fully synthesized products of BGI. The sequence of Phage-Dec is modified with restriction endonuclease, EcoR I and Xba I sites, and the recombinant primers are designed as follows (underlined are restriction endonuclease sites, italics are restriction endonuclease protection bases):

[0035] Forward primer: SEQ ID NO.3: Phage-Dec-F:

[0036] 5'-GAATTCAAAGCGAAAAAACGCC-3'-3'(EcoR I)

[0037] Reverse primer: SEQ ID NO.4: Phage-Dec-R:

[0038] 5'-TCTAGATTCTGCAGAAAACCTG-3'(Xba I)

[0039] The PCR amplification conditions were as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 59°C annealing for 30 s, 72°C extension for 1 min, for a total of 30 cycles; 72°C extension for 5 min; 4°C stabilization for 15 min. The DNA polymerase used in the PCR reaction was Primerstar HS purchased from Dalian Bao Biotechnology Company.

[0040] The PCR product was double digested with restriction endonucleases EcoR I and Xba I, and the PCR product after digestion was recovered by agarose gel electrophoresis. pPICZαA plasmid DNA (Invitrogen, USA) was also double digested with restriction endonucleases EcoR I and Xba I, and agarose gel electrophoresis was performed to recover the product fragments after digestion. The enzymes used for digestion and the substrate reaction system (temperature, time, DNA dosage, etc.) were operated according to the product instructions provided by Dalian Bao Biotechnology.

[0041] The double-digested PCR product and pPICZαA plasmid vector were ligated according to the instructions of DNA ligase (Dalian Bao Biotechnology Co., Ltd.); the ligation product was transformed into Pichia pastoris X33 (Invitrogen, USA). The obtained recombinant plasmid pPICZαA-phage-Dec was linearized by Sac I, and >5ug of the linearized recombinant plasmid was mixed with 80μL of competent Pichia pastoris X33, transferred to an electroporation cup with a slit distance of 0.2cm, and electroporated under ice bath for 5min, 2500V, 25μF, and 200Ω. After the electroporation, 1mL of 1M sorbitol solution was immediately added, transferred to a 1.5mL centrifuge tube, and incubated at 30℃ for 2h. 400μL of the transformation product was spread on YPD (containing 100μg / mL Zeocin) solid culture medium and cultured at 30℃ for 2 days until a single colony appeared. Then, PCR identification of Pichia pastoris transformants was performed. A single colony of the transformant was picked and inoculated into 10 mL of YPD culture medium. The culture was cultured at 30°C until the culture medium was saturated. The yeast DNA was extracted using a yeast genomic DNA rapid extraction kit and then sequenced for identification.

[0042] Example 2 Expression and purification of Phage-Dec

[0043] The recombinant Pichia pastoris single colony was inoculated into 10 mL YPD liquid medium (containing 100 μg / mL Zeocin) and cultured at 30°C, 200 rpm for 24 h. All colonies were inoculated into 200 mL BMGY medium and cultured at 30°C, 200 rpm for 24 h to reach OD 600 Reach 5.0. Centrifuge at 3000g for 10 minutes at room temperature, discard the supernatant, wash the bacteria with sterile water 3 times to remove the remaining glycerol, and finally resuspend the bacteria with 100mL BMMY medium, transfer to a sterile 500mL conical flask, and use 0.5% methanol to induce expression and culture at 28°C, 200rpm for 72h. Collect the supernatant fermentation liquid and bacterial precipitate for subsequent determination of the expression site.

[0044] The supernatant fermentation broth was placed in -80℃ freezer for 16h, and then freeze-dried at -50℃ in a vacuum freeze dryer for 4 days. The concentrate was reconstituted with 20mL of binding buffer in the nickel column purification kit, and the cell penetrating peptide protein was purified according to the instructions of the nickel column purification kit; the bacterial precipitate was reconstituted with 15mL of binding buffer, and 200μL of PMSF was added (to prevent degradation and damage of exogenous proteins), ice bathed for 20 minutes, and ultrasonically disrupted for 25min at 450W with a time interval of 10 seconds. Centrifuged at 4℃ and 3000g for 10 minutes, the supernatant was collected, and nickel column purification was performed. The obtained cell penetrating peptide protein was identified by Tricine-SDS-PAGE for the expression of the target protein. Since the periplasmic cell penetrating peptide expressed by bacterial precipitate has a limited yield and a low concentration. Considering the later practical application, the expression of the fermentation broth supernatant is more conducive to obtaining a high concentration of cell penetrating peptide. Therefore, in the next experiment, Pichia pastoris X33 was selected to express pPICZαA-phage-Dec cell penetrating peptide in the supernatant fermentation broth as the subsequent development and utilization object. After nickel column purification, the concentration of the cell-penetrating peptide protein was determined by Bradford method, and finally 2.58 mg / mL of pPICZαA-phage-Dec cell-penetrating peptide protein was obtained. The molecular weight was determined by LCMS and then purified. Finally, HPLC was used for separation and purification, and then freeze-dried to obtain a peptide with a purity of >95%.

[0045] Purification conditions: stationary phase: C18; mobile phase configuration: Pump A: V(tfa) / V(water)=1 / 1000; Pump B: V(TFA) / v(acetonitrile)=1 / 1000; flow rate: 10 mL / min; retention time: between 20-30 min.

[0046] Example 3 Determination of antibacterial activity of cell-penetrating peptides

[0047] The minimum inhibitory concentration of the peptide was determined by the standard microbroth dilution method. The bacteria were cultured overnight in MHB medium at 37°C and 220 rpm, and then the bacterial solution was transferred to new MHB medium and cultured until the logarithmic growth phase of the bacteria. Finally, the bacteria were diluted to 2x10 5 CFU / mL. 50 μL of peptide and suspension at a final concentration of 1-64 μM was added to each well of a 96-well plate. In addition, only MHB medium was used as a negative control, and only bacteria and MHB medium were used as a positive control. The 96-well plate was placed in a 37°C incubator for 18 hours and the plate was read at 492 nm (OD 492 ) to determine the minimum inhibitory concentration. The test was repeated three times independently, with two replicates for each. The results are shown in Table 1.

[0048] Table 1 Minimum inhibitory concentration (μM) of cell penetrating peptide Phage-Dec.

[0049]

[0050]

[0051] As can be seen from Table 1, the cell penetrating peptide Phage-Dec exhibits strong antibacterial activity against a variety of bacteria, including Salmonella typhimurium, Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus, with the minimum inhibitory concentration being between 2.3 and 8.5 μM.

[0052] Example 4 Determination of cytotoxicity of cell-penetrating peptides

[0053] Mouse macrophage RAW 264.7 cells were diluted to 4 × 10 5 cells / mL, 50 μL / well of the cell suspension was added to the 96-well plate, and the cells were cultured overnight in a 37°C cell culture incubator containing 5% CO2 until the cells were completely attached and grew. 50 μL of a polypeptide with a concentration of 64-0.125 μM was added to a new 96-well plate, 50 μL of cell culture medium was used as a positive control, and 100 μL of cell culture medium alone was used as a negative control. The liquid in each well of the above 96-well plate was transferred to the corresponding well of the 96-well plate containing cells, and cultured in a 37°C cell culture incubator containing 5% CO2 for 4 hours. Subsequently, 25 μL of MTT with a concentration of 0.5 mg / mL was added to each well of the 96-well plate, and the culture was continued for 3 hours in a 37°C cell culture incubator containing 5% CO2. Finally, the supernatant was discarded, 150 μL of DMSO was added to each well to dissolve the formazan crystals, and the plate was marked with a microplate reader at a wavelength of 570 nm (OD 570 ) to measure the absorbance value. The experiment was repeated three times independently. The cell viability calculation formula is as follows: Cell viability (%) = [(sample OD 570 - Negative control OD 570 ) / (positive control OD 570 - Negative control OD 570 )]×100%.

[0054] Figure 1 The cytotoxicity of the cell penetrating peptide Phage-Dec on mouse macrophages RAW 264.7 was studied. In the concentration range of 0.125-16 μM, the cell penetrating peptide Phage-Dec had little effect on the survival rate of mouse macrophages, which remained above 80%, indicating that the cell penetrating peptide Phage-Dec has good biocompatibility.

[0055] Example 5 Determination of cell penetration ability of cell penetrating peptides

[0056] Mouse macrophage RAW 264.7 cells were diluted to 2 × 10 5cells / mL, 1 mL of cell suspension was added to the 24-well plate, and the cells were cultured overnight in a 37°C cell culture incubator containing 5% CO2 until the cells were completely attached to the wall. FITC-labeled cell-penetrating peptide Phage-Dec was added and cultured for 2 h in a 37°C cell culture incubator containing 5% CO2, 0.4% trypan blue was added for 3 min to quench the extracellular fluorescence, and then the cells were collected after washing 2-3 times with PBS, and finally analyzed by flow cytometry.

[0057] Figure 2 As for the cell penetration ability of the cell penetrating peptide, at a concentration of 16 μM, the cell penetrating peptide Phage-Dec can penetrate into more than 79% of mouse macrophages, indicating that it has efficient cell penetration ability.

[0058] Example 6 Determination of intracellular bactericidal activity of cell-penetrating peptides

[0059] Mouse macrophage RAW 264.7 cells were diluted to 2 × 10 5 cells / mL, add 1mL of cell suspension to the 24-well plate, and continue to culture overnight in a 37℃ cell culture incubator with 5% CO2 until the cells are completely attached to the wall. S.typhimurium14028 or S.aureus 29213 was cultured in MHB medium at 37℃ and 220rpm overnight, and then the bacterial solution was transferred to a new MHB medium and cultured until the logarithmic growth phase of the bacteria. S.typhimurium 14028 or S.aureus 29213 was added to the 24-well plate containing cells and infected at 37℃ for 1h (cell: bacteria = 1:10). Then, gentamicin at a concentration of 100μg / mL was added and cultured at 37℃ for 1h to completely eliminate extracellular bacteria. After rinsing with PBS, different concentrations of cell-penetrating peptides were added, and PBS was added to the control, and cultured at 37℃ for 4h. After washing with PBS, the cells were lysed with 0.25% Triton X-100 for 15 min, spread on MHA plates after dilution, and counted after incubation in a 37°C incubator overnight.

[0060] Figure 3 and Figure 4 The intracellular antibacterial activity of the cell penetrating peptide Phage-Dec was shown in Figure 2. The killing rates of 16 μM Phage-Dec against Salmonella typhimurium and Staphylococcus aureus in mouse macrophages were both above 85%, indicating that it has excellent anti-intracellular bacterial activity.

[0061] Example 7 Bioinformatics Analysis

[0062] The amino acid primary structure of the Phage-Dec peptide was analyzed through professional protein bioinformatics websites (such as http: / / expasy.org, https: / / predictprotein.org / , https: / / swissmodel.expasy.org / ). Its lipophilic index (Aliphatic index) is 108.45, and its average hydrophilicity (GRAVY) is 0.67, indicating that Phage-Dec is a hydrophobic antimicrobial peptide. A higher lipophilic index means that the peptide can interact with lipids to a certain extent, which is conducive to its binding to the bacterial membrane.

[0063] According to the sequence characteristics, Phage-Dec contains more α-helical structures (such as Figure 5 ), a structure that is often seen in antimicrobial peptides because they can form holes on the cell membrane surface and destroy the membrane integrity of bacteria. In addition, there are also some random coil regions, and the diversity of these structures contributes to the broad-spectrum antibacterial activity of the peptide against different bacteria. When analyzed using the corresponding structure prediction tools, the three-dimensional structure of Phage-Dec showed a conformation dominated by α-helix. This structure is not only conducive to the mutual binding of its hydrophobic surface with the hydrophobic interaction of phospholipids, but also may interact with specific components of the bacterial membrane through specific spatial conformations.

[0064] Furthermore, based on the amino acid composition of KPhage-Dec, it was found that the total negative charge of Asp+Glu was 1, and the total positive charge of Arg+Lys was 5. Therefore, Phage-Dec is an antimicrobial peptide with a significant positive charge as a whole. The cationic property helps to enhance its antimicrobial activity, because cationic antimicrobial peptides can bind to the negatively charged outer membrane of bacteria through electrostatic attraction, thereby causing cell membrane destruction. In summary, the cationic property and hydrophobicity of Phage-Dec give it great potential in antimicrobial activity, which enables it to effectively target the bacterial surface and enhance its bactericidal effect, thereby exhibiting good antimicrobial activity.

[0065] In summary, the cell-penetrating peptide Phage-Dec has strong antibacterial activity against common intracellular bacteria such as Salmonella typhimurium, Listeria monocytogenes, and Staphylococcus aureus. It can efficiently penetrate macrophages and has excellent bactericidal effects on intracellular Salmonella and Staphylococcus aureus. It has low toxicity to macrophages and kills bacteria by destroying the bacterial membrane, and has extremely high application potential.

Claims

1. A cell penetrating peptide, named Phage-Dec, whose amino acid sequence is shown in SEQ ID NO.

1.

2. The nucleotide sequence corresponding to the cell-penetrating peptide according to claim 1, wherein the nucleotide sequence is shown in SEQ ID NO.

2.

3. Use of the cell penetrating peptide Phage-Dec as claimed in claim 1 in inhibiting bacteria.

4. The use according to claim 3, characterized in that: The bacteria include at least one of E. coli and S. typhi.

5. Use of the cell penetrating peptide according to claim 1 in the preparation of antibacterial products.

Images