Denitrifying strain capable of removing bisphenol A and nitrogen under low-oxygen condition as well as culture method and application of denitrifying strain

Abstract

The invention provides a denitrifying strain capable of removing bisphenol A and nitrogen under a low-oxygen condition as well as a culture method and application of the denitrifying strain, and belongs to the technical field of microorganisms. The denitrifying strain is Raoultella ornithinolytica strain S51, the Raoultella ornithinolytica strain S51 is preserved in the China Center for Type Culture Collection, and the preservation number of the Raoultella ornithinolytica strain S51 is CCTCC (China Center for Type Culture Collection) NO: M 20241684. The raoultella ornithinolyticus S51 can respectively grow by taking nitrate nitrogen, nitrite nitrogen and ammonia nitrogen as unique nitrogen sources, the nitrate nitrogen removal rate reaches 99.26% under the condition that C / N is equal to 3, and meanwhile, the BPA removal rate is 78.20%. The bacterium S51 can simultaneously realize denitrification and BPA removal functions, is convenient to use and simple to operate, reduces the sewage treatment cost, and has a good sewage treatment application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a denitrification strain capable of removing bisphenol A and nitrogen under hypoxic conditions, a cultivation method and application thereof. Background Art

[0002] The recycling of urban sewage is an effective way to alleviate water shortage, prevent water pollution and improve water quality. However, the nitrogen and other nutrients contained in the secondary effluent of urban sewage are key factors leading to eutrophication and algal bloom risks. Therefore, controlling the denitrification efficiency of recycled water is crucial for the reuse of urban sewage to replenish surface water bodies such as rivers and lakes.

[0003] Biological denitrification is the most economical and effective way to remove nitrogen. Biological denitrification is divided into two parts, nitrification and denitrification. Nitrification is the process of converting ammonia nitrogen into nitrate nitrogen; denitrification is the process of converting nitrate nitrogen in the water body into nitrite nitrogen and a series of intermediate gaseous products, and finally into harmless gas nitrogen to be removed from the water body. It is an important process for the complete denitrification of water bodies. Denitrifying bacteria are important bacteria that complete this process, so the discovery of efficient denitrifying bacteria is of great significance to biological denitrification.

[0004] Bisphenol A (BPA) is an endocrine disrupting chemical that is widely present in water bodies. Human exposure to BPA increases the risk of obesity, diabetes and heart disease. A large number of studies have been conducted on the removal of BPA, such as adsorption, membrane filtration, ion exchange, advanced oxidation and coagulation and flocculation, while microbial degradation of BPA has the advantages of low operating cost, eco-friendliness and wide applicability compared with other methods.

[0005] Prior art CN114591853B discloses a heavy metal-resistant aerobic denitrification strain that removes both BPA and nitrogen under oxygen-rich and high carbon-nitrogen ratio conditions and its application. The denitrifying bacteria is Pseudomonas stutzeri, with a deposit number of CCTCC NO: M20211101, which was deposited in the China Center for Type Culture Collection on August 30, 2021. Pseudomonas stutzeri can simultaneously achieve the functions of denitrification and BPA removal, with a nitrate nitrogen removal rate of 76.4%. However, hypoxic environments are widely present in various natural environments such as rivers, lakes, swamps, and wetlands. Obvious hypoxic zones begin to appear below 2 cm in the surface of the bottom mud of swamps and wetlands. 20-50% of the water column in rivers and lakes is in a hypoxic state. The intensification of eutrophication has expanded the hypoxic environment of the water body, and even hypoxia will occur in the surface area. Aerobic denitrifying bacteria have a high demand for oxygen, and their denitrification function is severely limited in such a hypoxic environment, making it difficult to function efficiently. On the contrary, facultative anaerobes and microaerobic bacteria can survive tenaciously under low oxygen or even anoxic conditions with their unique physiological mechanisms, and maintain a stable population structure and efficient metabolic activities. Therefore, it is of great significance to explore a denitrifying bacterium that can achieve efficient denitrification and effective removal of BPA under low oxygen or even anaerobic conditions and low carbon-nitrogen ratio. Summary of the invention

[0006] In order to solve the above problems, the present invention provides a denitrifying strain capable of removing bisphenol A and nitrogen under hypoxic conditions, a cultivation method and application thereof, which has efficient bisphenol A and nitrogen removal functions.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides a Raoultella ornithinolytica strain S51, wherein the Raoultella ornithinolytica strain S51 is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 20241684.

[0009] In a second aspect, the present invention provides a method for culturing Raoultella ornithine-solidifying S51, comprising inoculating Raoultella ornithine-solidifying S51 into a culture medium.

[0010] Specifically, the culture medium is a liquid culture medium, a solid culture medium, or a semi-solid culture medium.

[0011] In some embodiments, the liquid culture medium includes a nitrogen-rich medium (DBM), a nitrate nitrogen medium, a nitrite nitrogen medium, an ammonia nitrogen medium, and a bisphenol A-only carbon source removal test medium.

[0012] In some embodiments, the solid culture medium is bromothymol blue solid culture medium (BTB).

[0013] Wherein, the specific components of the above culture medium are as follows:

[0014] Nitrogen-rich medium (DBM): 5.0 g / L KNO3, 11.1 g / L sodium succinate hexahydrate, 1.0 g / L KH2PO4, 7.03 g / L Na2HPO4·12H2O, 0.13 g / L MgSO4·7H2O, 2 mL / L trace elements, adjusted to pH 7.0; trace elements: 1.8 g / L FeCl2·4H2O, 0.25 g / L CoCl2·6H2O, 0.01 g / L NiCl2·6H2O, 0.01 g / L CuCl2·2H2O, 0.70 g / L MnCl2·4H2O, 0.1 g / L ZnCl2, 0.5 g / L H3BO 3， 0.03g / L Na2MoO4·2H2O, 0.01g / L NaSeO3·5H2O.

[0015] Bromothymol blue solid medium (BTB): 5.0g / L KNO3, 11.1g / L sodium succinate hexahydrate, 1.0g / L KH2PO4, 7.03g / L Na2HPO4·12H2O, 0.13g / L MgSO4·7H2O, 2mL / L trace elements, 1% bromothymol blue, 2% agar powder, adjusted to pH 7.0-7.3.

[0016] Nitrate nitrogen medium (C / N=15:1): 0.108g / L KNO3, 0.768g / L sodium acetate, 0.226g / L KH2PO4, 0.792g / L Na2HPO4·12H2O, 0.01g / L MgSO4·7H2O, 2mL / L trace elements, adjusted to pH 7.0-7.3.

[0017] Nitrite medium (C / N=15:1): 0.0738g / L NaNO2, 0.768g / L sodium acetate, 0.226g / L KH2PO4, 0.792g / L Na2HPO4·12H2O, 0.01g / L MgSO4·7H2O, 2mL / L trace elements, adjusted to pH 7.0-7.3.

[0018] Ammonia nitrogen culture medium (C / N=15:1): 0.058g / L NH4Cl, 0.768g / L sodium acetate, 0.226g / L KH2PO4, 0.792g / L Na2HPO4·12H2O, 0.01g / L MgSO4·7H2O, 2mL / L trace elements, adjusted to pH 7.0-7.3.

[0019] Bisphenol A removal test medium (C / N=3:1): 0.108g / L KNO3, 0.154g / L sodium acetate, 0.226g / L KH2PO4, 0.792g / L Na2HPO4·12H2O, 0.01g / L MgSO4·7H2O, 2mL / L trace elements.

[0020] Specifically, the inoculation amount of the Raoultella ornithine-lytica S51 is 2%-5%.

[0021] Specifically, the culture method includes: a culture temperature of 20° C.-45° C., a culture pH of 3-9, a culture time of 0-80 hours, a C / N ratio of 1-60, and a dissolved oxygen content of 3%-10%.

[0022] Preferably, the culture method includes: a culture temperature of 25°C-35°C, a culture pH of 5-9, a culture time of 0-72h, a C / N ratio of 1-60, and a dissolved oxygen content of 3.8%-7.6%.

[0023] In some embodiments, the culture temperature is 25°C, 30°C and 35°C, the culture pH is 5, 7 and 9, the culture time is 0h, 12h, 24h, 36h, 48h, 60h and 72h, and the C / N ratio is 1, 3, 5, 10, 15, 30 and 60.

[0024] Herein, "C / N ratio" refers to the ratio of carbon in the carbon source to nitrogen in the nitrogen source.

[0025] In a third aspect, the present invention provides a use of Raoultella ornithine degrading S51 or Raoultella ornithine degrading S51 prepared by the aforementioned culture method in the preparation of nitrogen removal and bisphenol A removal products in wastewater.

[0026] Specifically, the nitrogen removal and bisphenol A removal products are selected from sewage treatment agents or microbial agents.

[0027] More specifically, the microbial agent is a powder or a liquid preparation.

[0028] In a fourth aspect, the present invention provides a sewage treatment agent, comprising the Raoultella ornithine-solidifying Bacteria S51 or the Raoultella ornithine-solidifying Bacteria S51 prepared by the aforementioned culture method.

[0029] The beneficial effects of the present invention are:

[0030] The present invention provides a low oxygen denitrification strain capable of removing both bisphenol A and nitrogen, a cultivation method and an application thereof. The denitrification strain is Raoultella ornithine degrading S51, and the removal rates of nitrate nitrogen, nitrite nitrogen and ammonia nitrogen are 97.09%, 100% and 64.96% respectively, and it has the potential for enhanced application of high nitrogen-rich wastewater. Secondly, under low oxygen and low carbon-nitrogen ratio (C / N=3) conditions, the removal rate of Raoultella ornithine degrading S51 for 100 μg / L bisphenol A is 78.2%, and the removal rate of nitrate nitrogen is 99.26%. Therefore, Raoultella ornithine degrading S51 has both good denitrification ability and bisphenol A removal ability, and there is no antagonism between the two.

[0031] Collection Instructions

[0032] Bacterial species name: Raoultella ornithine-solidifying S51;

[0033] Classification and nomenclature: Raoultella ornithinolytica strain S51;

[0034] Preservation time: July 25, 2024;

[0035] Deposit number: CCTCC NO:M 20241684;

[0036] Depository: China Center for Type Culture Collection;

[0037] Storage address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is the Gram staining and electron microscopy image of Raoultella ornithines S51.

[0039] Figure 2 Phylogenetic tree of Raoultella ornithine-solidifying S51.

[0040] Figure 3 This is a gel image of the amplification of genes related to the nitrogen pathway of Raoultella ornithinesophorae S51.

[0041] Figure 4 A is the growth curve of Raoultella ornithine-lysing S51 in nitrate medium, NH4 + -N concentration, NO3 - -N concentration and NO2 - -N concentration results; B is the growth curve of Raoultella ornithine-lysing S51 in nitrite medium, NH4 + -N concentration, NO3 - -N concentration and NO2 - -N concentration result diagram; C is the growth curve of Raoultella ornithine-lysing S51 in ammonia nitrogen medium, NH4+ -N concentration, NO3 - -N concentration and NO2 - -N concentration results graph.

[0042] Figure 5 A shows the effect of different carbon sources on the growth and denitrification of Raoultella ornithine-solubilizing S51; B shows the effect of different C / N ratios on the denitrification capacity of Raoultella ornithine-solubilizing S51; C shows the effect of different pH on the denitrification capacity of Raoultella ornithine-solubilizing S51; D shows the effect of different culture temperatures on the denitrification capacity of Raoultella ornithine-solubilizing S51.

[0043] Figure 6 OD of Raoultella ornithine-solubilizing S51 after 72 h of culture at different concentrations of BPA 600 And the degradation rate of BPA.

[0044] Figure 7 To understand the degradation of BPA by Raoultella ornithine S51.

[0045] Figure 8 A is the growth curve of the control group (without 100 μg / L BPA), Raoultella ornithine degrading S51, NH4 + -N concentration, NO3 - -N concentration, NO2 - -N concentration and TN concentration results; B is the growth curve of Raoultella ornithine-degrading S51 in the treatment group (100 μg / L BPA was added to the culture medium), NH4 + -N concentration, NO3 - -N concentration, NO2 - -N concentration and TN concentration result graph. DETAILED DESCRIPTION

[0046] The present invention will be further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0047] Example 1 Isolation and Identification of Raoultella ornithine-solidifying S51

[0048] 1. Isolation of Raoultella ornithine-solidifying S51

[0049] Take 5g of sediment (sediment from Huajin River, Anhui Normal University) and add it to 100mL of enrichment medium (DBM), put it in an anaerobic bag and culture it in a 30℃ incubator. Take 5mL of culture medium and transfer it to fresh DBM medium, repeat enrichment for 3 rounds. -1 -10 -7 Gradient dilution was performed, and 10 mL was spread on BTB solid medium and cultured in a 30°C incubator until obvious single colonies appeared. Single blue colonies were picked, purified by multiple streaking, and stored in a 4°C refrigerator.

[0050] 2. Identification of Raoultella ornithine-solidifying S51

[0051] 1. Morphological identification

[0052] The target strain was inoculated into a 50 mL centrifuge tube containing nitrogen-free medium (50 mL), the tube mouth was sealed with a sealing film, and the tube was incubated in a 30°C incubator for 24 hours. When the colony grew to the logarithmic phase, it was subjected to Gram staining and microscopic examination. The results were as follows: Figure 1 As shown, the target strain belongs to Gram-negative bacteria, the colonies are small and round, grayish white, moist, smooth, and rod-shaped. The size of the strain observed by electron microscopy is (0.5-0.7μm)×(1-1.25μm).

[0053] 2. Molecular Biological Identification

[0054] The 16S rDNA of the target strain was sequenced, and the sequence length was 1411bp. The sequence is shown in SEQ ID NO.1. The sequencing results were subjected to Blast analysis in NCBI to search for sequence homology and compare. It was found that the homology with Raoultella ornithinolytica strain WM1 (Gene Bank No.: CP049752.1) was 100%, so it was named Raoultella ornithinolytica strain S51. A phylogenetic tree was constructed using MEGA6.0 using closely related species. The results are shown in Figure 2 .

[0055] SEQ ID NO.1:

[0056]

[0057] Example 2 Amplification of nitrogen pathway-related genes in Raoultella ornithinesolidum S51

[0058] The nitrogen pathway-related genes narG, nirS, norR and nosZ of Raoultella ornithinesolyticus S51 were amplified. The amplification primer sequences were shown in Table 1 below, and the amplification conditions were shown in Table 1.

[0059] SEQ ID NO.2(narG-F): TCGCCSATYCCGGCSATGTC;

[0060] SEQ ID NO.3 (narG-R): GAGTTGTACCAGTCRGCSGAYTCSG;

[0061] SEQ ID NO.4 (nirS-F): AAGGTGCGGTGGTTCAGAT;

[0062] SEQ ID NO.5(nirS-R): ATGTGTTGCGGCGTTTCA;

[0063] SEQ ID NO.6(norR-F): GGAAATGACCAAGAACGAGC;

[0064] SEQ ID NO.7 (norR-R): AGGTAGCAGACCAGACCGAT;

[0065] SEQ ID NO.8 (nosZ-F): CGYTGTTCMTCGACAGCCAG;

[0066] SEQ ID NO. 9 (nosZ-R): CATGTGCAGNGCRTGGCAGAA.

[0067] Table 1 Amplification conditions of denitrase-related genes

[0068]

[0069] The amplification system is as follows: the total reaction system is 25 μL (10 μL ddH2O, 12.5 μL 2×PCR Mix, 1 μL primer-F, 1 μL primer-R, 1 μL bacterial liquid template DNA).

[0070] The electrophoresis results of the amplified fragments are as follows Figure 3 As shown, it can be seen that Raoultella ornithine-solidifying S51 has hypoxic denitrification potential.

[0071] Example 3 Determination of nitrogen removal capacity of Raoultella ornithine degrading S51

[0072] Raoultella ornithine-lysing S51 was inoculated into 50 mL of nitric acid culture medium (NO3 - -N as nitrogen source), nitrite nitrogen culture medium (50 mL) (with NO2 - -N as nitrogen source) and ammonia nitrogen medium (50 mL) (NH4 + -N is nitrogen source), the bottle mouth was wrapped with sealing film, and cultured in a 30℃ incubator for 48h. Samples were taken every 6h to measure OD 600 Value, NH4 + -N concentration, NO3 - -N concentration, NO2 - -N concentration and TN concentration, the results are shown in Figure 4 .

[0073] Figure 4 A in NO3 - -N was used as the single nitrogen source (C / N=15:1), the growth curve of the strain increased first and then stabilized within 0-36h; within 18h, NO3 - The concentration of -N dropped from the initial 15.62mg / L to 0.45mg / L, the nitrogen removal rate was 0.84mg / (L·h), the removal rate reached 97.09%, and the total nitrogen (TN) removal rate was 91.81%. There was almost no NH4 + -N and NO2 - -N accumulation.

[0074] Figure 4 B in NO2 - -N is the nitrogen source (C / N=15:1), within 36h, NO2 - The concentration of -N dropped from the initial 14.92 mg / L to 0 mg / L, the nitrogen removal rate was 0.5 mg / (L·h), the nitrite nitrogen removal rate was 100%, and the total nitrogen (TN) removal rate was 85.6%.

[0075] Figure 4 C in NH4 + -N was the single nitrogen source (C / N=15:1), and Raoultella ornithine-solidifying S51 could not utilize all the ammonia nitrogen within 48 hours, but there was no accumulation of nitrite nitrogen during the metabolic process. The ammonia nitrogen removal rate was 64.96%, and the total nitrogen (TN) removal rate was 17.4%.

[0076] The above results indicate that Raoultella ornithine-degrading S51 exhibits efficient inorganic nitrogen removal capability and has the potential for enhanced application in high nitrogen-rich wastewater.

[0077] Example 4 Determination of the Optimal Growth Conditions of Raoultella ornithine-solidifying S51

[0078] Prepare medium containing different carbon sources to test the nitrogen removal ability of Raoultella ornithine degrading S51. The carbon source concentration is set to 225 mg / L (C / N=15:1). The carbon sources are potassium sodium tartrate, sodium succinate hexahydrate, sodium citrate, sodium acetate and glucose. Raoultella ornithine degrading S51 is inoculated into different carbon source mediums (50 mL) in 50 mL centrifuge tubes at an inoculation rate of 2%. The bottle mouth is wrapped with sealing film and statically cultured in a 30°C incubator. Samples are taken for 48 hours to measure OD 600 The results are as follows: Figure 5 As shown in A, Raoultella ornithine-degrading S51 can grow under these five carbon sources. When sodium succinate hexahydrate, sodium citrate, sodium acetate and glucose are used as carbon sources, Raoultella ornithine-degrading S51 has a strong affinity for NO3 - The removal efficiencies of -N were 92.3%, 89.2%, 96.63% and 94.51% respectively. When potassium sodium tartrate was used as the only carbon source, Raoultella ornithine-degrading S51 could hardly grow and metabolize normally, and NO3 - The removal rate of -N was only 39.4%. The results showed that sodium acetate might be the best carbon source for Raoultella ornithinesolyticus S51.

[0079] The nitrogen removal capacity of Raoultella ornithine degrading S51 was tested by preparing culture media with C / N ratios of 1, 3, 5, 10, 15, 30 and 60. Raoultella ornithine degrading S51 was inoculated into 50 mL centrifuge tubes with different C / N ratios (50 mL) at a 2% inoculation rate, the bottle mouth was wrapped with sealing film, and the tube was placed in a 30°C incubator for static culture. Samples were taken for 48 hours to measure OD 600 The results are as follows: Figure 5 As shown in B, when the C / N ratio reaches 3, the denitrification rate of the strain reaches a maximum of 99.14%. The nitrate-nitrogen removal rate of the strain within the C / N ratio of 1-60 is higher than 80%, indicating that Raoultella deornithine S51 can adapt to multiple carbon-nitrogen ratio environments.

[0080] Nitrate nitrogen culture medium (C / N=15:1) with pH values ​​of 5, 7, and 9 was prepared to test the nitrogen removal capacity of Raoultella ornithine degrading S51. Raoultella ornithine degrading S51 was inoculated into culture medium (50 mL) with different pH values ​​in 50 mL centrifuge tubes at a 2% inoculation rate, the bottle mouth was wrapped with sealing film, and the tube was placed in a 30°C incubator for static culture. Samples were taken for 48 hours to measure OD 600 The results are as follows: Figure 5 As shown in C, the strain S51 had a strong effect on NO3 - The removal rates of -N were 6.38%, 95.84% and 90.81% respectively, indicating that the strain can only tolerate neutral and weak alkaline environments but not acidic environments.

[0081] Raoultia ornithine-solubilizing S51 was inoculated into 50 mL of nitric acid medium (C / N=15:1) in 50 mL centrifuge tubes at a 2% inoculation rate. The bottle mouth was wrapped with sealing film and cultured in 25°C, 30°C and 35°C incubators for 48 h. Samples were taken to measure OD 600 and nitrogen removal rate, the results are as follows Figure 5 As shown in D, under 30℃ condition, the strain had the highest nitrate-nitrogen removal rate of 96.82%.

[0082] Example 5 Removal characteristics of BPA by Raoultella ornithine degrading S51

[0083] The strain was inoculated into 50 mL of nitric acid medium (C / N=3) in a 50 mL centrifuge tube at a 5% inoculum volume, and 100 μg / L, 500 μg / L, and 1000 μg / L of BPA were added to the medium, and samples were taken after 72 h to measure OD 600 Value and BPA degradation rate, the results are shown in Figure 6 . It can be seen that the removal rates of BPA in different treatment groups were 78.2%, 48.25%, and 37.52%, respectively, and there were significant differences among the groups. This may be because when the BPA concentration is relatively low, Raoultella ornithine-degrading bacteria S51 can utilize BPA as a carbon source, and the BPA degradation rate is relatively high; when the BPA concentration increases, the higher concentration of BPA inhibits the growth of the strain, and the BPA degradation rate decreases. Therefore, a BPA concentration of 100 μg / L was selected as the initial concentration for subsequent studies on the degradation mechanism of BPA by strain S51.

[0084] The strain was inoculated into 50 mL of nitric nitrogen medium (C / N=3) in a 50 mL centrifuge tube at a 5% inoculum volume, 100 μg / L of BPA was added to the medium, and samples were taken every 12 hours to measure the BPA concentration. The results are shown in Figure 7 The results showed that the degradation rate of Raoultella ornithine degrading S51 for 100μg / L BPA reached 78.20% within 72h, indicating that S51 has good degradation ability for low-concentration BPA. At a BPA concentration of 100μg / L, the degradation rate from 0 to 72h reached 2.25μg / (L·h).

[0085] The strain was inoculated into 50 mL nitric acid medium (C / N=3) in a 50 mL centrifuge tube at a 5% inoculum. A control group and a treatment group were set up. 100 μg / L BPA was added to the medium of the treatment group. Then, samples were taken every 12 h to measure the OD of the control group and the treatment group. 600 Value, NH4 + -N concentration, NO3 - -N concentration, NO2 - -N concentration and TN concentration, the results are shown in Figure 8It can be seen that within 24 hours of cultivation, the NO3 - -N concentrations dropped rapidly, NO2 - The concentration of -N decreases, and there is almost no accumulation in the end, and there is no NH4 in the reaction process + -N production. At 72h, the nitrate removal rates of the treatment group and the control group were 99.26% and 99.17%, respectively. After data analysis, p>0.05, there was no significant difference between the two, indicating that the addition of BPA did not affect the nitrate removal of strain S51. Therefore, strain S51 has both good denitrification ability and BPA removal ability, and there is no antagonism between the two.

[0086] Compared with the prior art CN114591853B, the strain in CN114591853B has a strain preservation number of CCTCC NO: M20211101. When the strain is used as the sole nitrogen source under the conditions of rich oxygen and high carbon-nitrogen ratio (C / N=60), the removal rate reaches 98.38%, and the total nitrogen removal rate reaches 66%. At the same time, the removal rate of 10 mg / L BPA reaches 88.2%. When the strain is used as the sole nitrogen source under the conditions of low oxygen and low carbon-nitrogen ratio (C / N=3), the removal rate reaches 99.17%, and the total nitrogen removal rate reaches about 87.56%. By adding different concentrations of BPA, it is found that the higher the concentration, the lower the removal rate of BPA by strain S51. The removal rate of 100 μg / L BPA concentration is 78.2%, and the nitrate removal rate is 99.26%. It can be seen that compared with the prior art, the strain involved in the present invention has good environmental adaptability, and can stably survive and function in a low-oxygen and low-carbon-nitrogen ratio water environment. Its unique advantage is that it can not only efficiently remove nitrogen from water, but also show excellent degradation ability for BPA, providing an innovative biological solution to solve the problem of water pollution.

Claims

1. A strain of Raoultella ornithinolytica S51, characterized in that: The Raoultella ornithine-solidifying bacteria S51 is deposited in China Center for Type Culture Collection with a deposit number of CCTCC NO: M20241684.

2. The method for culturing Raoultella ornithine-solidifying S51 according to claim 1, characterized in that: The culturing method comprises inoculating Raoultella ornithineilyticus S51 into a culture medium.

3. The culture method according to claim 2, characterized in that The culture medium is a liquid culture medium, a solid culture medium or a semi-solid culture medium.

4. The culture method according to claim 2, characterized in that The inoculation amount of the Raoultella ornithine-lytica S51 is 2%-5%.

5. The culture method according to claim 2, characterized in that: The culture method comprises: a culture temperature of 20° C.-45° C., a culture pH of 3-9, a culture time of 0-80 hours, a C / N ratio of 1-60, and a dissolved oxygen content of 3%-10%.

6. The culture method according to claim 2, characterized in that: The culture method comprises: a culture temperature of 25° C.-35° C., a culture pH of 5-9, a culture time of 0-72 hours, a C / N ratio of 1-60, and a dissolved oxygen content of 3.8%-7.6%.

7. Use of the Raoultella ornithine-degrading S51 described in claim 1 or the Raoultella ornithine-degrading S51 prepared by the culturing method described in any one of claims 2 to 6 in preparing products for removing nitrogen and bisphenol A from wastewater.

8. The use according to claim 7, characterized in that: The nitrogen removal and bisphenol A removal products are selected from sewage treatment agents or microbial agents.

9. The use according to claim 8, characterized in that: The microbial agent is a powder or a liquid preparation.

10. A sewage treatment agent, characterized in that: It includes the Raoultella ornithine-solidifying S51 described in claim 1 or the Raoultella ornithine-solidifying S51 prepared by the cultivation method described in any one of claims 2-6.

Images