Denitrifying bacterial strain with both bisphenol a and nitrogen removal under hypoxic conditions, culture method and application thereof

Abstract

The application provides a denitrifying bacterial strain with the functions of removing bisphenol A (BPA) and nitrogen under hypoxic conditions, a culture method and application thereof, and belongs to the technical field of microorganisms. The denitrifying bacterial strain is Raoultella ornithinolytica strain S51, which is preserved in the China Center for Type Culture Collection (CCTCC) with a preservation number of CCTCC NO:M 20241684. The Raoultella ornithinolytica strain S51 can grow by taking nitrate nitrogen, nitrite nitrogen and ammonia nitrogen as the only nitrogen source respectively, and the removal rate of nitrate nitrogen reaches 99.26% under the condition of C / N=3, and the removal rate of BPA is 78.20%. The bacterial strain S51 can simultaneously realize the functions of denitrification and BPA removal, is convenient to use, simple to operate, reduces the sewage treatment cost, and has a good application prospect in sewage treatment.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial technology, and particularly relates to a denitrifying bacterial strain with the functions of removing bisphenol A and nitrogen under low-oxygen conditions, a culture method and application thereof. BACKGROUND

[0002] Urban sewage recycling is an effective way to alleviate water resource shortage, prevent water pollution, and improve water environmental quality. However, the nitrogen and other nutrients contained in the secondary effluent of urban sewage are the key factors leading to water eutrophication and water bloom risk. Therefore, controlling the denitrification efficiency of recycled water is crucial for urban sewage reuse to supply surface water bodies such as rivers and lakes.

[0003] Biological denitrification is the most economical and effective way of denitrification. Biological denitrification is divided into two parts, nitrification and denitrification process. Nitrification is the conversion of ammonia nitrogen to nitrate nitrogen. Denitrification is the conversion of nitrate nitrogen in water to nitrite nitrogen and a series of intermediate gaseous products, and finally to harmless gas nitrogen, which is removed from the water body. It is an important process for complete denitrification of water body. Denitrifying bacteria are an important bacterial flora for completing this process. Therefore, the discovery of high-efficiency denitrifying bacteria is of great significance to biological denitrification.

[0004] Bisphenol A (BPA) is an endocrine-disrupting chemical that is widely present in water bodies. Human exposure to BPA increases the risk of obesity, diabetes, and heart disease. Numerous studies have been conducted to remove BPA, such as adsorption, membrane filtration, ion exchange, advanced oxidation, and coagulation-flocculation, while microbial degradation of BPA has advantages over other methods, such as low operating cost, ecological friendliness, and wide applicability.

[0005] The prior art CN114591853B discloses a heavy metal-resistant aerobic denitrifying strain with BPA and nitrogen removal under oxygen-rich high carbon-nitrogen ratio conditions and application thereof. The denitrifying strain is Pseudomonas stutzeri, and the preservation number is CCTCC NO: M20211101, which was preserved in the China Center for Type Culture Collection on August 30, 2021. The Pseudomonas stutzeri strain can simultaneously achieve the functions of denitrification and BPA removal, and the removal rate of nitrate nitrogen is 76.4%. However, low-oxygen environments widely exist in various rivers, lakes, marshes, wetlands and other natural environments. The low-oxygen zone appears obviously below the surface layer of 2 cm of the bottom mud in marshes and wetlands, 20-50% of the water column of rivers and lakes is in a low-oxygen state, and the aggravation of eutrophication causes the expansion of the low-oxygen environment of the water body, and even the low-oxygen phenomenon appears in the surface layer. The aerobic denitrifying bacteria have a high demand for oxygen, and their denitrification function is severely limited in such a low-oxygen environment, and it is difficult to play a role efficiently. On the contrary, facultative anaerobic bacteria and micro-aerobic bacteria can survive in low-oxygen or even anoxic conditions by virtue of their unique physiological mechanisms, and maintain stable population structure and efficient metabolic activity. Therefore, it is of great significance to deeply explore a denitrifying strain that can simultaneously achieve efficient denitrification and effective removal of BPA under low-oxygen or even anoxic and low-carbon-nitrogen ratio conditions. SUMMARY

[0006] To solve the above problems, the present application provides a denitrifying strain with simultaneous removal of bisphenol A and nitrogen under low-oxygen conditions, a culture method and application thereof, which has efficient bisphenol A and nitrogen removal functions.

[0007] To achieve the above purpose, the present application adopts the following technical solutions:

[0008] In a first aspect, the present application provides a Raoultella ornithinolytica strain S51, which is preserved in the China Center for Type Culture Collection with a preservation number of CCTCC NO: M20241684.

[0009] In a second aspect, the present application provides a culture method of the Raoultella ornithinolytica strain S51, which comprises inoculating the Raoultella ornithinolytica strain S51 into a culture medium.

[0010] Specifically, the culture medium is a liquid culture medium, a solid culture medium or a semi-solid culture medium.

[0011] In some embodiments, the liquid culture medium includes a nitrogen-rich culture medium (DBM), a nitrate nitrogen culture medium, a nitrite nitrogen culture medium, an ammonia nitrogen culture medium and a bisphenol A removal test culture medium with bisphenol A as the sole carbon source.

[0012] In some embodiments, the solid medium is bromothymol blue solid medium (BTB).

[0013] wherein the specific components of the above medium are as follows:

[0014] Nitrogen-rich medium (DBM): 5.0 g / L KNO3, 11.1 g / L sodium succinate hexahydrate, 1.0 g / L KH2PO4, 7.03 g / L Na2HPO4·12H2O, 0.13 g / L MgSO4·7H2O, 2 mL / L trace elements, adjusted to pH 7.0; trace elements: 1.8 g / L FeCl2·4H2O, 0.25 g / L CoCl2·6H2O, 0.01 g / L NiCl2·6H2O, 0.01 g / L CuCl2·2H2O, 0.70 g / L MnCl2·4H2O, 0.1 g / L ZnCl2, 0.5 g / L H3BO 3， 0.03 g / L Na2MoO4·2H2O, 0.01 g / L NaSeO3·5H2O.

[0015] Bromothymol blue solid medium (BTB): 5.0 g / L KNO3, 11.1 g / L sodium succinate hexahydrate, 1.0 g / L KH2PO4, 7.03 g / L Na2HPO4·12H2O, 0.13 g / L MgSO4·7H2O, 2 mL / L trace elements, 1% bromothymol blue, 2% agar powder, adjusted to pH 7.0-7.3.

[0016] Nitrogen-nitrate medium (C / N = 15:1): 0.108 g / L KNO3, 0.768 g / L sodium acetate, 0.226 g / L KH2PO4, 0.792 g / L Na2HPO4·12H2O, 0.01 g / L MgSO4·7H2O, 2 mL / L trace elements, adjusted to pH 7.0-7.3.

[0017] Nitrogen-nitrite medium (C / N = 15:1): 0.0738 g / L NaNO2, 0.768 g / L sodium acetate, 0.226 g / L KH2PO4, 0.792 g / L Na2HPO4·12H2O, 0.01 g / L MgSO4·7H2O, 2 mL / L trace elements, adjusted to pH 7.0-7.3.

[0018] Nitrogen-ammonia medium (C / N = 15:1): 0.058 g / L NH4Cl, 0.768 g / L sodium acetate, 0.226 g / L KH2PO4, 0.792 g / L Na2HPO4·12H2O, 0.01 g / L MgSO4·7H2O, 2 mL / L trace elements, adjusted to pH 7.0-7.3.

[0019] Bisphenol A removal test medium (C / N = 3:1): 0.108 g / L KNO3, 0.154 g / L sodium acetate, 0.226 g / L KH2PO4, 0.792 g / L Na2HPO4·12H2O, 0.01 g / L MgSO4·7H2O, 2 mL / L trace elements.

[0020] Specifically, the inoculation amount of the inoculation of the Raoultella ornithinolytica S51 is 2%-5%.

[0021] Specifically, the culture method comprises: a culture temperature of 20-45℃, a culture pH of 3-9, a culture time of 0-80h, a C / N ratio of 1-60, and a dissolved oxygen content of 3%-10%.

[0022] Preferably, the culture method comprises: a culture temperature of 25-35℃, a culture pH of 5-9, a culture time of 0-72h, a C / N ratio of 1-60, and a dissolved oxygen content of 3.8%-7.6%.

[0023] In some embodiments, the culture temperature is 25℃, 30℃ and 35℃, the culture pH is 5, 7 and 9, the culture time is 0h, 12h, 24h, 36h, 48h, 60h and 72h, and the C / N ratio is 1, 3, 5, 10, 15, 30 and 60.

[0024] In the formula, the "C / N ratio" refers to the ratio of carbon in the carbon source to nitrogen in the nitrogen source.

[0025] In a third aspect, the application provides an application of the Raoultella ornithinolytica S51 or the Raoultella ornithinolytica S51 prepared by the culture method in the preparation of a product for nitrogen removal and bisphenol A removal in sewage.

[0026] Specifically, the product for nitrogen removal and bisphenol A removal is selected from a sewage treatment agent or a microbial agent.

[0027] Further specifically, the microbial agent is a powder or a liquid preparation.

[0028] In a fourth aspect, the application provides a sewage treatment agent comprising the Raoultella ornithinolytica S51 or the Raoultella ornithinolytica S51 prepared by the culture method.

[0029] The application has the following beneficial effects:

[0030] The application provides a low-oxygen denitrifying strain with bisphenol A and nitrogen removal functions, a culture method and application thereof. The denitrifying strain is Raoultella ornithinolytica S51, and the removal rates of nitrate nitrogen, nitrite nitrogen and ammonia nitrogen are 97.09%, 100% and 64.96% respectively, and the strain has the potential for high-nitrogen wastewater strengthening application. In addition, the removal rate of 100 μg / L bisphenol A by the Raoultella ornithinolytica S51 under low-oxygen and low-carbon-nitrogen ratio (C / N=3) conditions is 78.2%, and the removal rate of nitrate nitrogen is 99.26%. Therefore, the Raoultella ornithinolytica S51 has good denitrification capacity and bisphenol A removal capacity, and there is no antagonism between the two.

[0031] DEPOSIT DESCRIPTION

[0032] Strain name: Raoultella ornithinolytica S51

[0033] Classification name: Raoultella ornithinolytica strain S51

[0034] Deposit time: July 25, 2024

[0035] Deposit number: CCTCC NO: M 20241684

[0036] Deposit unit: China Center for Type Culture Collection

[0037] Deposit address: No. 299, Bayi Road, Wuchang District, Wuhan, Hubei Province. BRIEF DESCRIPTION OF DRAWINGS

[0038] Figure 1 Gram staining and electron microscope pictures of Raoultella ornithinolytica S51.

[0039] Figure 2 Phylogenetic tree of Raoultella ornithinolytica S51.

[0040] Figure 3 Amplification gel map of nitrogen pathway related genes of Raoultella ornithinolytica S51.

[0041] Figure 4 A is the growth curve of Raoultella ornithinolytica S51 in nitrate nitrogen culture medium, NH4 + -N concentration, NO3 - -N concentration and NO2 - A is the growth curve of Raoultella ornithinolytica S51 in nitrate nitrogen culture medium, NH4 + -N concentration, NO3 - -N concentration and NO2 - A is the growth curve of Raoultella ornithinolytica S51 in nitrate nitrogen culture medium, NH4+ -N concentration, NO3 - -N concentration and NO2 - -N concentration result chart.

[0042] Figure 5 A is the effect of different carbon sources on the growth and denitrification of Raoultella ornithinolytica S51; B is the effect of different C / N ratios on the denitrification ability of Raoultella ornithinolytica S51; C is the effect of different pH values on the denitrification ability of Raoultella ornithinolytica S51; D is the effect of different culture temperatures on the denitrification ability of Raoultella ornithinolytica S51.

[0043] Figure 6 OD of Raoultella ornithinolytica S51 after being cultured for 72 h under different concentrations of BPA 600 and the degradation rate of BPA.

[0044] Figure 7 BPA degradation by Raoultella ornithinolytica S51.

[0045] Figure 8 A is the growth curve of Raoultella ornithinolytica S51 in the control group (without adding 100 μg / L BPA), NH4 + -N concentration, NO3 - -N concentration, NO2 - -N concentration and TN concentration result chart; B is the growth curve of Raoultella ornithinolytica S51 in the treatment group (100 μg / L BPA is added to the culture medium), NH4 + -N concentration, NO3 - -N concentration, NO2 - -N concentration and TN concentration result chart. DETAILED DESCRIPTION

[0046] The present application will be further described below in conjunction with specific examples, which are not used to limit the present application, but only to illustrate the present application. Unless otherwise specified, the experimental methods used in the following examples are generally performed according to conventional conditions. Unless otherwise specified, the materials, reagents, etc. used in the following examples can be obtained from commercial channels.

[0047] Example 1: Isolation and identification of Raoultella ornithinolytica S51

[0048] I. Isolation of Raoultella ornithinolytica S51

[0049] Take 5g of sediment (sediment from Huajin River, Anhui Normal University) and add it to 100mL of enrichment medium (DBM), put it into anaerobic bag and culture it in 30℃ incubator. Take 5mL of culture medium and transfer it to fresh DBM medium, repeat enrichment for 3 rounds. -1 -10 -7 10 mL of the solution was spread onto BTB solid medium and cultured in a 30°C incubator until distinct single colonies appeared. Single blue colonies were picked, purified by multiple streaking, and stored in a 4°C refrigerator.

[0050] 2. Identification of Raoultella ornithinelytica S51

[0051] 1. Morphological identification

[0052] The target strain was inoculated into a 50 mL nitrogen-depleted culture medium in a 50 mL centrifuge tube. The tube was sealed with a sealing film and incubated in a 30°C incubator for 24 hours. When the colony grew to the logarithmic phase, it was subjected to Gram staining and microscopic examination. The results were as follows: Figure 1 As shown, the target strain is a Gram-negative bacterium. The colonies are small, round, and protruding, off-white, moist, and smooth, with rod-shaped bodies. Electron microscopic observation of the strain size is (0.5-0.7μm)×(1-1.25μm).

[0053] 2. Molecular Biological Identification

[0054] The 16S rDNA of the target strain was sequenced, yielding a 1411bp sequence. The sequence is shown in SEQ ID NO. 1. Blast analysis was performed in NCBI to search for sequence homology and compare the results. It was found to be 100% homologous to Raoultella ornithinolytica strain WM1 (Gene Bank No. CP049752.1), so it was named Raoultella ornithinolytica strain S51. A phylogenetic tree was constructed using MEGA6.0 using closely related species. The results are shown in Figure 1. Figure 2 .

[0055] SEQ ID NO.1:

[0056]

[0057] Example 2 Amplification of Raoultella ornithinolytica S51 nitrogen pathway related genes

[0058] The Raoultella ornithinolytica S51 nitrogen pathway related genes narG, nirS, norR and nosZ genes were amplified, and the amplification primer sequences are shown in Table 1, and the amplification conditions are shown in Table 1.

[0059] SEQ ID NO. 2 (narG-F): TCGCCSATYCCGGCSATGTC;

[0060] SEQ ID NO. 3 (narG-R): GAGTTGTACCAGTCRGCSGAYTCSG;

[0061] SEQ ID NO. 4 (nirS-F): AAGGTGCGGTGGTTCAGAT;

[0062] SEQ ID NO. 5 (nirS-R): ATGTGTTGCGGCGTTTCA;

[0063] SEQ ID NO. 6 (norR-F): GGAAATGACCAAGAACGAGC;

[0064] SEQ ID NO. 7 (norR-R): AGGTAGCAGACCAGACCGAT;

[0065] SEQ ID NO. 8 (nosZ-F): CGYTGTTCMTCGACAGCCAG;

[0066] SEQ ID NO. 9 (nosZ-R): CATGTGCAGNGCRTGGCAGAA.

[0067] Table 1 Amplification conditions of denitrase related genes

[0068]

[0069] The amplification system was as follows: the total reaction system was 25 μL (10 μL ddH2O, 12.5 μL 2x PCR Mix, 1 μL primer-F, 1 μL primer-R, 1 μL bacterial liquid template DNA).

[0070] The electrophoresis results of the amplified fragments are shown in Figure 3 It can be seen that Raoultella ornithinolytica S51 has low oxygen denitrification potential.

[0071] Example 3 Determination of nitrogen removal capacity of Raoultella ornithinolytica S51

[0072] Raoultella ornithinolytica S51 was inoculated into nitrate medium (50 mL) (with NO3 - -N as nitrogen source), nitrite medium (50 mL) (with NO2 - -N as nitrogen source) and ammonia medium (50 mL) (with NH4 + -N as nitrogen source) respectively with an inoculation amount of 2%, and the bottle mouth was wrapped with sealing film. The samples were taken every 6 hours to measure OD 600 value, NH4 + -N concentration, NO3 - -N concentration, NO2 - -N concentration and TN concentration in 30°C incubator for 48 hours. The results are shown in Figure 4 .

[0073] Figure 4 In medium A, NO3 - -N was used as the sole nitrogen source (C / N = 15:1), and the growth curve of the strain increased first and then leveled off within 0-36h. Within 18h, the concentration of NO3 - -N decreased from the initial 15.62 mg / L to 0.45 mg / L, the nitrogen removal rate was 0.84 mg / (L·h), the removal rate reached 97.09%, and the total nitrogen (TN) removal rate was 91.81%. In this process, almost no NH4 + -N and NO2 - -N accumulated.

[0074] Figure 4 In medium B, NO2 - -N was used as the nitrogen source (C / N = 15:1), and within 36h, the concentration of NO2 - -N decreased from the initial 14.92 mg / L to 0 mg / L, the nitrogen removal rate was 0.5 mg / (L·h), the nitrite nitrogen removal rate was 100%, and the total nitrogen (TN) removal rate was 85.6%.

[0075] Figure 4 In medium C, NH4 + -N was used as the sole nitrogen source (C / N = 15:1), and Raoultella ornithinolytica S51 could not utilize all the ammonia nitrogen within 48h, but there was no nitrite accumulation in the metabolic process, the ammonia nitrogen removal rate was 64.96%, and the total nitrogen (TN) removal rate was 17.4%.

[0076] The above results show that Raoultella ornithinolytica S51 has high inorganic nitrogen removal capacity and has the potential for application in the enrichment of nitrogen-rich wastewater.

[0077] Example 4 Determination of the optimal growth conditions of Raoultella ornithinolytica S51

[0078] The medium containing different carbon sources was prepared for testing the nitrogen removal ability of Raoultella ornithinolytica S51, and the carbon source concentration was set to 225 mg / L (C / N = 15:1), and the carbon sources were potassium sodium tartrate, sodium succinate hexahydrate, sodium citrate, sodium acetate and glucose. Raoultella ornithinolytica S51 was inoculated into 50 mL centrifuge tubes containing different carbon sources (50 mL) at an inoculation amount of 2%, the bottle mouth was wrapped with sealing film, and the culture was incubated at 30°C in an incubator, and the OD value and nitrogen removal rate were measured after 48 h of sampling. 600 The results are shown in Table A. Figure 5 As shown in Table A, Raoultella ornithinolytica S51 can grow under the five carbon sources, and when sodium succinate hexahydrate, sodium citrate, sodium acetate and glucose are used as carbon sources, the removal efficiency of NO3 - -N by Raoultella ornithinolytica S51 is 92.3%, 89.2%, 96.63% and 94.51% respectively. When potassium sodium tartrate is used as the only carbon source, Raoultella ornithinolytica S51 cannot grow and metabolize normally, and the removal rate of NO3 - -N is only 39.4%. The results show that sodium acetate may be the best carbon source for Raoultella ornithinolytica S51.

[0079] The medium with C / N ratios of 1, 3, 5, 10, 15, 30 and 60 was prepared for testing the nitrogen removal ability of Raoultella ornithinolytica S51. Raoultella ornithinolytica S51 was inoculated into 50 mL centrifuge tubes containing different C / N ratios (50 mL) at an inoculation amount of 2%, the bottle mouth was wrapped with sealing film, and the culture was incubated at 30°C in an incubator, and the OD value and nitrogen removal rate were measured after 48 h of sampling. 600 The results are shown in Table B. Figure 5 As shown in Table B, when the C / N ratio reaches 3, the denitrification rate of the strain reaches the highest 99.14%, and the nitrate removal rate of the strain in the C / N ratio of 1-60 is higher than 80%, which shows that Raoultella ornithinolytica S51 can adapt to multiple carbon-nitrogen ratio environments.

[0080] The nitrate medium with pH values of 5, 7 and 9 (C / N = 15:1) was prepared for testing the nitrogen removal ability of Raoultella ornithinolytica S51. Raoultella ornithinolytica S51 was inoculated into 50 mL centrifuge tubes containing different pH values (50 mL) at an inoculation amount of 2%, the bottle mouth was wrapped with sealing film, and the culture was incubated at 30°C in an incubator, and the OD value and nitrogen removal rate were measured after 48 h of sampling. 600 The results are shown in Table C. Figure 5 As shown in Table C, when the pH values are 5, 7 and 9, the removal rates of NO3 - -N by strain S51 are 6.38%, 95.84% and 90.81% respectively, which shows that the strain can only tolerate neutral and weak alkaline environments, and cannot tolerate acidic environments.

[0081] The Raoultella ornithinolytica S51 was inoculated into the nitrate culture medium (C / N=15:1) (50 mL) in a 50 mL centrifuge tube at an inoculation amount of 2%, the bottle opening was wrapped with sealing film, and the culture was statically cultured in a 25℃, 30℃ and 35℃ incubator for 48 h, and the OD was measured 600 and the nitrogen removal rate, and the results are shown in Figure 5 As shown in D in the table, under the condition of 30℃, the strain has the highest nitrate nitrogen removal rate of 96.82%.

[0082] Example 5: BPA removal characteristics of Raoultella ornithinolytica S51

[0083] The strain was inoculated into the nitrate culture medium (C / N=3) (50 mL) in a 50 mL centrifuge tube at an inoculation amount of 5%, and 100 μg / L, 500 μg / L and 1000 μg / L of BPA were added to the culture medium, respectively, and the OD was measured after 72 h 600 , and the BPA degradation rate, and the results are shown in Figure 6 It can be seen that the BPA removal rates of different treatment groups are 78.2%, 48.25% and 37.52%, respectively, and there is a significant difference between each group. This may be because when the BPA concentration is relatively low, Raoultella ornithinolytica S51 can utilize BPA as a carbon source, and the BPA degradation rate is relatively high; when the BPA concentration is increased, the high concentration of BPA inhibits the growth of the strain, and thus the BPA degradation rate decreases. Therefore, 100 μg / L of BPA concentration is selected as the initial concentration for the subsequent study of the degradation mechanism of the strain S51 to BPA.

[0084] The strain was inoculated into the nitrate culture medium (C / N=3) (50 mL) in a 50 mL centrifuge tube at an inoculation amount of 5%, and 100 μg / L of BPA was added to the culture medium, and the BPA concentration was measured every 12 h, and the results are shown in Figure 7 The results show that the degradation rate of Raoultella ornithinolytica S51 to 100 μg / L of BPA reaches 78.20% within 72 h, indicating that the strain S51 has good degradation capacity to low-concentration BPA. Under the BPA concentration of 100 μg / L, the degradation rate from 0 to 72 h reaches 2.25 μg / (L·h).

[0085] The strain was inoculated into the nitrate culture medium (C / N=3) (50 mL) in a 50 mL centrifuge tube at an inoculation amount of 5%, and the control group and the treatment group were set, and 100 μg / L of BPA was added to the culture medium of the treatment group, and then the OD 600 value, NH4 + -N concentration, NO3 - -N concentration, NO2 - -N concentration and TN concentration of the control group and the treatment group were measured every 12 h, and the results are shown in Figure 8It can be seen that within 24h of culture, the concentrations of NO3 - - The concentration of NO2 + -N decreased rapidly, and almost no NH4 + -N was accumulated during the reaction process. At 72h, the removal rates of nitrate nitrogen in the treatment group and the control group were 99.26% and 99.17%, respectively. After data analysis, p>0.05, there was no significant difference between the two, indicating that the addition of BPA did not affect the removal of nitrate nitrogen by strain S51. Therefore, strain S51 has good denitrification ability and BPA removal ability, and there is no antagonism between the two.

[0086] Compared with the prior art CN114591853B, the strain in CN114591853B has a preservation number of CCTCC NO: M20211101. When the strain uses nitrate nitrogen as the only nitrogen source under the condition of rich oxygen and high carbon-nitrogen ratio (C / N=60), the removal rate is 98.38%, and the total nitrogen removal rate is 66%. At the same time, the removal rate of 10mg / L BPA is 88.2%. The strain in the present application uses nitrate nitrogen as the only nitrogen source under the condition of low oxygen and low carbon-nitrogen ratio (C / N=3), and the removal rate is 99.17%, and the total nitrogen removal rate is about 87.56%. By adding different concentrations of BPA, it is found that the higher the concentration, the lower the removal rate of BPA by strain S51. The removal rate of 100ug / L BPA concentration is 78.2%, and at the same time, the nitrate nitrogen removal rate is 99.26%. It can be seen that compared with the prior art, the strain involved in the present application has good environmental adaptability and can survive and play a role in the low-oxygen and low-carbon-nitrogen ratio water environment. Its unique advantage is that it can not only efficiently remove nitrogen elements in water, but also exhibit excellent degradation ability to BPA, providing an innovative biological solution to solve water pollution problems.

Claims

1. A strain of Raoultella ornithineilytica ( Raoultella ornithinolytica strain ) S51, characterized in that, The Raoultella ornithinolytica S51 is preserved in China Center for Type Culture Collection, and the preservation number is CCTCC NO:M20241684.

2. The culture method of Raoultella ornithinolytica S51 according to claim 1, characterized by, The culture method comprises inoculating the Raoultella ornithinolytica S51 into a culture medium.

3. The culturing method according to claim 2, wherein, The culture medium is a liquid culture medium, a solid culture medium or a semi-solid culture medium.

4. The culturing method according to claim 2, wherein The inoculation amount of the Raoultella ornithinolytica S51 is 2%-5%.

5. The culturing method according to claim 2, wherein The culture method comprises a culture temperature of 20-45℃, a culture pH of 3-9, a culture time of 0-80h, a C / N ratio of 1-60, and a dissolved oxygen content of 3%-10%.

6. The culturing method according to claim 2, wherein The culture method comprises a culture temperature of 25-35℃, a culture pH of 5-9, a culture time of 0-72h, a C / N ratio of 1-60, and a dissolved oxygen content of 3.8%-7.6%.

7. The Raoultella ornithinolytica S51 of claim 1 or the Raoultella ornithinolytica S51 prepared by the culture method of any one of claims 2-6 is applied to the preparation of a product for nitrogen removal and bisphenol A removal in sewage.

8. Use according to claim 7, characterized in that, The product for nitrogen removal and bisphenol A removal is selected from a sewage treatment agent or a microbial agent.

9. Use according to claim 8, characterized in that, The microbial agent is a powder or a liquid preparation.

10. A sewage treatment agent, characterized by, The Raoultella ornithinolytica S51 of claim 1 or the Raoultella ornithinolytica S51 prepared by the culture method of any one of claims 2-6 is included.

Images