A denitrifying strain capable of removing toluene and nitrogen under anaerobic conditions and its application

Abstract

The present invention provides a denitrifying strain capable of removing both toluene and nitrogen under anaerobic conditions and its application, belonging to the field of microbial technology. The denitrifying strain described in the present invention is Raoultella ornithinolytica strain 14, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 20241685. The Raoultella ornithinolytica strain 14 provided by the present invention can simultaneously achieve the functions of denitrification and toluene removal under anaerobic conditions, is easy to use, simple to operate, reduces the cost of sewage treatment, and has good application prospects in sewage treatment.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a denitrifying bacterial strain capable of removing toluene and nitrogen under anaerobic conditions and application thereof. Background Art

[0002] Nitrogen is one of the most common pollutants in surface water worldwide, and nitrate is the main component of dissolved inorganic nitrogen in water. - -N concentration is too high and will lead to a series of human health and environmental risks. High concentration of NO3 - -N sewage entering rivers, lakes and reservoirs will stimulate the rapid growth of algae, leading to deterioration of water quality, reduction of biodiversity and degradation of ecosystems. The control of nitrate pollution is urgent.

[0003] Aromatic VOCs are a typical pollutant found in chemical-contaminated sites, with refineries, pesticide plants, chemical plants, gas stations, and composting plants being the primary sources. Aromatic VOCs are diverse, including benzene, toluene, naphthalene, and nitrobenzene. Studies have reported that VOC emissions from Chinese refineries increased from 353,000 tons in 1999 to 1.116 million tons in 2018, with an average annual growth rate of 6.2%.

[0004] Biological denitrification is the use of denitrifying bacteria to convert NO2 - -N and NO3 - -N denitrification is the removal of gaseous nitrogen and is considered the most economical and effective method of denitrification. Due to eutrophication of water bodies, conditions vary across different units of sewage treatment plants. The regeneration of inorganic nutrients in the bottom layer consumes oxygen, increasing the primary productivity of the water body. The growth and decay process forms organic matter in the water body. The rapid degradation of this matter consumes dissolved oxygen, leading to the existence of an anaerobic environment. At this time, the presence of facultative anaerobic denitrifying bacteria can adapt to this complex environmental change and ensure the stability of the denitrification effect. At the same time, areas contaminated by hydrocarbons are characterized by lack of oxygen, and hydrocarbons can also serve as a carbon source for bacterial growth. Therefore, seeking functional bacteria that can efficiently remove nitrogen and toluene under anaerobic conditions will bring new technological innovations to the field of sewage treatment. Summary of the Invention

[0005] In order to solve the above problems, the present invention provides a denitrifying bacterial strain capable of removing toluene and nitrogen under anaerobic conditions and its application. This bacterium exhibits efficient denitrification and toluene removal capabilities and has good application prospects in sewage treatment.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a Raoultella ornithinolytica strain 14, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 20241685.

[0008] Specifically, the colony of the Raoultia ornithinelyticus 14 is round, transparent, moist, and has a smooth surface. The bacterial body is rod-shaped, and the strain size is (0.35-0.6 μm)×(1.25-2.7 μm).

[0009] Specifically, the Raoultella ornithinolyticus 14 contains the 16S rDNA sequence shown in SEQ ID NO.1.

[0010] SEQ ID NO.1:

[0011]

[0012] In a second aspect, the present invention provides a culture obtained by culturing or fermenting the above-mentioned Raoultella ornithine-lytica 14 through a culture medium.

[0013] Specifically, the culture medium contains: a carbon source, KNO3, KH2PO4, Na2HPO4·12H2O, MgSO4·7H2O and trace elements.

[0014] More specifically, the carbon source is selected from any one of potassium sodium tartrate, sodium succinate hexahydrate, sodium citrate, sodium acetate and glucose.

[0015] In some embodiments, the optimal carbon source for the efficient denitrification ability of Raoultella ornithinesophora 14 is sodium citrate.

[0016] Specifically, the culture is culture fluid, culture fluid extract, whole bacteria, whole bacteria extract, fermentation fluid and / or fermentation fluid extract.

[0017] In a third aspect, the present invention provides a bacterial agent comprising Raoultella ornithinelyticus 14 and the above-mentioned culture.

[0018] Specifically, the bacterial agent is a powder or liquid preparation.

[0019] In a fourth aspect, the present invention provides a method for preparing Raoultella ornithine-degrading bacteria 14, comprising the following steps:

[0020] (1) Enrichment: River sediment (from Huajin River, Anhui Normal University) was added to 100 mL of sterile DBM, placed in an anaerobic bag, and cultured in a 30°C incubator. 5 mL of the culture medium was transferred to fresh sterile DBM medium and the enrichment was repeated three times.

[0021] (2) Separation: The enriched solution was separated by 10 -1 -10 -7 Dilute in sequence, take 10 mL and spread on BTB solid culture medium, place in anaerobic bag, and culture in a 30℃ incubator until obvious single colonies appear.

[0022] In a fifth aspect, the present invention discloses the use of Raoultella ornithine 14 or the culture thereof or the bacterial agent thereof in sewage treatment.

[0023] Specifically, the sewage is nitrogen-rich sewage containing nitrate.

[0024] In a sixth aspect, the present invention provides a sewage treatment agent comprising Raoultella ornithine-degrading bacteria 14 or a preparation thereof, wherein the preparation is a bacterial liquid of Raoultella ornithine-degrading bacteria 14.

[0025] Specifically, the bacterial solution of Raoultella ornithinelyticus 14 is in the logarithmic growth phase.

[0026] In a seventh aspect, the present invention provides a method for sewage treatment, comprising adding Raoultella ornithine-lytica 14 or a preparation thereof to sewage for culturing.

[0027] Specifically, the culture method is as follows: the culture temperature is 20° C.-40° C., the culture time is 0-72 hours, the C / N ratio is 1-80, and the culture pH is 5-9.

[0028] Preferably, the culture method is: culture temperature is 25°C-35°C, culture time is 12-72h, C / N ratio is 1-60, and culture pH is 5-9.

[0029] The beneficial effects of the present invention are:

[0030] The ornithine-degrading Raoultella 14 provided by the present invention has the function of removing toluene and nitrogen. Under anaerobic conditions, when nitric nitrogen is the only nitrogen source, the removal rate reaches 96.94% within 24 hours. In this process, no NH4 + -N accumulation, NO2 - -N peaked at 7.30 mg / L, but was completely degraded at the next time point. Under anaerobic conditions, when toluene was used as the sole carbon source in the removal test medium, the strain maintained a moderate nitrate-nitrogen removal rate, with a toluene removal rate of 53.39%. This strain could be used as a sewage treatment agent and has promising prospects for wastewater treatment applications.

[0031] Preservation Instructions

[0032] Bacteria species name: Raoultella ornithine-lytica 14;

[0033] Classification and nomenclature: Raoultella ornithinolytica strain14;

[0034] Deposit date: July 25, 2024;

[0035] Deposit number: CCTCC NO:M 20241685;

[0036] Depository: China Center for Type Culture Collection;

[0037] Storage address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 A is an electron microscope image of Raoultella ornithinelyticus 14, and B is a Gram staining image.

[0039] Figure 2 is a phylogenetic tree.

[0040] Figure 3 Shown are the amplification results of nirS, norR, nosZ and narG genes (M: DL 2000 DNA marker).

[0041] Figure 4 A is the growth curve of Raoultella ornithine-lysingensis 14 in nitrate nitrogen medium, NH4 + -N concentration, NO3 - -N concentration, NO2 - -N and TN concentration results; B is the growth curve of Raoultella ornithine-lysing bacteria 14 in ammonia nitrogen medium, NH4 + -N concentration, NO3 - -N concentration, NO2 - -N concentration and TN result diagram; C is the growth curve of Raoultella ornithine-lytica 14 in nitrite medium, NH4 + -N concentration, NO3 - -N concentration, NO2 - -N concentration and TN result graph.

[0042] Figure 5 A shows the effect of different carbon sources on the growth and denitrification of Raoultella ornithine-solubilizing bacteria 14; B shows the effect of different C / N ratios on the growth and denitrification ability of Raoultella ornithine-solubilizing bacteria 14; C shows the effect of different pH on the growth and denitrification ability of Raoultella ornithine-solubilizing bacteria 14; D shows the effect of different culture temperatures on the growth and denitrification ability of Raoultella ornithine-solubilizing bacteria 14.

[0043] Figure 6 A is the growth curve of Raoultella ornithine-degrading 14 in the culture medium with toluene as carbon source, NH4 + -N concentration, NO3 - -N concentration and NO2 - -N concentration and TN concentration results; B is the concentration of toluene at different culture times. DETAILED DESCRIPTION

[0044] The present invention will be further described in detail below with reference to specific examples. The following examples are not intended to limit the present invention but are merely intended to illustrate the present invention. The experimental methods used in the following examples are generally based on conventional conditions unless otherwise specified. The materials and reagents used in the following examples are all commercially available unless otherwise specified.

[0045] The culture medium types and components involved in the experiments of the present invention are:

[0046] 1. Enrichment medium (DBM)

[0047] 5.0 g / L KNO3, 11.1 g / L sodium succinate hexahydrate, 1.0 g / L KH2PO4, 7.03 g / L Na2HPO4·12H2O, 0.13 g / L MgSO4·7H2O, 2 mL / L trace elements, adjusted to pH 7.0;

[0048] Trace elements: 1.8g / L FeCl2·4H2O, 0.25g / L CoCl2·6H2O, 0.01g / L NiCl2·6H2O, 0.01g / L CuCl2·2H2O, 0.70g / L MnCl2·4H2O, 0.1g / L ZnCl2, 0.5g / L H3BO3, 0.03g / LNa2MoO4·2H2O, 0.01g / L NaSeO3·5H2O.

[0049] 2. Bromothymol blue solid medium (BTB)

[0050] 5.0 g / L KNO3, 11.1 g / L sodium succinate hexahydrate, 1.0 g / L KH2PO4, 7.03 g / L Na2HPO4·12H2O, 0.13 g / L MgSO4·7H2O, 2 mL / L trace elements, 1% bromothymol blue, 2% agar powder, adjust to pH 7.0-7.3.

[0051] 3. Nitrate-nitrogen culture medium (C / N=15:1)

[0052] 0.108g / L KNO3, 0.8049g / L sodium citrate, 0.226g / L KH2PO4, 0.792g / LNa2HPO4·12H2O, 0.01g / L MgSO4·7H2O, 2mL / L trace elements, adjust to pH 7.0-7.3.

[0053] 4. Nitrite medium (C / N=15:1)

[0054] 0.0738 g / L NaNO2, 0.8051 g / L sodium citrate, 0.226 g / L KH2PO4, 0.792 g / L Na2HPO4·12H2O, 0.01 g / L MgSO4·7H2O, 2 mL / L trace elements, adjust to pH 7.0-7.3.

[0055] 5. Ammonia nitrogen culture medium (C / N=15:1)

[0056] 0.058 g / L NH4Cl, 0.8160 g / L sodium citrate, 0.226 g / L KH2PO4, 0.792 g / L Na2HPO4·12H2O, 0.01 g / L MgSO4·7H2O, 2 mL / L trace elements, adjust to pH 7.0-7.3.

[0057] 6. Remove the test medium with toluene as the only carbon source (C / N=15:1)

[0058] 0.108g / L KNO3, 0.226g / L KH2PO4, 0.792g / L Na2HPO4·12H2O, 0.01g / LMgSO4·7H2O, 2mL / L trace elements.

[0059] Culture medium sterilization operation: The culture medium and required materials are sterilized in an autoclave at 121°C for 20 minutes.

[0060] OD 600 (indicator biomass), TN, NO3 - -N, NO2 - -N and NH4 + -N content was determined using a spectrophotometer, OD 600 The value is directly measured at a wavelength of 600nm, TN is determined by alkaline potassium persulfate oxidation-UV spectrophotometry, NO3 - -N was determined by aminosulfonic acid-UV spectrophotometry, NO2 - -N uses sulfonamide-naphthylethylenediamine hydrochloride method, NH4 + -N was determined using Nessler's reagent method.

[0061] The determination of toluene was based on the method for determining the concentration of residual benzene series in the solution in the National Environmental Protection Standard "Determination of Volatile Organic Compounds in Water - Headspace / Gas Chromatography-Mass Spectrometry" (HJ810-2016); pure toluene was diluted to a concentration of 100 mg / L using chromatographic grade methanol. -1 and 1000mg·L -1 The stock solution of toluene-D8 was diluted to 1000 mg·L -1 Use a microinjection needle to transfer the toluene stock solution into the headspace bottle containing 10 mL of matrix modification solution to prepare a toluene series concentration of 50, 100, 160, 200, 250, and 300 μg·L -1 The concentration of internal standard toluene-D8 was fixed at 200 μg·L -1 Then, GC-MS was used for instrumental analysis. The results showed that toluene was in the range of 0 to 300 μg·L -1 Good linearity within the concentration range (R 2>0.99) and the method detection limit is less than 1 μg·L -1 . A GC-MS system was used, and the headspace sampling system parameters were: oven temperature 80°C, sampling needle temperature 95°C, transfer line temperature 110°C, carrier gas pressure (He) 19.0 psi, equilibration time 30 min, pressurization time 1 min, injection time 0.04 min, needle removal time 0.5 min, and GC cycle time was set to 33 min. The chromatographic column model was a DB-1 column (60m×0.32mm×1.0μm), and the carrier gas was high-purity helium. The GC temperature program was as follows: start at 60°C and hold for 2 min; then increase to 120°C at 5°C per minute and hold for 3 min; then increase to 230°C at 20°C per minute and hold for 3 min, with a total program of 25 min. MS conditions were: electron impact (EI) ion source; ion source temperature 230°C, ionization energy 70 eV, and interface temperature 280°C. Scan mode: full scan (Scan); Scan range: 35amu~300amu.

[0062] Example 1 Isolation and Identification of Raoultella ornithinelyticus 14

[0063] 1. Isolation of Raoultella ornithine-lytica 14

[0064] Take 5g of sediment (sediment from Huajin River, Anhui Normal University) and add it to 100mL of enrichment medium (DBM), place it in an anaerobic bag, and culture it in a 30℃ incubator for one week. Take 5mL of culture medium and transfer it to fresh DBM medium. Repeat the enrichment for 3 rounds. -1 -10 -7 10 mL of the solution was spread onto BTB solid medium in a gradient dilution system, placed in an anaerobic bag, and cultured in a 30°C incubator until distinct single colonies appeared. Single blue colonies were picked, purified by multiple streaking, and stored in a 4°C refrigerator.

[0065] 2. Identification of Raoultella ornithinelytica 14

[0066] 1. Morphological identification

[0067] The target strain was inoculated into a 50 mL nitrogen-free medium in a 50 mL centrifuge tube. The tube was sealed with a sealing film and placed in a 30°C incubator for 24 hours. When the colony grew to the logarithmic phase, it was subjected to Gram staining and microscopic examination. The results were as follows: Figure 1 As shown, the target strain is a Gram-negative bacterium, with round, transparent, moist, smooth-surfaced colonies and rod-shaped bodies. Electron microscopic observation of the strain size is (0.35-0.6μm)×(1.25-2.7μm).

[0068] 2. Molecular Biological Identification

[0069] The 16S rDNA of the target strain was sequenced, and the sequence was shown in SEQ ID NO. 1, with a length of 1408 bp. The sequencing results were subjected to Blast analysis in NCBI, and sequence homology was searched and compared. It was found that the homology with Raoultella ornithinolytica strain ATCC 31898 (Gene Bank No.: NR_114502.1) was 99%. The phylogenetic tree is shown in Figure 2 As shown, it was therefore named Raoultella ornithinolytica strain 14.

[0070] Example 2 Amplification of Raoultella ornithine-lytica 14 denitrase-related genes

[0071] The denitrification-related genes narG, nirS, norR, and nosZ of Raoultella ornithineilyticus 14 were amplified. The amplification primer sequences and amplification conditions are shown in Table 1 below.

[0072] SEQ ID NO.2(narG-F): TCGCCSATYCCGGCSATGTC;

[0073] SEQ ID NO.3 (narG-R): GAGTTGTACCAGTCRGCSGAYTCSG;

[0074] SEQ ID NO.4 (nirS-F): AAGGTGCGGTGGTTCAGAT;

[0075] SEQ ID NO.5(nirS-R): ATGTGTTGCGGCGTTTCA;

[0076] SEQ ID NO.6(norR-F): GGAAATGACCAAGAACGAGC;

[0077] SEQ ID NO.7 (norR-R): AGGTAGCAGACCAGACCGAT;

[0078] SEQ ID NO.8 (nosZ-F): CGYTGTTCMTCGACAGCCAG;

[0079] SEQ ID NO. 9 (nosZ-R): CATGTGCAGNGCRTGGCAGAA.

[0080] Table 1 Amplification conditions of denitrase-related genes

[0081] Amplified genes Amplification conditions narG 95°C for 5 min, 95°C for 1 min, 55°C for 1 min, 72°C for 1 min, 30 cycles nirS 94°C for 5 min, 94°C for 30 s, 57°C for 30 s, 72°C for 45 s, 35 cycles norR 94°C for 5 min, 94°C for 30 s, 58°C for 30 s, 72°C for 45 s, 35 cycles nosZ 95°C for 5 min, 94°C for 30 s, 50°C for 1 min, 72°C for 1 min, 35 cycles

[0082] The amplification system is: the total reaction system is 25 μL (10 μL ddH2O, 12.5 μL 2×PCR Mix, 1 μL Primer-F, 1 μL Primer-R, 1 μL bacterial liquid template DNA) electrophoresis results of the amplified fragment

[0083] like Figure 3 As shown, it can be seen that the content of denitrification-related genes narG, nirS, norR and nosZ genes in Raoultella ornithinesolyticus 14 is high.

[0084] Example 3 Determination of Nitrogen Removal Capacity of Raoultella ornithinesolyticus 14

[0085] Inoculate the frozen strain Raoultella ornithinesolensis 14 into a 50-mL centrifuge tube containing 50 mL of nitrate nitrogen medium and seal the tube with parafilm. Cultivate the tube in a 30°C incubator until the logarithmic phase. Then, pour 10 mL of the bacterial suspension into a 50-mL centrifuge tube, add 40 mL of nitrate nitrogen medium, cap tightly, and seal with parafilm. Cultivate the tube until the logarithmic phase before use.

[0086] Raoultia ornithine-lysing bacteria 14 were inoculated into 50 mL of nitric nitrogen culture medium (NO3 - -N as nitrogen source), nitrite nitrogen culture medium (50 mL) (with NO2 - -N as nitrogen source) and ammonia nitrogen culture medium (50 mL) (NH4 + -N is nitrogen source), the bottle mouth was wrapped with sealing film, and cultured in a 30℃ incubator. Samples were taken every 6 hours to measure OD 600 Value, NH4 + -N concentration, NO3 - -N concentration, NO2 - -N concentration and TN concentration, the results are shown in Figure 4 .

[0087] Figure 4 A in NO3 - -N was used as the sole nitrogen source, and the growth curve of the strain increased continuously from 0 to 48 hours, and reached a maximum value of 0.0492 at 48 hours; within 24 hours, NO3 - The concentration of -N dropped from the initial 15mg / L to 0.99mg / L, the nitrogen removal rate was 0.58mg / (L·h), and the removal rate reached 96.94%. The concentration of TN dropped from the initial 15mg / L to 2.28mg / L, and the removal rate reached 86.08%. In this process, no NH4 + -N accumulation, NO2 - The maximum -N content was 7.30 mg / L, but it was completely degraded at the next time point. Figure 4 B in NH4+ -N as nitrogen source and C as NO2 - -N is nitrogen source, NH4 + -N and NO2 - -N nitrogen removal rates were 68.04% and 39.57% respectively, the removal rates were 0.21mg / (L·h) and 0.125mg / (L·h) respectively, and the TN degradation rates were 35.90% and 37.09% respectively. + When -N was the only nitrogen source, there was almost no accumulation of nitrite during the incubation process. These results showed that Raoultella ornithine-degrading bacteria 14 had a high efficiency in removing inorganic nitrogen under anaerobic conditions and had the potential for enhanced application in high-nitrogen-rich wastewater.

[0088] Example 4 Determination of the Optimal Growth Conditions of Raoultella ornithinesolyticus 14

[0089] Prepare culture media containing different carbon sources to test the nitrogen removal capacity of Raoultella ornithine-degrading bacteria 14. The carbon sources are potassium sodium tartrate, sodium succinate hexahydrate, sodium citrate, sodium acetate, and glucose, all at a concentration of 225 mg / L. Raoultella ornithine-degrading bacteria 14 was inoculated into 50 mL of different carbon source culture media (50 mL) in 50 mL centrifuge tubes at a 2% inoculum rate. The bottle caps were wrapped with sealing film and incubated in a 30°C incubator. After 48 hours of incubation, samples were taken and the OD was measured. 600 Value and nitrogen removal rate, the results are as follows Figure 5 As shown in A, Ornithine-Solving Raoultella 14 can grow under these five carbon sources. When glucose is the only carbon source, the OD of Ornithine-Solving Raoultella 14 is 600 It reached a maximum value of 0.2304, but at this time the nitrogen removal rate was 96.68%, while when sodium citrate was used as the carbon source, the nitrogen removal rate reached a maximum of 97.06%.

[0090] C / N ratios of 1, 3, 5, 10, 15, 30, and 60 were prepared to test the nitrogen removal ability of Raoultella ornithine-degrading 14. Raoultella ornithine-degrading 14 was inoculated into 50 mL of culture medium with different C / N ratios in 50 mL centrifuge tubes at a 2% inoculum size. The tubes were wrapped with sealing film and incubated in a 30°C incubator. After 48 hours of incubation, samples were taken to measure the OD value. 600 Value and nitrogen removal rate, the results are as follows Figure 5 As shown in B, with the increase of C / N ratio, the OD 600 It shows a trend of increasing first and then decreasing. When the C / N ratio reaches 5, OD 600The maximum value reached 0.056, and then a downward trend appeared. As the C / N ratio increased, the denitrification efficiency of the strain first increased and then decreased, reaching a maximum of 99% at a C / N ratio of 3. The nitrate-nitrogen removal efficiency of the strain was higher than 80% within a C / N ratio range of 1-60, indicating that the strain can tolerate anaerobic low C / N conditions and can effectively remove nitrogen under these conditions.

[0091] Prepared culture media with pH values ​​of 5, 7, and 9 to test the nitrogen removal capacity of Raoultella ornithine-degrading 14. Raoultella ornithine-degrading 14 was inoculated into 50 mL of culture media with different pH values ​​in 50 mL centrifuge tubes at a 2% inoculum rate. The tubes were sealed with film and incubated in a 30°C incubator. After 48 hours of incubation, samples were taken to measure the OD value. 600 Value and nitrogen removal rate, the results are as follows Figure 5 As shown in C, the strain basically does not grow at a pH of 5, but can grow at pH 7-9. It grows best at pH 7, and the nitrogen removal rate reaches as high as 95%, indicating that the strain can only tolerate neutral and weak alkaline environments, and cannot tolerate acidic environments.

[0092] Raoultia ornithine-solubilizing 14 was inoculated into 50 mL of nitric acid culture medium in 50 mL centrifuge tubes at a 2% inoculum volume. The bottle mouths were sealed with film and cultured in incubators at 25°C, 30°C, and 35°C for 48 h. The OD values ​​were measured. 600 and nitrogen removal rate, the results are as follows Figure 5 As shown in D, under the culture conditions of 25-35℃, Raoultella ornithine-lytica 14 can grow. As the temperature increases, OD 600 It showed a linear decline. At 25℃, Raoultella ornithine-solubilizing bacteria 14 grew best. OD 600 The nitrate removal rate was 0.075, but at this temperature, the lowest nitrate removal rate was 95.36%. At 30°C, the strain had the highest nitrate removal rate, 96.63%. Raoultella ornithine-degrading 14 maintained a high removal rate at temperatures between 25°C and 35°C, exceeding 80% and reaching a maximum of 96%, demonstrating that Raoultella ornithine-degrading 14 can tolerate a wide temperature range.

[0093] Example 5 Determination of the ability of Raoultella ornithine-degrading bacteria 14 to remove toluene

[0094] The strain was inoculated at a 5% inoculum into a 100 mL anaerobic bottle containing 50 mL of the test medium with toluene as the sole carbon source. Argon gas was passed through the bottle for 4 minutes to create an anaerobic environment. After the aeration was completed, the bottle was tightly capped and sealed with a sealing film. 10 μL of toluene solution was injected into the bottle with a microsyringe to a concentration of 170 mg / L. The bottle was cultured at 30°C and 160 r / min for 72 h, and samples were taken every 12 h to measure the OD. 600 Value, NH4 +-N concentration, NO3 - -N concentration, NO2 - -N concentration, TN concentration and toluene concentration, the results are shown in Figure 6 .

[0095] Figure 6 A in the middle shows that the growth curve of the strain gradually decreased after 24 hours and reached a minimum of 0.025 at 72 hours. At the same time, within 72 hours, NO3 - The concentration of -N decreased gradually with time, from the initial 17 mg / L to 6.39 mg / L, with a removal rate of 0.15 mg / (L·h) and a removal rate of 63.31%. - The -N content increased with time, and the accumulation reached the highest level at 72h, which was 10.98mg / L; the TN content decreased from the initial 17.8mg / L to 15.6mg / L, with a removal rate of 13.9%. No NH4 + -N accumulation. Figure 6 Figure B shows that the toluene content also gradually decreased with time, from the initial 170 mg / L to 78.46 mg / L, with a removal rate of 1.27 mg / (L·h) and a removal rate of 53.39%.

[0096] In summary, Raoultella ornithine-degrading bacteria 14 can maintain a high nitrogen removal rate under anaerobic low C / N (C / N = 1) conditions and reduce NO3 - -N removal rate is the highest, and there is no NH4 + -N and NO2 - -N accumulation, which provides new biological materials for treating sewage with low C / N ratio and insufficient carbon source under anaerobic conditions.

[0097] Ornithine-degrading Raoultella 14 can grow and reproduce in anaerobic environment. In anaerobic environment, it can still maintain a certain nitrate-nitrogen removal rate with toluene as the only carbon source, and the toluene removal rate reaches 53.39%. This provides a new solution for the synergistic denitrification removal of toluene under anaerobic conditions in water. Ornithine-degrading Raoultella 14 produces a large amount of NO2 in the synergistic removal process. - -N accumulation, which can provide sufficient raw materials for the next step of coupled anaerobic ammonium oxidation.

[0098] The data comparing the strain of the present invention with other strains in the prior art are as follows:

[0099] Table 2 Sources of strains and technical effects

[0100]

[0101] The above data demonstrate that the strain of the present invention, when cultured under anaerobic conditions with nitrate as the sole nitrogen source, achieved a nitrate-nitrogen removal rate of 96.94% after 48 hours of cultivation, exceeding the existing technology. The strain described in Chinese patent CN114591853B was tested for its denitrification effectiveness using the technical solution of the present invention, demonstrating superior results to those described in the published patent.

Claims

1. A strain of Raoultella ornithineilytica ( Raoultella ornithinolytica ) 14, characterized in that, The Raoultella ornithinelyticus 14 is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 20241685.

2. A culture, characterized in that The culture is obtained by culturing or fermenting the Raoultella ornithine-lytica 14 according to claim 1 through a culture medium.

3. The culture according to claim 2, characterized in that The culture medium comprises: a carbon source, KNO3, KH2PO4, Na2HPO4·12H2O, MgSO4·7H2O and trace elements.

4. The culture according to claim 3, characterized in that The carbon source is selected from any one of potassium sodium tartrate, sodium succinate hexahydrate, sodium citrate, sodium acetate and glucose.

5. A bacterial agent, characterized in that Comprising the Raoultia ornithinelytica 14 according to claim 1 and / or the culture according to any one of claims 2 to 4.

6. Use of the Raoultella ornithine-lytica 14 according to claim 1, the culture according to any one of claims 2 to 4, or the bacterial agent according to claim 5 in sewage treatment, wherein the sewage is nitrogen-rich sewage containing nitrate.

7. A method for sewage treatment, characterized in that: The method comprises adding the ornithine-degrading Raoultella 14 or its preparation according to claim 1 into sewage for culturing, wherein the preparation is a bacterial liquid of ornithine-degrading Raoultella 14, and the sewage is nitrogen-rich sewage containing nitrate.

8. The method according to claim 7, characterized in that The culture method comprises the following steps: a culture temperature of 20° C.-40° C., a culture time of 0-72 hours, a C / N ratio of 1-80, and a culture pH of 5-9.

Images