Vibrio harveyi fliQ gene knockout mutant strain as well as preparation method and application thereof

Abstract

The invention discloses a vibrio harveyi fliQ gene knockout mutant strain as well as a preparation method and application thereof, and the vibrio harveyi fliQ gene knockout mutant strain is characterized in that the preservation number of the strain is CGMCC (China General Microbiological Culture Collection Center) No.32132. The preparation method of the vibrio harveyi fliQ gene knockout mutant strain comprises the following steps: amplifying upstream and downstream fusion fragments of fliQ by adopting an overlapping PCR (Polymerase Chain Reaction) technology, inoculating a T1 vector, and converting into a CC118 competent state to obtain a fliQ-UD The preparation method comprises the following steps: carrying out enzyme digestion on fliQ-UD-T recombinant plasmids and a pRE112 vector, carrying out connection transformation, culturing, screening positive bacteria as donor bacteria, carrying out a conjugation transfer experiment by using vibrio harveyi with the preservation number of CGMCC No.32133 as recipient bacteria, and carrying out sucrose-induced double exchange to obtain the vibrio harveyi fliQ gene knockout mutant strain, so as to obtain the vibrio harveyi fliQ gene knockout mutant strain. The compound has the application in preparation of attenuated live vaccine preparations, vibrio harveyi inhibitors and pseudosciaena crocea immune protective agents, and has the advantage of having an immune protection effect on pseudosciaena crocea.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a large yellow croaker-derived Vibrio harveyi fliQ gene knockout mutant strain and application thereof. Background Art

[0002] In recent years, as the yellow croaker farming industry has gradually developed towards intensive and industrialized development, large-scale high-density farming and water pollution have caused aquaculture diseases to become increasingly serious, which has seriously threatened the sustainable development of the yellow croaker farming industry. The body rot disease caused by Vibrio harveyi has repeated attacks, high morbidity and serious harm.

[0003] Vibrio harveyi is a pathogenic vibrio that is commonly found in marine and estuarine ecosystems. It is the most common pathogen affecting tropical and subtropical marine aquaculture animals. Diseased fish bleed from the anus, the base of the tail fin and the base of the pectoral fin, and the fish body becomes ulcerated. After dissection, it can be found that there is ascites in the abdominal cavity of the fish, accompanied by yellow liquid in the intestine, the liver is bleeding and eroded, and there are a large number of white nodules in the spleen, which leads to the death of a large number of young fish and causes serious economic losses. Therefore, it is of great significance to formulate effective measures to prevent farmed fish and fishery workers from being infected with Vibrio harveyi.

[0004] The pathogenic process of Vibrio harveyi includes adhesion, invasion and proliferation in vivo, and it exerts its effects by producing pathogenic factors that interfere with the normal metabolism of host cells. Adherence to the host is an important step and initial stage of its infection, in which flagella play a major role as the main organelle of movement. fliQ is a flagellar biosynthesis protein, which is believed to be located in the central pore of the MS ring of the bacterial flagellar type III protein exporter together with flhA, flhB, fliO, fliP and fliR. It is one of the main virulence factors of Vibrio harveyi, but there are few studies on the virulence regulation of Vibrio harveyi on large yellow croaker. Therefore, the construction of a flagellar protein fliQ-deficient mutant not only helps to reveal the functional mechanism of flagellar protein, but also provides the possibility for the development of attenuated live vaccines of Vibrio harveyi, and provides new important data for the prevention and control of Vibrio harveyi diseases in large yellow croaker. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a Vibrio harveyi fliQ gene knockout mutant strain having an immune protection effect on large yellow croaker, and a preparation method and application thereof.

[0006] The technical solution adopted by the present invention to solve the above technical problems is: a fliQ gene knockout mutant of Vibrio harveyi, which is V.harveyi LcV6△fliQ strain, classified and named Vibrio harveyi, and has a preservation number of CGMCC No.32132.

[0007] The present invention also provides a method for preparing the above-mentioned V.harveyi LcV6ΔfliQ strain, comprising the following steps:

[0008] Step 1, activating the strain: streak culture the Vibrio harveyi LcV6 with the deposit number of CGMCC No. 32133, then pick a single clone and inoculate it into LB liquid culture medium for activation at 28°C to obtain a Vibrio harveyi bacterial liquid;

[0009] Step 2, amplification of upstream and downstream fragments of the fliQ gene: first, the location of the fliQ gene of Vibrio harveyi in the genome was obtained, and the approximately 500 bp parts at both ends were cloned as homology arms, and primers fliQ-up-F / fliQ-up-R for amplifying the upstream fragment of fliQ and fliQ-down-F / fliQ-down-R for amplifying the downstream fragment of fliQ were designed, and PCR amplification was performed to obtain the upstream fragment of fliQ and the downstream fragment of fliQ, respectively;

[0010] Step 3, homology arm construction: Use overlapping PCR technology to amplify the fliQ upstream and downstream fusion fragments, then insert the fliQ upstream and downstream fusion fragments into the T1 vector and transform into CC118 competent cells, screen positive clones to obtain fliQ-UD-T recombinant plasmid;

[0011] Step 4, construction of a recombinant knockout vector: the fliQ-UD-T recombinant plasmid and the pRE112 vector obtained in step 3 were digested and then connected for transformation, and positive clones were screened after cultivation to obtain X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112;

[0012] Step 5, recombinant plasmid conjugation transfer experiment: using the X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112 obtained in step 4 as the donor bacteria, and using Vibrio harveyi LcV6 with a deposit number of CGMCC No.32133 as the recipient bacteria, a conjugation transfer experiment was carried out to obtain a positively identified strain;

[0013] Step 6, sucrose-induced double exchange: The positively identified strains were inoculated into LB solid medium containing 10 wt% sucrose, and single clones were selected and inoculated into 96-well plates for bacterial liquid PCR verification. Positive clones were screened to obtain V. harveyi LcV6ΔfliQ strains.

[0014] Furthermore, the nucleotide sequence of the fliQ-up-F in step 2 is shown in SEQ ID NO.1: 5'-AAATCTAGAAATGCCTTGAAGAGATAGAGCGGTAATAC-3'; the nucleotide sequence of the fliQ-up-R is shown in SEQ ID NO.2: 5'-TGGTACCTTGTCTGCCAGCTTGTCCATGATTCTTGGT C-3'; the nucleotide sequence of the fliQ-down-F is shown in SEQ ID NO.3: 5'-GACCAAGAATCAT GGACAAGCTGGCAGACAAGGTACCA-3'; the nucleotide sequence of the fliQ-down-R is shown in SEQ ID NO.4: 5'-AAAGAGCTCGCCCACCAAACCGAGTGTTG-3'.

[0015] Furthermore, the overlapping PCR amplification system described in step 3 is 2×Taq PCR Master Mix 12.5 μL, 10 μM fliQ-up-F containing XbaI restriction site 1 μL, 10 μM fliQ-down-R containing SacI restriction site 1 μL, fliQ upstream fragment template DNA 1 μL, fliQ downstream fragment template DNA 1 μL, and sterile water 8.5 μL.

[0016] Furthermore, step 4 is specifically as follows: construct a recombinant knockout vector: the fliQ-UD-T recombinant plasmid and the pRE112 vector obtained in step 3 are digested and then connected for transformation, the transformed competent cells are revived and cultured overnight, and after single colonies are grown, multiple single clones are picked and placed in LB liquid culture medium containing chloramphenicol, and cultured in a shaker at 37°C at 150 rpm for 12 h. After picking a single clone of bacteria for cultivation, extract the bacterial DNA as a PCR template for verification. According to the pRE112 vector, the verification primers pRE112-F / pRE112-R were designed, wherein the nucleotide sequence of pRE112-F is shown in SEQ ID NO.8: 5'-ACATAGCCCCACTGTTCGT-3', and the nucleotide sequence of pRE112-R is shown in SEQ ID NO.9: 5'-TTTTCGTCTCAGCCAATCC-3'. The PCR amplification system was 25 μL: 2×Taq PCR Master Mix 12.5 μL, 10 μM pRE112-F 1 μL, 10 μM pRE112-R 1μL, DNA template 1μL, sterile water 9.5μL; PCR amplification program: 94℃5min; 94℃30sec, 58℃30sec, 72℃1min, cycle 35 times; stored at 4℃, and X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112 were obtained.

[0017] Furthermore, step 5 is specifically as follows: the Vibrio harveyi bacterial solution and the X7213 positive bacterial solution containing the recombinant vector ΔfliQ-pRE112 are mixed in a volume ratio of 1:1 and then dropped into the center of a 2216E plate containing DAP for culture to obtain a mixed bacteria, the mixed bacteria are washed and spread on a 2216E plate containing chloramphenicol, and after culture, a single clone is picked and cultured in a 2216E liquid culture medium containing chloramphenicol, and the single clone bacterial solution is used as a DNA template for bacterial solution PCR verification, and the positive strains are screened and identified.

[0018] Furthermore, step 6 is specifically as follows: adding the positively identified strain to a test tube containing non-resistant 2216E culture medium, diluting the bacterial solution and spreading it on a 10% sucrose plate for culture, picking several single clones after single colonies grow, inoculating them into well plates and culturing them at room temperature, extracting the bacterial solution as a knockout strain DNA template for bacterial solution PCR verification, and screening positive clones to obtain V.harveyi LcV6△fliQ strains.

[0019] The present invention also provides the use of the V.harveyi LcV6ΔfliQ strain in preparing a live attenuated vaccine preparation.

[0020] The present invention also provides application of the V.harveyi LcV6ΔfliQ strain in preparing Vibrio harveyi inhibitors.

[0021] The present invention also provides application of the V.harveyi LcV6ΔfliQ strain in preparing an immune protective agent for large yellow croaker.

[0022] Compared with the prior art, the advantages of the present invention are as follows: the present invention discloses for the first time a fliQ gene knockout mutant of Vibrio harveyi and a preparation method and application thereof, constructs a fliQ gene knockout strain by homologous recombination, explores the effect of the fliQ gene on virulence, and provides a new option for attenuated vaccines of Vibrio harveyi.

[0023] The above-mentioned Vibrio harveyi is a strain LcV6, classified and named Vibrio harveyi. The strain is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, with a deposit number of CGMCC No. 32133. The deposit date is September 30, 2024, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China.

[0024] The above-mentioned Vibrio harveyi fliQ gene knockout mutant strain is the V.harveyi LcV6△fliQ strain, classified and named Vibrio harveyi (Vibrio harveyi), and the strain is deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration, with the deposit number CGMCC No.32132, the deposit date is September 30, 2024, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The figure is the agarose gel electrophoresis of the amplified fliQ upstream and downstream fragments, M is 2kPlus DNA Marker, lane 1 is the amplified fliQ upstream fragment, and lane 2 is the amplified fliQ downstream fragment;

[0026] Figure 2 It is the agarose gel electrophoresis of overlapping PCR amplification of fliQ upstream and downstream fusion fragments, M is 2kPlus DNAMarker, and lanes 1 and 2 are the amplified fliQ upstream and downstream fusion fragments;

[0027] Figure 3 This is the agarose gel electrophoresis diagram of the constructed X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112, M is 2k Plus DNA Marker, and lane 1 is the verified fliQ upstream and downstream fusion fragments connected to pRE112.

[0028] Figure 4is the agarose gel electrophoresis of the PCR amplification product after the first homologous recombination integration, M is 2kPlusDNAMarker, the fusion fragment on the recombinant vector is first exchanged with the upstream homologous arm on the V.harveyi LcV6 genome, and then exchanged with the downstream homologous arm to obtain the result, lanes 2 and 3 are the results of the fusion fragment on the recombinant vector first exchanged with the downstream homologous arm on the V.harveyi LcV6 genome, and then exchanged with the upstream homologous arm;

[0029] Figure 5 It is the agarose gel electrophoresis diagram of V.harveyi LcV6 and Vibrio harveyi fliQ gene knockout mutant, M is 2k Plus DNAMarker, lane 1 is V.harveyi LcV6, and lanes 2-4 are the screened Vibrio harveyi fliQ gene knockout mutants;

[0030] Figure 6 It is the agarose gel electrophoresis diagram of V.harveyi LcV6 and Vibrio harveyi fliQ gene knockout mutants, M is 2k Plus DNA Marker, lane 1 is V.harveyi LcV6, and lanes 2-8 are the screened Vibrio harveyi fliQ gene knockout mutants;

[0031] Figure 7 To detect the motility of the knockout strain and the wild strain in LB semi-solid medium, A shows the motility of the ΔfliQ strain and the V.harveyi LcV6 strain in LB semi-solid medium, and B shows the movement radius statistics of the two strains.

[0032] Figure 8 These are the half-lethal concentration curves of wild V.harveyi LcV6 and fliQ gene knockout mutant of Vibrio harveyi, where A is wild V.harveyi LcV6 and B is fliQ gene knockout mutant of Vibrio harveyi.

[0033] Fig. 9 These are the results of the protective efficiency test of the fliQ gene knockout mutant of Vibrio harveyi on large yellow croaker. DETAILED DESCRIPTION

[0034] The present invention is further described in detail below with reference to the accompanying drawings.

[0035] Specific Example 1: Preparation of fliQ gene knockout mutant of Vibrio harveyi.

[0036] Step 1, activating the strain: taking out the bacterial solution of Vibrio harveyi LcV6 (Vibrio harveyi) with the preservation number of CGMCC No. 32133 from the -80°C refrigerator, immediately using a sterilized pipette tip to dip a little ice liquid for streak culture; then picking a single clone and inoculating it into LB liquid culture medium (purchased from Dalian Meilun Biotechnology Co., Ltd., catalog number: MMT059) for activation at 28°C to obtain Vibrio harveyi bacterial solution.

[0037] Step 2, amplification of upstream and downstream fragments of the fliQ gene: First, the location of the Vibrio harveyi gene fliQ in the genome was obtained, and the approximately 500 bp portions at both ends were cloned as homology arms. Primers fliQ-up-F / fliQ-up-R for amplification of the upstream fragment of fliQ and fliQ-down-F / fliQ-down-R for amplification of the downstream fragment of fliQ were designed.

[0038] The nucleotide sequence of fliQ-up-F is shown in SEQ ID NO. 1: 5′-AAATCTAGAAATGCCTTGAAGAGATAGAGCGGTAATAC-3′;

[0039] The nucleotide sequence of fliQ-up-R is shown in SEQ ID NO. 2: 5′-TGGTACCTTGTCTGCCAGCTTGTCCATGATTCTTGGTC-3′;

[0040] The nucleotide sequence of fliQ-down-F is shown in SEQ ID NO. 3: 5′-GACCAAGAATCATGGACAAGCTGGCAGACAAGGTACCA-3′;

[0041] The nucleotide sequence of fliQ-down-R is shown in SEQ ID NO.4: 5'-AAAGAGCTCGCCCACCAAACCGAGTGTTG-3'.

[0042] Using Vibrio harveyi bacterial liquid as the sample, the bacterial genomic DNA extraction kit (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.) was used to extract DNA. The extracted Vibrio harveyi DNA was used as a template to perform PCR amplification on the upstream fragment of the fliQ gene. The PCR amplification system was 25 μL: 2×Taq PCR Master Mix 12.5 μL, 10 μM fliQ-up-F 1 μL, 10 μM fliQ-up-R 1 μL, DNA template 1 μL, and sterile water 9.5 μL. The PCR amplification program was: 94°C for 5 min; 94°C for 30 sec, 58°C for 30 sec, and 72°C for 1 min, 35 cycles; stored at 4°C. After amplification, the PCR product was separated and verified by agarose gel electrophoresis, and then the amplified product was excised, recovered, and sequenced. The results are as follows Figure 1 Lane 1 is the upstream fragment of fliQ (abbreviated as fliQ-up), and the nucleotide sequence of fliQ-up is shown in SEQ ID NO.5: 5'-AATGCCTTGAAGAGATAGAGCGGT AATAACCTGAGCCGACCGGCCAAACGACAAAGCTCTGAATAACAATGTCGATAACCAACAAATGTCCTTCAAGTGCAAGGAACAGCAAAGTAGAAAAAATCAGAAAAATACGTCCAAGAATGGCGACCGAAAGTCCGTTCACTGGGTCATTCATCATCGCCATACCTAAACCCATCTGCAGAGAGATGACTTGACCAAGCATGGTAAAGACATTGAATAGCATATGCAGAATCAAC CCAAACATCACGCCAGATTGCTTGCTCGAAAGCAAGAAACAGAGACGTCATAGAGAAGAGTTCGACTTCTGGCATGGGTGGCATCAGTGGAGCGGTGATCACCACAATAGAAAGGGCGAGCAAGCTGCGCACCCAAACAGGAATAAGCGCATCTCCGAAAAAAGGCATGGAGATAAACACCGCGCCCACACGGAAAAATGGCCACCAAAGTTGACCAAGAATCATGGAC-3'.

[0043] Furthermore, the fliQ downstream fragment was PCR amplified, and the PCR amplification system was 25μL: 2×Taq PCR MasterMix 12.5μL, 10μM fliQ-down-F 1μL, 10μM fliQ-down-R 1μL, DNA template 1μL, sterile water 9.5μL; PCR amplification program was: 94℃5min; 94℃30sec, 58℃30sec, 72℃1min, 35 cycles; stored at 4℃. After amplification, the PCR products were separated and verified by agarose gel electrophoresis, and then the amplified products were excised, recovered and sequenced. The results are as follows Figure 1 Lane 2 is the fli Q downstream fragment (abbreviated as fliQ-down), and the nucleotide sequence of fliQ-down is shown in SEQ ID NO.6: 5'-AAGCTGGCAGACAAGGTACCAACCGTCATCGCCCAACCATCAACAAGAACAAA AATGACCAGTTTTAAAGGGTAGGGAGATGATCAGAGGTGACAACATCATCATACCCATTGCCATTAAGACACTAGCGACCACCAGATCGATGATCAAAAATGGAATAAACAACATGAAGCCAATTTGGAAAGCCGTTTTGAGTTCACTGATCACAAATGCTGGCAGTACAACAGCGAAAGAAATGTCTTCAACATTTTGATCTATTGGCTCATTCGC AATACGTAACATCTGCTCTAATGAGCTTTGGTGCGTCTGCGCTAACATAAAGCTTCTGACTGGCTTTTCAGCTACAGAAAACGCCTGAACCAAAGTAATTTCACCGTTGTCATAGGGCTTAAACGCATTGTCGTAAATGTCAGTCCAAACGGGACGCATAATTAGAATCGTCAGCGTCAAAGCAATACCCACCAACACTCGGTTTGGTGGGC-3'.

[0044] Step 3, construction of homology arms: overlap PCR technique was used to obtain the fusion fragment, the upstream primer was fliQ-up-F containing Xba I restriction site, and the downstream primer was fliQ-down-R containing Sac I restriction site. The overlap PCR amplification system was 25 μL: 2×Taq PCR Master Mix 12.5 μL, 10 μM fliQ-up-F containing Xba I restriction site 1 μL, 10 μM fliQ-down-R containing Sac I restriction site 1 μL, fliQ upstream fragment template DNA 1 μL, fliQ downstream fragment template DNA 1 μL, and sterile water 8.5 μL. The PCR amplification program was: 94°C for 5 min; 94°C for 30 sec, 65°C for 30 sec, 72°C for 1 min, 10 cycles. After each thermal cycle, the annealing temperature was lowered by 1°C and the cycle was started again; 94°C for 30 sec, 56°C for 30 sec, 72°C for 1 min, 25 cycles; stored at 4°C. After the amplification was completed, the PCR products were separated and verified by agarose gel electrophoresis. The results are shown in Figure 2As shown, lanes 1 and 2 are the amplified fliQ upstream and downstream fusion fragments (abbreviated as fliQ-UD fragments). Subsequently, gel excision recovery and sequencing were performed. The nucleotide sequence of fliQ-UD is shown in SEQ ID NO.7: 5'-AAATCTAGAAATGCCTTGAAGAGATAGAGCGGTAATACCTGAGCCGACCGGCCAAACGACAAAGCTCTGAATAACAATGTCGATAACCAACAAATGTCCTTCAAGTGCAAGGAACAGCAAAGTAGAAAAAATCAGAAAAATACGTCCAAGAATGGCGACCGAAAGTCCGTTCACTGGGTCATTCATCATCGCCATACCTAAACCCATCTGCAGAGAGATGACTTGACCAAGCATGGTAAAGACATTGAATAGCATATGCAGAATCAACCCAAACATCACGCCCCAGATTGCTTGCTCGAAAGCAAGAAACAGAGACGTCATAGAGAAGAGTTCGACTTCTGGCATGGGTGGCATCAGTGGAGCGGTGATCACCACAATAGAAAGGGCGAGCAAGCTGCGCACCCAAACAGGAATAAGCGCATCTCCGAAAAAAGGCATGGAGATAAACACCGCGCCCACACGGAAAAATGGCCACCAAAGTTGACCAAGAATCATGGACAAGCTGGCAGACAAGGTACCAACCGTCATCGCCCAACCATCAACAAGAACAAAAATGACCAGTTTAAAGGGTAGGGAGATGATCAGAGGTGACAACATCATCATACCCATTGCCATTAAGACACTAGCGACCACCAGATCGATGATCAAAAATGGAATAAACAACATGAAGCCAATTTGGAAAGCCGTTTTGAGTTCACTGATCACAAATGCTGGCAGTACAACAGCGAAAGAAATGTCTTCAACATTTTGATCTATTGGCTCATTCGCAATACGTAACATCTGCTCTAATGAGCTTTGGTGCGTCTGCGCTAACATAAAGCTTCTGACTGGCTTTTCAGCTACAGAAAACGCCTGAACCAAAGTAATTTCACCGTTGTCATAGGGCTTAAACGCATTGTCGTAAATGTCAGTCCAAACGGGACGCATAATTAGAATCGTCAGCGTCAAAGCAATACCCACCAACACTCGGTTTGGTGGGCGAGCTCTTT-3'。

[0045] The fliQ-UD fragment was then inserted into the pEASY-T1 Simple cloning vector (Beijing Quanshijin T1 Simple Gene Cloning Kit) and transformed into CC118 competent cells. PCR amplification was further performed using universal primers M13-F / M13-R. The PCR amplification conditions were as follows: 94°C for 5 min; 94°C for 30 sec, 58°C for 30 sec, 72°C for 1 min, 35 cycles; stored at 4°C. The PCR products were separated by agarose gel electrophoresis, and positive clones were screened to obtain the fliQ-UD-T recombinant plasmid.

[0046] Step 4: Construction of recombinant knockout vector: The fliQ-UD-T recombinant plasmid obtained in step 3 and the pRE112 vector were cloned by restriction endonuclease Xba I and SacI were double digested, and the digestion was carried out at 37°C for 1h. The digestion products were recovered, and the digestion products were connected by T4 ligase at 16°C overnight. The ligation products were mixed with X7213 competent cells and placed on ice for 30min, heat-shocked in a water bath at 42°C for 40-90s, placed on ice again, and ice-bathed for 2min. 50μL of the transformed competent cells were added to 900μL of LB liquid culture medium, placed in a constant temperature oscillator, and revived at 150rpm at 37°C for 60min. The competent cells were centrifuged at 5000rpm in a centrifuge for 2min, most of the supernatant was poured out, and the remaining small amount of liquid was resuspended by blowing with a pipette, and then all were coated on LB solid culture medium containing chloramphenicol (LB agar was purchased from Qingdao Haibo Biotechnology Co., Ltd., product number: HB0129-2), placed in a 37°C constant temperature incubator, and cultured overnight. After a single colony was grown, multiple single clones were picked and placed in LB liquid culture medium containing 34 μg / mL chloramphenicol, respectively, and cultured at 150 rpm in a shaker at 37°C for 12 h. The single clone bacterial solution was used as a DNA template for bacterial solution PCR verification, and verification primers pRE112-F / pRE112-R were designed according to the pRE112 vector, wherein the nucleotide sequence of pRE112-F is shown in SEQ ID NO.8: 5'-ACATAGCCCCACTGTTCGT-3', and the nucleotide sequence of pRE112-R is shown in SEQ ID NO.9: 5'-TTTTCGTCTCAGCCAATCC-3'. PCR amplification system 25μL: 2×TaqPCR Master Mix 12.5μL, 10μM pRE112-F 1μL, 10μM pRE112-R 1μL, DNA template 1μL, sterile water 9.5μL; PCR amplification program: 94℃5min; 94℃30sec, 58℃30sec, 72℃1min, 35 cycles; 4℃ storage. PCR products were separated and verified by agarose gel electrophoresis. The results are as follows Figure 3As shown, lane 1 is the verified fliQ upstream and downstream fusion fragment connected to pRE112.

[0047] 3 mL of successfully identified bacterial liquid was collected, and the plasmid was extracted according to the instructions of the plasmid small-scale extraction kit (Guangdong Meiji Biotechnology Co., Ltd.) and sent to the company for sequencing to obtain X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112.

[0048] Step 5: Recombination plasmid transfer experiment (first homologous recombination).

[0049] The X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112 obtained in step 4 were used as donor bacteria, and the Vibrio harveyi LcV6 with a deposit number of CGMCC No. 32133 was used as a recipient bacteria to carry out a conjugation transfer experiment.

[0050] A small amount of 5 mL of 2216E culture medium (purchased from Qingdao Haibo Biotechnology Co., Ltd.) was taken from V.harveyi LcV6 stored in an ultra-low temperature refrigerator, and activated by shaking in a small shaker at 28°C, and then transferred to 2216E culture medium at a ratio of 1% by volume, and cultured at 28°C for 4-6 hours to the mid-to-late logarithmic period to obtain a Vibrio harveyi bacterial liquid.

[0051] At the same time, a small amount of X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112 was picked up and placed in LB liquid culture medium containing 34 μg / mL chloramphenicol and 50 μg / ml 2, 6-diaminopimelate (abbreviated as DAP), placed in a 37°C constant temperature oscillator for culture for 12 hours, and then transferred to LB solid culture medium containing 34 μg / mL chloramphenicol and 50 μg / ml 2, 6-diaminopimelate at a volume percentage of 1%, and continued to be cultured at 37°C for 4-6 hours to the mid-to-late logarithmic period to obtain the recombinant vector bacterial solution.

[0052] Take 1.5 mL of Vibrio harveyi bacterial solution and recombinant vector bacterial solution respectively, centrifuge and wash twice with sterile ddH2O to remove antibiotics, then resuspend the bacteria with 500 μL of sterile ddH2O, take 100 μL of each and mix them at a volume ratio of 1:1, take 100 μL of the mixed bacterial solution and drop it in the center of a 2216E plate (2216E agar purchased from Qingdao Haibo Biotechnology Co., Ltd.) containing 50 μg / ml DAP, dry it, place it in a 28°C incubator, and culture it for 12 hours to obtain a mixed bacteria.

[0053] The mixed bacteria were washed with 400 μL of 2216E medium into a centrifuge tube, and the washed mixed bacterial solution was spread on a 2216E plate containing 10 μg / mL chloramphenicol and cultured at 28°C for 1-2 days. Then, 8 single clones were picked and added to a 2216E liquid medium containing 34 μg / mL chloramphenicol and cultured at 28°C. Four single clone bacterial solutions were taken as DNA templates for bacterial solution PCR verification. Primers VH-F / VH-R were designed according to the V. harveyi LcV6 gene, wherein the nucleotide sequence of VH-F is shown in SEQ ID NO.10: 5'-CTGCTCGGTTCATCACA-3', and the nucleotide sequence of VH-R is shown in SEQ ID NO.11: 5'-CCAGCGTTTATCCTCAT-3'.

[0054] The PCR system was 25 μL: 2×Taq PCR Master Mix 12.5 μL, 10 μM pRE112-F 1 μL, 10 μM VH-R 1 μL, DNA template 1 μL, sterile water 9.5 μL. The PCR amplification program was: 94°C for 5 min; 94°C for 30 sec, 58°C for 30 sec, 72°C for 1 min, 35 cycles; stored at 4°C. The PCR products were separated and verified by agarose gel electrophoresis. The results are shown in Figure 4 Lanes 1 and 4 are 1315 bp, and lanes 2 and 3 are 1585 bp. Since the order of single exchange between the fusion fragment on the recombinant vector and the upstream and downstream homologous arms on the V.harveyi LcV6 genome is different, the integration of the vector into the genome will produce two results. Lanes 1 and 4 are the results obtained by first exchanging the fusion fragment on the recombinant vector with the upstream homologous arm on the V.harveyi LcV6 genome and then exchanging with the downstream homologous arm. Lanes 2 and 3 are the results obtained by first exchanging the fusion fragment on the recombinant vector with the downstream homologous arm on the V.harveyi LcV6 genome and then exchanging with the upstream homologous arm.

[0055] Step 6: Sucrose induces double exchange (second homologous recombination).

[0056] Add the two bacterial solutions from step 5 to the test tube containing the non-resistant 2216E medium at a volume percentage of 0.1% and culture at 28°C for 15 hours. 1 , 10 2 , 10 3 , 10 4 , 10 5 and 10 6 times, of which the dilution was 10 3 Up to 10 6200 μL of each bacterial suspension was spread on a 10 wt% sucrose plate and cultured at 28°C for 1-2 days. After a single colony was grown, 48 single clones were picked and inoculated into a 96-well plate (each well contained 150 μL of 2216E medium), cultured at room temperature for 5 h, and the bacterial solution was extracted as a knockout strain DNA template. Primers fliQ-F / fliQ-R were designed based on the fliQ gene (the nucleotide sequence of the fliQ gene is shown in SEQ ID NO.12: 5'-TTAGCCGATCATCCCCGGAATGTTGT GGAATAGGTAATCGAACAGCTCCATGATTTTTCGCAGCATCCAGTGACCTGCGAAAATCACCATAAGGAGTGTGACTAATAGACGCGGTAAGAAACTCAGTGTCTGTTCGTTAATCTGTGTTGCGGCTTGAAATACCGCAATACACAAACCAACAATCAAACCAGGTACAACAAGCACTGCCACCATCAAGATGATAAGCCATACTGCGTCAGAGAATAGAGTGACGGTTAATTCTGGTGTCAT-3'), wherein the nucleotide sequence of fliQ-F is shown in SEQ ID NO.12: 5'-TTAGCCGATCATCCCCGGAATGTTGT GGAATAGGTAATCGAACAGCTCCATGATTTTTCGCAGCATCCAGTGACCTGCGAAAATCACCATAAGGAGTGACGGTTAATTCTGGTGTCAT-3'). NO.13 is shown: 5'-GTGTTGCGGCTTGAAAT-3', and the nucleotide sequence of fliQ-R is shown in SEQ ID NO.14: 5'-ATGGTGGCAGTGCTTGT-3'.

[0057] The strains were randomly selected from the two results as DNA templates for bacterial liquid PCR verification. The PCR system was 25μL: 2×Taq PCR Master Mix 12.5μL, 10μM fliQ-F 1μL, 10μM VH-R 1μL, DNA template 1μL, and sterilized water 9.5μL. The PCR amplification program was: 94℃5min; 94℃30sec, 58℃30sec, 72℃1min, 35 cycles; stored at 4℃, and the PCR products were separated and verified by agarose gel electrophoresis. At the same time, a control group was set up: Vibrio harveyi bacterial liquid was used as a DNA template for bacterial liquid PCR verification. The PCR system and PCR amplification program were the same as above, and the PCR products were separated and verified by agarose gel electrophoresis.

[0058] The results are as follows Figure 5 As shown, lane 1 is the wild V.harveyi LcV6 strain, the PCR product length is 721 bp (control group), lanes 2-4 are V.harveyi LcV6△fliQ knockout strains, and the PCR product length is 0 bp.

[0059] VH-F / VH-R were further used as primers for verification. The PCR system was 25 μL: 2×Taq PCR MasterMix 12.5 μL, 10 μM VH-F 1 μL, 10 μM VH-R 1 μL, DNA template 1 μL, and sterile water 9.5 μL. The PCR amplification procedure was the same as above. After the amplification was completed, the PCR products were separated and verified by agarose gel electrophoresis. The results are shown in Figure 6 As shown, lane 1 is the PCR product of the wild V.harveyi LcV6 strain with a length of 1473bp, lanes 2-8 are the PCR products of the V.harveyi LcV6△fliQ knockout strain with a length of 1162bp, and the PCR amplification products are sequenced for verification, and the verified correct colonies are stored at -80°C, which are the fliQ gene knockout mutants of Vibrio harveyi.

[0060] The strain has been deposited in the General Microbiology Center of the China Culture Collection Administration. It is the V.harveyi LcV6△fliQ strain, classified and named Vibrio harveyi, with the deposit number CGMCCNo.32132. The deposit time is September 30, 2024. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences.

[0061] Specific Example 2: Determination of motility of the fliQ gene knockout mutant strain of Vibrio harveyi prepared in Specific Example 1.

[0062] The wild-type strain of V. harveyi LcV6 and the knockout strain of V. harveyi LcV6ΔfliQ were cultured in LB solid medium until OD 600 Close to 0.5, then adjust the OD with LB liquid medium 600 =0.2, carefully drop 1 μL of bacterial solution onto 0.3% agar LB semi-solid medium (add 0.3% agar by mass to LB liquid medium), and place in a 28°C incubator for 48 hours. Observe and photograph the movement of the strain, and record and compare the colony diameters. Figure 7 As shown in Figures A and B, under the same conditions, both strains were able to move in a viscous environment, but the colony diameter formed by the V.harveyi LcV6△fliQ knockout strain was significantly smaller than that of the V.harveyi LcV6 wild strain (P<0.05), indicating that the knockout of the fliQ gene affected the motility of the V.harveyi LcV6 wild strain.

[0063] Specific Example 3: Infection experiment and median lethal dose LD of Vibrio harveyi fliQ gene knockout mutant prepared in Specific Example 1 50 Determination of.

[0064] The experimental fish were healthy large yellow croaker purchased from a breeding farm in Xiangshan, Zhejiang Province, with a body length of 8-10 cm and a weight of about 25-30 g. They were temporarily kept in the ecological cycle breeding system of the pilot base of the College of Oceanography of Ningbo University for more than a week without any abnormalities as experimental fish. The experimental fish were randomly divided into groups, with 30 fish in each group, and the breeding water temperature was 18°C. No food was fed during the experiment.

[0065] Median lethal dose determination: Healthy yellow croakers were divided into groups of 30, and the bacterial suspensions of a certain concentration of wild strain V. harveyi LcV6 and knockout strain V. harveyi LcV6△fliQ were diluted proportionally to 4×10 8 , 4×10 7 , 4×10 6 CUF / mL. The bacterial solution was injected intraperitoneally, 0.2mL / tail. The control group was injected with sterile PBS buffer, 0.2mL / tail, and then the LD of each group on large yellow croaker was calculated. 50 .

[0066] The results are as follows Figure 8 As shown in A and B, LD was calculated by Bliss method 50 The half lethal concentration of wild-type V. harveyi LcV6 is 7.4×10 5 CFU / mL, fliQ knockout type of Vibrio harveyi is 6.7×10 6 CFU / mL. The virulence was reduced by 9.1 times compared with the wild type.

[0067] Specific Example 4: Experiment on the immune protection of large yellow croaker by the fliQ gene knockout mutant of Vibrio harveyi prepared in Specific Example 1.

[0068] The experimental large yellow croakers were randomly divided into groups, 30 per group. The large yellow croakers were immunized by intraperitoneal injection of the fliQ gene knockout mutant of Vibrio harveyi prepared in Example 1. The concentration of the prepared strain was adjusted to 2.4×10 5 CUF / mL, 0.2mL / tail, intraperitoneal injection. The control group was injected with sterile PBS buffer, 0.2mL / tail. After 14 days, booster immunization was performed by repeating the above dose. One week later, each group was challenged with wild V. harveyi LcV6 live bacteria at a concentration of 10 9 CUF / mL, 0.2mL / tail, intraperitoneal injection. Then observe the control group and the immunized group, record the number of deaths, and calculate the immune protection of each group according to the following formula: immune protection % = (control group mortality - immunized group mortality) / control group mortality × 100%.

[0069] The results are as follows Fig. 9As shown, 3 weeks after vaccination, the large yellow croakers in the immunized group and the control group were injected with wild-type. The results showed that after stimulation with the wild-type, deaths were observed in both the control group and the vaccine group. Compared with the immunized group, the mortality rate of the control group after the challenge was significantly increased, and the tail fin and abdomen of the dead large yellow croakers were ulcerated, there was yellowish inflammatory mucus in the intestinal cavity, and a large number of white spots appeared in the spleen. 17 days after the challenge, the mortality rates of the control group and the immunized group were 100% and 56.7%, respectively, and the calculated value of the immune protection RPS was 43.3%.

[0070] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by a person skilled in the art within the spirit and scope of the present invention shall also fall within the protection scope of the present invention.

Claims

1. A fliQ gene knockout mutant of Vibrio harveyi, characterized in that: The strain is V.harveyi LcV6△fliQ strain, classified and named as Vibrio harveyi, and the preservation number is CGMCC No.32132.

2. A method for preparing the fliQ gene knockout mutant of Vibrio harveyi according to claim 1, characterized in that The following steps are involved: Step 1, activating the strain: streak culture of V.harveyi LcV6 with a deposit number of CGMCC No.32133, then pick a single clone and inoculate it into LB liquid culture medium for activation at 28°C to obtain a Vibrio harveyi bacterial liquid; Step 2, amplification of upstream and downstream fragments of the fliQ gene: first, the location of the fliQ gene of Vibrio harveyi in the genome was obtained, and the approximately 500 bp parts at both ends were cloned as homology arms, and primers fliQ-up-F / fliQ-up-R for amplifying the upstream fragment of fliQ and fliQ-down-F / fliQ-down-R for amplifying the downstream fragment of fliQ were designed, and PCR amplification was performed to obtain the upstream fragment of fliQ and the downstream fragment of fliQ, respectively; Step 3, homology arm construction: Use overlapping PCR technology to amplify the fliQ upstream and downstream fusion fragments, then insert the fliQ upstream and downstream fusion fragments into the T1 vector and transform into CC118 competent cells, screen positive clones to obtain fliQ-UD-T recombinant plasmid; Step 4, construction of a recombinant knockout vector: the fliQ-UD-T recombinant plasmid and the pRE112 vector obtained in step 3 were digested and then connected for transformation, and positive clones were screened after cultivation to obtain X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112; Step 5, recombinant plasmid conjugation transfer experiment: using the X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112 obtained in step 4 as the donor bacteria, and using V.harveyi LcV6 with a deposit number of CGMCC No.32133 as the recipient bacteria, a conjugation transfer experiment was carried out to obtain a positively identified strain; Step 6, sucrose-induced double exchange: The positively identified strains were inoculated into LB solid medium containing 10 wt% sucrose, and single clones were selected and inoculated into 96-well plates for bacterial liquid PCR verification. Positive clones were screened to obtain the Vibrio harveyi fliQ gene knockout mutant strain.

3. The method for preparing the fliQ gene knockout mutant of Vibrio harveyi according to claim 2, characterized in that: The nucleotide sequence of the fliQ-up-F in step 2 is shown in SEQ ID NO.1: 5'-AAATCTAGAAATGCCTTGAAGAGATAGAGCGGTAATAC-3'; the nucleotide sequence of the fliQ-up-R is shown in SEQ ID NO.2: 5'-TGGTACCTTGTCTGCCAGCTTGTCCATGATTCTTGGTC-3'; the nucleotide sequence of the fliQ-down-F is shown in SEQ ID NO.3: 5'-GACCAAGAATCATGGACAAGC TGGCAGACAAGGTACCA-3'; the nucleotide sequence of the fliQ-down-R is shown in SEQ ID NO.4: 5'-AAAGAGCTCGCCCACCAAACCGAGTGTTG-3'.

4. The method for preparing the fliQ gene knockout mutant of Vibrio harveyi according to claim 2, characterized in that: The overlapping PCR amplification system described in step 3 is 2×Taq PCR Master Mix 12.5 μL, 1 μL of 10 μM fliQ-up-F containing Xba I restriction site, 1 μL of 10 μM fliQ-down-R containing SacI restriction site, 1 μL of fliQ upstream fragment template DNA, 1 μL of fliQ downstream fragment template DNA, and 8.5 μL of sterile water.

5. The method for preparing the fliQ gene knockout mutant of Vibrio harveyi according to claim 2, characterized in that Step 4 is specifically as follows: construct a recombinant knockout vector: the fliQ-UD-T recombinant plasmid and the pRE112 vector obtained in step 3 are digested and then connected for transformation; the transformed competent cells are revived and cultured overnight; after single colonies are grown, multiple single clones are picked and placed in LB liquid culture medium containing chloramphenicol respectively; the single clones are cultured at 150 rpm in a shaker at 37°C for 12 h; the single clone bacterial solution is used as a DNA template for bacterial solution PCR verification; verification primers pRE112-F / pRE112-R are designed according to the pRE112 vector; the nucleotide sequence of pRE112-F is shown in SEQ ID NO.8: 5'-ACATAGCCCCACTGTTCGT-3'; the nucleotide sequence of pRE112-R is shown in SEQ ID NO.9: 5'-TTTTCGTCTCAGCCAATCC-3'; the PCR amplification system is 25 μL: 2×Taq PCR MasterMix 12.5μ, 10μM pRE112-F 1μL, 1μL of 10μM pRE112-R, 1μL of DNA template, 9.5μL of sterile water; PCR amplification program: 94℃5min; 94℃30sec, 58℃30sec, 72℃1min, 35 cycles; stored at 4℃, and X7213 positive bacteria containing the recombinant vector ΔfliQ-pRE112 were obtained.

6. The method for preparing the fliQ gene knockout mutant of Vibrio harveyi according to claim 2, characterized in that Step 5 is specifically as follows: the bacterial solution of Vibrio harveyi and the positive bacterial solution of X7213 containing the recombinant vector ΔfliQ-pRE112 are mixed in a volume ratio of 1:1 and then dropped into the center of a 2216E plate containing DAP for culture to obtain a mixed bacteria, the mixed bacteria are washed and spread on a 2216E plate containing chloramphenicol, a single clone is picked out after culture and cultured in a 2216E liquid culture medium containing chloramphenicol, the single clone bacterial solution is used as a DNA template for bacterial solution PCR verification, and the positive strains are screened and identified.

7. The method for preparing the fliQ gene knockout mutant of Vibrio harveyi according to claim 2, characterized in that Step 6 is specifically as follows: adding the positively identified strain to a test tube containing non-resistant 2216E medium, diluting the bacterial solution and spreading it on a 10% sucrose plate for culture after culturing, picking several single clones after single colonies grow, inoculating them into well plates and culturing them at room temperature, extracting the bacterial solution as a knockout strain DNA template for bacterial solution PCR verification, and screening positive clones to obtain the Vibrio harveyi fliQ gene knockout mutant.

8. Use of the fliQ gene knockout mutant of Vibrio harveyi according to claim 1 in preparing a live attenuated vaccine preparation.

9. Use of the Vibrio harveyi fliQ gene knockout mutant according to claim 1 in preparing a Vibrio harveyi inhibitor.

10. Use of the fliQ gene knockout mutant of Vibrio harveyi according to claim 1 in preparing an immune protectant for large yellow croaker.

Images