Recombinant photogenic bacterium for detecting genotoxic pollutants as well as construction method and detection method of recombinant photogenic bacterium

Abstract

The invention discloses a recombinant photobacterium for detecting genotoxic pollutants as well as a preparation method and a detection method of the recombinant photobacterium, and belongs to the technical field of analysis and detection. The invention provides a recombinant luminescent bacterium for detecting genetic toxic pollutants, a chromosome of the recombinant luminescent bacterium carries a luminescent gene, and the luminescent gene and a target gene on the chromosome have a common promoter. Luminescence enhancement of the recombinant luminescent bacterium is induced by the genotoxic substance, and target gene transcription of the recombinant luminescent bacterium is enhanced in the presence of the genotoxic substance, so that the luminescent gene is expressed, and whole-cell biosensing of genotoxicity detection is realized. The recombinant photobacterium obtained by the method has the advantages of stable strain structure, high sensitivity, simple sample treatment, fast detection, low detection cost, and detection limit of 0.5 [mu] M.

Description

Technical Field

[0001] The present invention belongs to the technical field of analysis and detection, and in particular relates to a recombinant luminescent bacteria for detecting genetic toxic pollutants and a construction method and a detection method thereof. Background Art

[0002] Pollutants entering the environment seriously endanger human health. Among them, the detection of genotoxic pollutants has attracted much attention. Usually, toxic substances are generally detected by physical and chemical methods and biological methods. Physical and chemical methods are based on instrumental analysis of sample components, such as GC-MS or HPLC. The composition data of the sample can be obtained by physical and chemical means, and the toxicity of the substance in the sample can be obtained by toxicity data conversion. However, the physical and chemical analysis method has many procedures and high costs, which are not suitable for rapid and high-throughput applications on site. Moreover, the toxicity data obtained do not consider the biological effectiveness of the substance in the environment. More importantly, the results ignore the antagonism, addition and synergy between toxic substances. Biological detection methods are simple to operate and low in cost. They are suitable for rapid and high-throughput applications on site, and can reflect the antagonism, addition and synergy between toxic substances in the sample. They are of great significance in the detection of genotoxicity. Among them, biosensor cells are a type of detection method that is developing rapidly.

[0003] Currently, commonly used biological detection methods mainly include biosensor cytotoxicity assessment, such as the Ames test for Salmonella typhimurium / microsome mutagenicity (Ames test), SOS / umu test, and SOS lux test. However, the Ames test is time-consuming, the plasmid vector cannot guarantee stability, and the chemical being tested will diffuse to the bottom of the plate when added to the top layer, and the concentration will decrease over time, thus affecting the experimental results; the SOS / umu test has low sensitivity, cumbersome operation, requires cell disruption and the addition of a colorimetric agent, which is costly, and the plasmid vector cannot guarantee stability. The fusion gene fragment in the SOS lux method is large, and the host strain construction is difficult. Therefore, it is urgent to develop a new method. Summary of the invention

[0004] The present invention provides a recombinant luminescent bacteria for detecting genotoxic pollutants, a construction method and a detection method thereof. The luminescent intensity of the recombinant luminescent bacteria responds to the environment and the degree of genotoxic contamination in a sample can be quickly determined.

[0005] The first invention objective of the present invention is to provide a recombinant luminescent bacteria for detecting genotoxic pollutants, wherein the recombinant luminescent bacteria is based on Acinetobacter as a basic bacterium, and a luminescent gene and a resistance gene are inserted between target genes in the genome of the basic bacterium;

[0006] The target gene and the luminescent gene are driven by a common promoter.

[0007] In a preferred embodiment of the present invention, the target gene includes the recA gene, the luminescent gene includes luxCDABE, and the resistance gene includes the kanamycin resistance gene kmr.

[0008] The second invention object of the present invention is to provide a method for constructing the above-mentioned recombinant luminescent bacteria, comprising the following steps:

[0009] (1) Using the genome of Acinetobacter as a template, four primers were designed to amplify the 5' and 3' parts of the target gene respectively, and then the target gene fragment with two restriction sites inserted was obtained by overlapping PCR; different restriction sites were inserted into the 5' and 3' parts respectively;

[0010] (2) cloning the target gene fragment obtained in step (1) into a T vector, and simultaneously connecting the luminescent gene and the resistance gene in sequence using the same enzyme as the restriction site described in step (1) to obtain a recombinant vector;

[0011] (3) Using the recombinant vector described in step (2) to transform the basic bacteria, thereby obtaining the recombinant luminescent bacteria.

[0012] In a preferred embodiment of the present invention, when the target gene in step (1) is recA, the four primers designed include recA_f and recA_ir for amplifying the 5' portion, and recA_if and recA_r for amplifying the 3' portion, wherein the nucleotide sequences of recA_f, recA_ir, recA_if and recA_r are shown in SEQ ID No.1 to SEQ ID No.4, respectively.

[0013] In a preferred embodiment of the present invention, overlapping PCR is performed after the amplification, and the overlapping PCR program includes: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 1 minute, annealing at 60°C for 1 minute, extension at 72°C for 2.5 minutes, 35 cycles; and extension at 72°C for another 10 minutes.

[0014] The third inventive object of the present invention is to provide a method for preparing a bacterial solution for detecting genotoxic pollutants in water bodies, comprising culturing the above-mentioned recombinant luminous bacteria under oscillation conditions for 14 to 16 hours, resuspending the bacterial mud after centrifugation, and obtaining the bacterial solution.

[0015] In a preferred embodiment of the present invention, the recombinant luminescent bacteria is inoculated into LBK10 liquid culture medium and incubated at 30° C. for 14 to 16 hours on a shaker at a rotation speed of 150 rpm.

[0016] The fourth invention objective of the present invention is to provide a bacterial solution prepared by the above preparation method.

[0017] A fifth inventive object of the present invention is to provide the use of the above-mentioned recombinant luminescent bacteria or the above-mentioned bacterial solution in detecting genotoxic pollutants in water bodies.

[0018] The sixth inventive object of the present invention is to provide a method for detecting genotoxic pollutants in water, comprising mixing the above-mentioned bacterial solution with a sample, reacting for a period of time, detecting the luminescence intensity, and evaluating the concentration of genotoxic pollutants in the sample based on the luminescence intensity.

[0019] Beneficial effects: The present invention provides a recombinant luminescent bacteria for detecting genotoxic pollutants, wherein the chromosome of the recombinant luminescent bacteria carries a luminescent gene, and the luminescent gene and the target gene on the chromosome have a common promoter, which overcomes the problem of plasmid loss when a plasmid is used as a vector, and the destruction of the target gene causes the recombinant luminescent bacteria to lose the ability to homologously recombine exogenous DNA, thereby improving genetic stability. In one embodiment of the present invention, a Acinetobacter ADP1_recA is constructed, which carries the luminescent gene luxCDABE on its chromosome and has a common promoter with the recA gene on the chromosome. Moreover, the luminescence enhancement of the recombinant luminescent bacteria of the present invention is induced by genotoxic substances. In the presence of genotoxic substances, the transcription of the recA gene of the recombinant bacteria is enhanced, thereby expressing the luminescent gene luxCDABE, thereby realizing whole-cell biosensing for genotoxicity detection.

[0020] The recombinant luminescent bacteria obtained by the method of the present invention have stable strain structure, high sensitivity, simple sample processing, rapid detection and low detection cost. The present invention confirms that the relative luminescence intensity is positively correlated with the genotoxicity of the sample to a certain extent. For example, in one embodiment, the toxicity detection of ADP1_recA can be completed within 2 hours after being exposed to the genotoxic substance MMC, and the minimum detection limit is 0.5 μM. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a schematic diagram of the chromosome fragment of Acinetobacter ADP1_RecA;

[0022] Figure 2 Schematic diagram of the process of obtaining the recA gene containing restriction sites through overlapping PCR reaction;

[0023] Figure 3 The effect of different concentrations of MMC on the luminescence intensity of ADP 1_recA at different times;

[0024] Figure 4 The relationship between MMC concentration and ADP 1_recA luminescence intensity at 60 minutes. DETAILED DESCRIPTION

[0025] The present invention provides a recombinant luminescent bacteria for detecting genotoxic pollutants, wherein the recombinant luminescent bacteria uses Acinetobacter as a basic bacterium, and a luminescent gene and a resistance gene are inserted between target genes in the genome of the basic bacterium;

[0026] The target gene and the luminescent gene are driven by a common promoter.

[0027] The present invention does not specifically limit the specific strain of the basic bacteria. For example, in one embodiment, Acinetobacter baylyi ADP1: ATCC33304 is selected as the basic bacteria, wherein the target gene may be the recA gene (Gene ID: 45233800), the luminescence gene includes luxCDABE, and the resistance gene includes the kanamycin resistance gene kmr.

[0028] The present invention also provides a method for constructing the above-mentioned recombinant luminescent bacteria, comprising the following steps:

[0029] (1) Using the genome of Acinetobacter as a template, four primers were designed to amplify the 5' and 3' parts of the target gene respectively, and then the target gene fragment with two restriction sites inserted was obtained by overlapping PCR; different restriction sites were inserted into the 5' and 3' parts respectively;

[0030] (2) cloning the target gene fragment obtained in step (1) into a T vector, and simultaneously connecting the luminescent gene and the resistance gene in sequence using the same enzyme as the restriction site described in step (1) to obtain a recombinant vector;

[0031] (3) Using the recombinant vector described in step (2) to transform the basic bacteria, thereby obtaining the recombinant luminescent bacteria.

[0032] In one embodiment of the present invention, the target gene is recA, and a total of 4 primers are designed, including recA_f and recA_ir for amplifying the 5' part, and recA_if and recA_r for amplifying the 3' part, and the sequences are as follows:

[0033] RecA_f(SEQ ID No.1):TCATTAGCAATAAGAGGTTGGATCG;

[0034] RecA_ir (SEQ ID No. 2): TCGCACCAGAGCGTACAAGCGGATCCGGAATTCCC;

[0035] RecA_if (SEQ ID No. 3): GGGAATTCCGGATCCGCTTGTACGCTCTGGTGCGA;

[0036] RecA_r (SEQ ID No. 4): GGCTTCGCAATTGTACTCTGTG.

[0037] When designing primers, the present invention designs the endonuclease recognition sites of EcoRI and BamHI on the primers recA_if and recA_ir, respectively. Then, PCR amplification is performed, and the PCR amplification procedure includes: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 1 minute, annealing at 60°C for 1 minute, extension at 72°C for 2.5 minutes, 35 cycles; and extension at 72°C for 10 minutes.

[0038] The present invention uses the two amplified recA fragments as templates to obtain the recA gene fragment of ADP1 containing EcoRI and BamHI restriction sites by overlapping PCR. The overlapping PCR reaction uses a Taq polymerase kit (Sigma), and the overlapping PCR program is set as follows: 95°C pre-denaturation for 5 minutes; 95°C denaturation for 1 minute, 60°C annealing for 1 minute and 72°C extension for 2.5 minutes, 35 cycles; 72°C extension for 10 minutes.

[0039] The present invention clones the recA gene containing restriction sites into a T vector to construct a recombinant vector. In one embodiment, pGEM-T is used as the T vector to obtain a recombinant vector pRecA. Then, a luminescent gene and a resistance gene are inserted into the recombinant vector pRecA, such as by double-digesting the plasmid pSalAR_lux (disclosed in DOI:10.1111 / j.1462-5822.2005.00821.x) and pRMJ1 (disclosed in DOI:10.1016 / j.desal.2004.12.025) with restriction endonucleases EcoRI and BamHI, respectively, to obtain a luxCDABE fragment and a kanamycin resistance gene kmr, and then sequentially connect them with the pRecA plasmid to obtain a recombinant vector pRecA_lux containing the luminescent gene luxCDA BE and the kanamycin resistance gene kmr.

[0040] The present invention utilizes the recombinant vector pRecA_lux to transform competent cells of the basic bacteria. For example, in one embodiment, the ADP1 cells are shaken and cultured at 30°C for 3 hours to enter an exponential growth phase, mixed with pRecA_lux, cultured at 30°C for 3 hours, and the recombinant, i.e., ADP1_recA, is screened by LBK10 medium. The LBK10 medium of the present invention is an LB broth medium containing 10 g / mL kanamycin, and the LB broth medium is a commercially available powder prepared according to the instructions.

[0041] The present invention also provides a method for preparing a bacterial solution for detecting genetic toxic pollutants in water, comprising culturing the above-mentioned recombinant luminous bacteria under oscillation conditions for 14 to 16 hours, resuspending the bacterial mud after centrifugation, and obtaining the bacterial solution.

[0042] In a preferred embodiment of the present invention, the recombinant luminescent bacteria is inoculated into LBK10 liquid culture medium, and incubated at 30°C for 14 to 16 hours on a shaker with a rotation speed of 150 rpm. In the present invention, the cultured cells are centrifuged at 3000 rpm for 5 minutes, and the bacterial sludge obtained by centrifugation is resuspended in 10 ml of fresh LBK10 liquid culture medium to obtain the bacterial solution.

[0043] The present invention also provides a bacterial liquid prepared by the above preparation method.

[0044] The present invention also provides the use of the recombinant luminescent bacteria or the bacterial solution in detecting genetic toxic pollutants in water bodies.

[0045] The genetic toxic pollutants described in the present invention include industrial wastewater, polluted water bodies and water quality biological genetic toxicity of soluble chemical substances under test conditions.

[0046] The present invention also provides a method for detecting genotoxic pollutants in water, comprising mixing the above bacterial solution with a sample, reacting for a period of time, detecting the luminescence intensity, and evaluating the concentration of the genotoxic pollutants in the sample according to the luminescence intensity.

[0047] In one embodiment of the present invention, 20 μL of the bacterial solution and 180 μL of the sample were transferred to each well of a 96-well microplate and immediately mixed for bioluminescence measurement. After 60 minutes of reaction, the relative luminescence intensity showed a good linear relationship with the concentration of the toxic substance in the sample.

[0048] In order to further illustrate the present invention, the recombinant luminescent bacteria for detecting genotoxic pollutants provided by the present invention and its construction method and detection method are described in detail below in combination with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0049] Example 1

[0050] A. Using the ADP1 colony of Acinetobacter as a template, four PCR primers were designed. RecA_f and recA_ir amplified the 5' part of the recA gene, and recA_if and recA_r amplified the 3' part of the recA gene. EcoRI and BamHI restriction sites were designed on primers recA_if and recA_ir, respectively. The recA gene fragment of ADP1 containing EcoRI and BamHI restriction sites was obtained by overlapping PCR. The overlapping PCR reaction used a Taq polymerase kit (Sigma), and the process was as follows: Figure 2 shown.

[0051] B. The recA gene containing the restriction site was cloned into pGEM-T to obtain the recombinant vector pRecA. The plasmids pSalAR_lux and pRMJ1 were cut by restriction endonucleases EcoRI and BamHI to obtain the luxCDABE fragment and the kanamycin resistance gene kmr, which were then connected to the pRecA plasmid in turn to obtain the recombinant vector pRecA_lux containing the luminescent gene luxCDABE and the kanamycin resistance gene kmr.

[0052] C. Prepare APD1 spontaneous competent cells and transform pRecA_lux into ADP1. The specific method is: ADP1 cells are shaken and cultured at 30℃ for 3 hours to enter the exponential growth phase, mixed with pRecA_lux, cultured at 30℃ for 3 hours, and the recombinant, i.e. ADP1_recA, is selected by LBK10 medium. The chromosome fragment of Acinetobacter ADP1_RecA has Figure 1 Schematic diagram of the structure shown.

[0053] D. Take a single ADP1_recA colony and inoculate it into 2 mL of LBK10 liquid culture medium. Incubate it at 30°C overnight (14-16 h) on a rotary shaker at 150 rpm.

[0054] E. Centrifuge the overnight cultured cells at 3000 rpm for 5 min and resuspend in 10 ml of fresh LBK10 liquid culture medium.

[0055] F. Transfer 20 μL of cell solution and 180 μL of sample to each well of a 96-well microplate (96-well optical flat bottom plate) and mix immediately for bioluminescence measurement. After 60 minutes of reaction, the relative luminescence intensity showed a good linear relationship with the concentration of toxic substances in the sample.

[0056] Different concentrations of MMC (mitomycin C) were used to detect the effect on the luminescence intensity of ADP 1_recA at different times: 180 μL of MMC of different concentrations was added to 20 μL of ADP1_recA cell solution to make the final concentrations 0, 0.05, 0.1, 0.2, 0.4 and 0.8 μM. The bioluminescence value of each sample was measured every 5 minutes at 37°C. Three parallels were set for each test condition during one experiment;

[0057] The results are as follows Figure 3 As shown in the figure, within the concentration range of 0.05g / L to 0.8mg / L MMC, the MMC dose and luminescence intensity showed an S-shaped dose-effect relationship commonly seen in toxicity effect studies. The higher the MMC concentration, the higher the relative luminescence intensity.

[0058] Moreover, there was a good linear relationship between the MMC concentration and the ADP 1_recA luminescence intensity at 60 min, as shown in Figure 4 As shown, y = 0.513x + 0.913, R 2 =0.9815, x is the MMC concentration (μM), y is the relative luminescence intensity RLU.

[0059] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A recombinant luminescent bacterium for detecting genotoxic pollutants, characterized in that: The recombinant luminescent bacteria uses Acinetobacter as the basic bacteria, and a luminescent gene and a resistance gene are inserted between the target genes of the genome of the basic bacteria; The target gene and the luminescent gene are driven by a common promoter.

2. The recombinant luminescent bacteria according to claim 1, characterized in that: The target gene includes the recA gene, the luminescent gene includes luxCDABE, and the resistance gene includes the kanamycin resistance gene kmr.

3. The method for constructing the recombinant luminescent bacteria according to claim 1 or 2, characterized in that: The following steps are involved: (1) Using the genome of Acinetobacter as a template, four primers were designed to amplify the 5' and 3' parts of the target gene respectively, and then the target gene fragment with two restriction sites inserted was obtained by overlapping PCR; different restriction sites were inserted into the 5' and 3' parts respectively; (2) cloning the target gene fragment obtained in step (1) into a T vector, and simultaneously connecting the luminescent gene and the resistance gene in sequence using the same enzyme as the restriction site described in step (1) to obtain a recombinant vector; (3) Using the recombinant vector described in step (2) to transform the basic bacteria, thereby obtaining the recombinant luminescent bacteria.

4. The construction method according to claim 3, characterized in that: When the target gene in step (1) is recA, the four primers designed include recA_f and recA_ir for amplifying the 5' portion, and recA_if and recA_r for amplifying the 3' portion, wherein the nucleotide sequences of recA_f, recA_ir, recA_if and recA_r are shown in SEQ ID No.1 to SEQ ID No.4, respectively.

5. The construction method according to claim 4, characterized in that: After the amplification, overlapping PCR was performed, and the program of the overlapping PCR included: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 2.5 min, 35 cycles; and extension at 72°C for another 10 min.

6. A method for preparing a bacterial solution for detecting genotoxic pollutants in water, characterized in that: The method comprises culturing the recombinant luminescent bacteria according to claim 1 or 2 under shaking conditions for 14 to 16 hours, resuspending the bacterial mud after centrifugation, and obtaining the bacterial solution.

7. The preparation method according to claim 6, characterized in that: The method comprises inoculating the recombinant luminescent bacteria into LBK10 liquid culture medium, and incubating the culture medium at 30° C. for 14 to 16 hours on a shaking table with a rotation speed of 150 rpm.

8. The bacterial liquid prepared by the preparation method according to claim 6 or 7.

9. Use of the recombinant luminescent bacteria according to claim 1 or 2 or the bacterial solution according to claim 8 in detecting genotoxic pollutants in water.

10. A method for detecting genotoxic pollutants in water, characterized in that: The method comprises mixing the bacterial solution of claim 8 with a sample, reacting the mixture for a period of time, detecting the luminescence intensity, and evaluating the concentration of genotoxic pollutants in the sample according to the luminescence intensity.

Images