Production method of beta-glucosidase and application of beta-glucosidase

Abstract

The invention provides a production method and application of beta-glucosidase. The production method of the beta-glucosidase comprises the following steps: step 1, preparing a carrier with a CEL3A gene through trichoderma reesei; and 2, extracting the CEL3A gene from the carrier with the CEL3A gene, and expressing the CEL3A gene by adopting an escherichia coli BL21 cell to obtain the beta-glucosidase. According to the production method and application of the beta-glucosidase, production process parameters are adjustable, and a new opportunity is provided for people to finely adjust or customize a traditional cellulase premix so as to better meet the raw material requirements of the traditional cellulase premix. This makes them more flexible and efficient in the food processing industry, thereby saving the costs for making different food products.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering, and specifically to recombining the CEL3A gene from Trichoderma reesei and using an Escherichia coli expression system and a vector thereof to produce beta-glucosidase, aiming to improve and simplify the food processing procedure of dehulled oil bean by using the above techniques. Background Art

[0002] Cellulase is an enzyme that helps break down cellulose into glucose. β-Glucosidase is the main component of cellulase and is responsible for converting cellobiose into glucose, contributing to the final step of cellulose hydrolysis. Due to its properties, cellulase is often used as a catalyst in the food production and processing industry to soften fruit, soften dough, and digest the hard outer shell of foods like peas.

[0003] Classified as a weed, the tuber of yam bean resembles a nut and is rich in nutrients, including healthy oils, protein and fiber, as well as minerals and vitamins such as phosphorus, vitamin C and vitamin E. The application of yam bean is very diverse, and it can be made into yam bean milk, ice cream and even baked products. However, there are also some problems in the manufacturing process of yam bean:

[0004] 1. The thick skin of oil bean contains very high cellulose, hemicellulose and glutamine, so it is difficult for enzyme degradation to obtain its internal components.

[0005] 2. Commercially available or traditional cellulase premixes are not enough to decompose the thick skin of oil bean, because they are fixed and standardized enzyme premixes, which cannot meet the requirements of foods with higher fiber content. Therefore, it is difficult to obtain its internal components using existing food processing procedures.

[0006] Therefore, it is necessary to develop a more efficient and high-yield β-glucosidase production technology, thereby increasing the β-glucosidase concentration in the cellulase premix to improve the performance of the traditional cellulase premix, better achieve the purpose of decomposing the oil bean skin, and improve and simplify the food processing procedures of removing the root skin of the oil bean. This invention also aims to establish a protocol for food manufacturers to fine-tune commercially available cellulase premixes to meet their own needs, thereby achieving greater flexibility and cost savings in their food production and processing procedures. Summary of the invention

[0007] In view of the above technical problems, the present invention provides a production method of β-glucosidase and its application.

[0008] The technical solution proposed by the present invention is as follows:

[0009] The present invention provides a method for producing β-glucosidase, comprising the following steps:

[0010] Step 1, preparing a vector having a CEL3A gene by using Trichoderma reesei;

[0011] Step 2: extract the CEL3A gene from the vector having the CEL3A gene, and express the CEL3A gene using Escherichia coli BL21 cells to obtain β-glucosidase.

[0012] In the above-mentioned method for producing β-glucosidase of the present invention, step 1 comprises:

[0013] Step 1.1, extracting β-glucosidase messenger RNA of Trichoderma reesei QM9414;

[0014] Step 1.2, using β-glucosidase messenger RNA for reverse transcription to obtain complementary deoxyribonucleic acid of CEL3A gene;

[0015] Step 1.3, using the complementary deoxyribonucleic acid of the CEL3A gene as a template, using 5'attacccgggACCATTCTGTTGAGC 3' as the first forward primer, and using 5'cgataagcttAACCGCCTTCACCCT3' as the first reverse primer to perform polymerase chain reaction amplification, thereby obtaining a vector having the CEL3A gene.

[0016] In the above-mentioned method for producing β-glucosidase of the present invention, step 1 comprises:

[0017] ccgggctgcaggaattcgat ATGCGTTACCGAACAGCAGC was used as the second forward primer;

[0018] CCGAGGCCCCCGATGTTGAG TGACTGTCTGCCCTAGCAAA was used as the second reverse primer;

[0019] TTTGCTAGGGCAGACAGTCA CTCAACATCGGGGGCCTCGG was used as the third forward primer;

[0020] GTAGTTGAACTTGGTGTAAG ACAGTCCATAGCCGAACTCG was used as the third reverse primer;

[0021] CGAGTTCGGCTATGGACTGT CTTACACCAAGTTCAACTAC was used as the fourth forward primer;

[0022] acggtatcgataagcttgat CTACGCTACCGACAGAGTGC was used as the fourth reverse primer;

[0023] By using homologous recombination, the pbs2ks+ plasmid is connected to the first exon using the second forward primer, the first exon is connected to the second exon using the second reverse primer, the first exon is connected to the second exon using the third forward primer, the second exon is connected to the third exon using the third reverse primer, the second exon is connected to the third exon using the fourth forward primer, and the third exon is connected to the pbs2ks+ plasmid using the fourth reverse primer to obtain a vector having the CEL3A gene.

[0024] In the above-mentioned method for producing β-glucosidase of the present invention, the CEL3A gene is extracted from the pbs2ks+ plasmid by using XbaI enzyme and HindIII enzyme.

[0025] In the above-mentioned β-glucosidase production method of the present invention, the expression of CEL3A gene by using Escherichia coli BL21 cells is achieved by inserting the CEL3A gene into an expression vector compatible with Escherichia coli BL21 cells.

[0026] In the above-mentioned method for producing β-glucosidase of the present invention, the expression vector compatible with Escherichia coli BL21 cells is the pET-22b expression vector.

[0027] In the above-mentioned method for producing β-glucosidase of the present invention, step 2 comprises:

[0028] Step 2.1, inserting the CEL3A gene into the pET-22b expression vector using T4 DNA ligase to obtain the pET22b-CEL3A expression vector;

[0029] Step 2.2, transform the pET22b-CEL3A expression vector into Escherichia coli BL21 cells, and then induce with isopropyl β-D-thiogalactoside to trigger the transcription cascade reaction and induce the expression of β-glucosidase.

[0030] In the above-mentioned β-glucosidase production method of the present invention, in step 2.2, an Escherichia coli colony composed of Escherichia coli BL21 cells having a pET22b-CEL3A expression vector is cultured in LB medium, and when the optical density at a wavelength of 600 nm reaches 0.6, isopropyl β-D-thiogalactoside is added to induce β-glucosidase expression.

[0031] In the above-mentioned method for producing β-glucosidase of the present invention, the LB culture medium comprises 1wt% casein peptone, 1wt% sodium chloride and 0.5wt% yeast extract.

[0032] The invention also provides a use of beta-glucosidase for decomposing cellulose.

[0033] The present invention proposes a production method and use of β-glucosidase, and its production process parameters are adjustable, providing people with new opportunities to fine-tune or customize traditional cellulase premixes to better meet their own raw material needs. This makes them more flexible and efficient in the food processing industry, thereby saving the cost of manufacturing different food products. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] The present invention will be further described below in conjunction with the accompanying drawings and technical effects, in which:

[0035] Figure 1 A graph showing the relationship between the absorbance of a glucose solution and the glucose concentration. DETAILED DESCRIPTION

[0036] The purpose of the present invention is to strengthen the key components of cellulase, so that the process of removing or digesting oil bean skin will become easier and faster, thereby improving the efficiency of food processing or production process, and solving the problem of oil bean skin decomposition in oil bean food processing process. The second purpose of the present invention is to improve and enhance the digestibility and customizability of traditional cellulase premixes used in the food industry.

[0037] The present invention provides a method for producing β-glucosidase, comprising the following steps:

[0038] Step 1, preparing a vector having a CEL3A gene by using Trichoderma reesei;

[0039] There are two methods for implementing step 1. Specifically, in the first method, step 1 includes:

[0040] Step 1.1, extracting β-glucosidase messenger RNA of Trichoderma reesei QM9414;

[0041] Step 1.2, using β-glucosidase messenger RNA for reverse transcription to obtain complementary deoxyribonucleic acid of CEL3A gene;

[0042] Step 1.3: Use the complementary deoxyribonucleic acid of the CEL3A gene as a template to perform polymerase chain reaction amplification to obtain a vector containing the CEL3A gene.

[0043] In step 1.3, the complementary deoxyribonucleic acid of the CEL3A gene is used as a template to perform polymerase chain reaction amplification, so as to connect the complementary deoxyribonucleic acid of the CEL3A gene to the cloning vector and obtain a fragment with a length of 2282 bp, thereby obtaining a vector having the CEL3A gene. In this process, the polymerase chain reaction amplification uses 5'attacccgggACCATTCTGTTGAGC 3' (XmaI) as the first forward primer (see sequence number (ID): 1), and uses 5'cgataagcttAACCGCCTTCACCCT 3' (HindIII) as the first reverse primer (see sequence number (ID): 2), thereby inserting the CEL3A gene into the cloning vector for subsequent expression.

[0044] The second method is to use homologous recombination to combine DNA fragments extracted from Trichoderma reesei. Specific forward and reverse primers are designed to overlap in specific regions in order to selectively amplify the exonic region of the gene and reconnect to form the desired complementary DNA sequence. In addition, the primers also allow the complementary DNA to be simultaneously included in the pBluescript KS(+) cloning vector, that is, the pbs2ks+ plasmid.

[0045] In the second method,

[0046] ccgggctgcaggaattcgat ATGCGTTACCGAACAGCAGC was used as the second forward primer (see sequence number (ID): 3),

[0047] CCGAGGCCCCCGATGTTGAG TGACTGTCTGCCCTAGCAAA was used as the second reverse primer (see sequence number (ID): 4);

[0048] TTTGCTAGGGCAGACAGTCA CTCAACATCGGGGGCCTCGG was used as the third forward primer (see sequence number (ID): 5);

[0049] GTAGTTGAACTTGGTGTAAG ACAGTCCATAGCCGAACTCG was used as the third reverse primer (see sequence number (ID): 6);

[0050] CGAGTTCGGCTATGGACTGT CTTACACCAAGTTCAACTAC was used as the fourth forward primer (see sequence number (ID): 7);

[0051] acggtatcgataagcttgat CTACGCTACCGACAGAGTGC was used as the fourth reverse primer (see sequence number (ID): 8);

[0052] A vector having the CEL3A gene is obtained by connecting the pbs2ks+ plasmid to the first exon using the second forward primer, connecting the first exon to the second exon using the second reverse primer, connecting the first exon to the second exon using the third forward primer, connecting the second exon to the third exon using the third reverse primer, connecting the second exon to the third exon using the fourth forward primer, and connecting the third exon to the pbs2ks+ plasmid using the fourth reverse primer.

[0053] The desired insert sizes of the DNA fragments were 105 bp, 1800 bp and 1800 bp, respectively, and in this way a vector having the CEL3A gene could be obtained.

[0054] Here, when the second forward primer is used to connect the pbs2ks+ plasmid to the first exon and the second reverse primer is used to connect the first exon to the second exon, the insert fragment size = 105bp; when the third forward primer is used to connect the first exon to the second exon and the third reverse primer is used to connect the second exon to the third exon, the insert fragment size = 1800bp; when the fourth forward primer is used to connect the second exon to the third exon and reverse primer 3 is used to connect the third exon to the pbs2ks+ plasmid, the insert fragment size = 1800bp.

[0055] Step 2: extract the CEL3A gene from the vector having the CEL3A gene, and express the CEL3A gene using Escherichia coli BL21 cells to obtain β-glucosidase.

[0056] In this step, the CEL3A gene can be extracted from the pbs2ks+ plasmid using XbaI enzyme and HindIII enzyme.

[0057] The expression of CEL3A gene by using E. coli BL21 cells is achieved by inserting the CEL3A gene into an expression vector compatible with E. coli BL21 cells. The expression vector compatible with E. coli BL21 cells is a pET-22b expression vector.

[0058] Specifically, step 2 includes:

[0059] Step 2.1, inserting the CEL3A gene into the pET-22b expression vector using T4 DNA ligase to obtain the pET22b-CEL3A expression vector;

[0060] Step 2.2, transform the pET22b-CEL3A expression vector into Escherichia coli BL21 cells, and then induce with isopropyl β-D-thiogalactoside (IPTG) to trigger the transcription cascade reaction and induce the expression of β-glucosidase.

[0061] In step 2.2, the pET22b-CEL3A expression vector (expression plasmid) is transformed into Escherichia coli BL21 cells, followed by IPTG induction to trigger the transcriptional cascade reaction. Escherichia coli falls in 40 ml of LB medium (1% casein peptone, 1% sodium chloride and 0.5% yeast extract) and is cultured at 37 ° C and 200 rpm until the optical density at a wavelength of 600 nm reaches 0.6. Afterwards, β-glucosidase expression is induced at 25 ° C by adding 0.4 mM IPTG, and the cells are kept at 210 rpm for 3 hours. Finally, the Escherichia coli BL21 cells are collected by centrifugation at 4000 g at 4 ° C.

[0062] Here, the culture temperature and rotation speed of the E. coli in the LB culture medium can be appropriately adjusted according to the culture environment, and the formula of the LB culture medium is not limited to the above formula. When the optical density at a wavelength of 600nm reaches 0.6, the IPTG addition concentration, environmental temperature, rotation speed and culture time can be appropriately adjusted according to the culture environment.

[0063] β-glucosidase extracted from the collected E. coli BL21 cells can be collected by ultrasonication. First, use 1 ml of cell lysis buffer (50mM tricarboxylic acid-hydrochloride buffer, 25mM sodium chloride and 2mM ethylenediaminetetraacetic acid) to resuspend the cell pellet and sonicate in an ice bath for 4 minutes (including 2 seconds of work and 2 seconds of stop). Once the suspension becomes clear, the desired product can be collected after centrifugation at 12,000g for 30 minutes.

[0064] The benefit of this technology is that the production process parameters in the β-glucosidase production method are adjustable, providing new opportunities for people to fine-tune or customize traditional cellulase premixes to better meet their own raw material needs. This makes them more flexible and efficient in the food processing industry, saving costs in manufacturing different food products.

[0065] The invention also provides a use of beta-glucosidase for decomposing cellulose.

[0066] In order to make the technical purpose, technical solution and technical effect of the present invention clearer and to facilitate those skilled in the art to understand and implement the present invention, the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments.

[0067] Example 1 Cultivation of Trichoderma reesei

[0068] In terms of preliminary preparation, the freeze-dried strain of Trichoderma reesei QM9414 was rehydrated before inoculation to increase the survival rate of the strain. In order to check the survival and growth of the strain, they were inoculated on potato dextrose agar (PDA) plates at different dilutions and aerobically cultured at 25°C for 4-7 days to maximize the chance of successful cultivation. Next, 100 microliters of aerobic cultured Trichoderma reesei QM9414 fungal inoculation was added to 5 milliliters of potato dextrose medium (PDB). Finally, both PDA and PDB were autoclaved at 121°C and 15psi for 20 minutes before use.

[0069] Example 2 Obtaining protein coding genes from RNA by reverse transcription polymerase chain reaction

[0070] To prepare for RNA extraction, the fungus was first inoculated in potato dextrose medium (PDB) with microcrystalline cellulose (Avicel) 1% as a carbon source and cultured aerobically at 25-30°C and 220 rpm for 3 days until spherical fungi were observed. Next, the solution and Avicel were filtered using a 100 micron mesh. After that, the cells were thoroughly washed with double distilled water. Then, the cells were induced to produce RNA in Mandel and Andreotti (MA-medium) and cultured at 25-30°C and 220 rpm for 7 days. The composition of MA medium includes 2 g potassium dihydrogen phosphate, 1.4 g ammonium sulfate, 0.3 g urea, 5 mg ferrous sulfate heptahydrate, 1.6 mg manganese sulfate monohydrate, 1.4 mg zinc sulfate heptahydrate, 2 mg cobalt chloride, 0.3 g magnesium sulfate heptahydrate, 0.3 g calcium chloride or 0.397 g calcium chloride dihydrate, 0.75 g peptone, 10 g glucose in 1 liter water. Prior to use, both PDB and MA-medium were autoclaved at 121°C, 15 psi for 20 min.

[0071] For RNA extraction, collect the cells and filter out the Avicel using a 100 μm mesh sieve and double distilled water. For every 250 mg of cells, use 1 ml The reagents were resuspended and then snap frozen in liquid nitrogen. Cells containing TRIzol can be stored in a -80°C freezer. Next, the thawing solution was used with a microcentrifuge pestle to disrupt the cells. RNA extraction was performed according to the manufacturer's instructions.

[0072] To obtain protein-coding genes from the extracted RNA, reverse transcribe the RNA into complementary DNA using Moloney murine leukemia virus reverse transcriptase (M-MLV RT) according to the manufacturer's instructions. Skip the DNase treatment.

[0073] To amplify the complementary DNA for ligation into the cloning vector, a polymerase chain reaction was performed to prepare the insert using the first forward primer with the XmaI cutting region and the first reverse primer with the HindIII cutting region as attached in the sequence list. Finally, Phusion high-fidelity DNA polymerase was selected to amplify the CEL3A gene. The optimal polymerase chain reaction conditions were: initial denaturation at 95°C for 3 minutes, followed by 34 cycles of denaturation at 95°C, annealing at 55°C, and extension at 72°C, and finally a final extension at 72°C for 5 minutes.

[0074] Example 3 Obtaining protein coding genes using extracted DNA fragments by homologous recombination

[0075] For homologous recombination, a mixture of linearized plasmid and exon fragments was mixed with cells, followed by ice incubation and heat shock according to standard procedures. E. coli RR1 competent cells were used for recombination and transformation. The cloning vector in this process was the plasmid pBluescript KS(+), also known as pbs2ks+. Plasmids were prepared from 2 ml of transformed RR1 E. coli cells, cultured at 37°C for 16 hours at 220 rpm, and then extracted using the Qiagen SpinMiniprep kit according to the manufacturer's instructions. Plasmids were visualized on agarose gels after EcoRV linearization and extracted using the Qiaex II gel extraction kit.

[0076] For the exon fragments, they were prepared by polymerase chain reaction amplification of DNA. Fungal DNA was extracted using the phenol-chloroform method (after rapid freezing of 250 mg of grown cells and mechanical pulverization). Briefly, there are three exon fragments that need to be prepared to connect the CEL3A transcript gene into the plasmid pbs2ks+. The primers are attached in the sequence listing page, with EcoRV as the cutting site, and they are designed to overlap each other to create a complete CEL3A complementary DNA, i.e., a vector with the CEL3A gene.

[0077] Example 4: Expressing CEL3A gene in Escherichia coli and obtaining cell lysate

[0078] The successfully recombined plasmid (pbs2ks-CEL3A) was used for protein synthesis in BL21 E. coli. The CEL3A gene was extracted from pbs2ks-CEL3A using XbaI and HindIII. The insert was then incorporated into the pET-22b expression vector for β-glucosidase production, and the pET22b vector was prepared according to the previously mentioned procedure. The pET22b vector and the CEL3A insert were ligated using T4 DNA ligase according to the manufacturer's instructions to obtain the expression plasmid pET22b-CEL3A.

[0079] This plasmid was then transformed into BL21 cells for IPTG-induced expression. A single colony was grown in 40 ml of LB medium (1% casein peptone, 1% sodium chloride and 0.5% yeast extract) at 37°C and 200 rpm until the optical density at 600 nm reached 0.6. To induce protein expression, 0.4 mM IPTG was added at 25°C and then maintained at 210 rpm for 3 hours. The cells were collected by centrifugation at 4000 g and the supernatant was removed.

[0080] Then, the CEL3A protein was extracted from the bacterial cells using ultrasonic method. Briefly, each cell pellet was resuspended with 1 ml of cell lysis buffer (50 mM tricarboxylic acid-hydrochloride buffer, 25 mM sodium chloride, 2 mM ethylenediaminetetraacetic acid). The suspension was sonicated for 4 minutes in an ice bath, including 2 seconds on and 2 seconds off, until the suspension became clear, and then centrifuged at 12000g for 30 minutes.

[0081] Technical Effects

[0082] To validate this technology, the activity of the target CEL3A enzyme (i.e., β-glucosidase) was tested using the following method:

[0083] Three groups of cell lysates were prepared from BL21 cells accordingly. The first group was BL21 cells without any plasmid. The second group was BL21 cells without IPTG induction and with pET22b-CEL3A plasmid. The third group was BL21 cells with IPTG induction and with pET22b-CEL3A plasmid. The transformation conditions and procedures were the same as before, and then the cell lysate groups and their transformation conditions are summarized in the table below.

[0084]

[0085]

[0086] After transformation, they were incubated in three solutions, namely normal digestion solution, high cellobiose solution and high lysis solution, at 50°C for 10 minutes to verify their digestibility. The composition of the three solutions and the results of the digestibility test are detailed below.

[0087]

[0088]

[0089] From the results, the digestibility of each set of cell lysates was tested by the absorbance of each solution at 500nm and the amount of glucose in each solution. The absorbance can be defined as the amount of light absorbed by a particular solution. In other words, the higher the amount of soluble solute in the solution, the higher the value detected. And for glucose, the presence of glucose can indicate that the CEL3A enzyme converts the cellobiose in the solution into glucose. In other words, the presence of glucose indicates the presence of the CEL3A enzyme in the BL21 cells.

[0090] The relationship between absorbance and glucose concentration can be found in Figure 1 In the graph, they are positively correlated, that is, the higher the glucose concentration, the higher the absorbance index.

[0091] Regarding group one, which served as a baseline activity for comparison, no glucose was detected in all three solutions. For group two, the absorbance was higher than that of group one, indicating that there were more soluble solutes in all three solutions. In addition, the data also showed the presence of glucose, which indicates that the target enzyme still has cellobiose decomposing activity even without IPTG induction. Finally, for group three, the absorbance was the highest among the three groups, and the highest content of glucose was also detected. This indicates that under IPTG induction, the content of soluble solutes in the solution was the highest among the three groups, and the cellobiose decomposing activity of the CEL3A enzyme was also the highest. Specifically, comparing group three with group two, the content of glucose detected in all three solutions increased by 27% after IPTG induction. Therefore, this test can verify that the production of the target enzyme using our invention is successful.

[0092] The embodiments of the present invention are described above in conjunction with the accompanying drawings, but the present invention is not limited to the above-mentioned specific implementation modes, which are merely illustrative rather than restrictive. Under the guidance of the present invention, ordinary technicians in this field can also make many forms without departing from the scope of protection of the present invention and the claims, all of which are within the protection of the present invention.

Claims

1. A method for producing β-glucosidase, characterized in that: The following steps are involved: Step 1, preparing a vector having a CEL3A gene by using Trichoderma reesei; Step 2: extract the CEL3A gene from the vector having the CEL3A gene, and express the CEL3A gene using Escherichia coli BL21 cells to obtain β-glucosidase.

2. The method for producing β-glucosidase according to claim 1, characterized in that Step 1 includes: Step 1.1, extracting β-glucosidase messenger RNA of Trichoderma reesei QM9414; Step 1.2, using β-glucosidase messenger RNA for reverse transcription to obtain complementary deoxyribonucleic acid of CEL3A gene; Step 1.3, using the complementary deoxyribonucleic acid of the CEL3A gene as a template, using 5'attacccgggACCATTCTGTTGAGC 3' as the first forward primer, and using 5'cgataagcttAACCGCCTTCACCCT3' as the first reverse primer to perform polymerase chain reaction amplification, thereby obtaining a vector having the CEL3A gene.

3. The method for producing β-glucosidase according to claim 1, characterized in that: Step 1 includes: ccgggctgcaggaattcgat ATGCGTTACCGAACAGCAGC was used as the second forward primer; CCGAGGCCCCCGATGTTGAG TGACTGTCTGCCCTAGCAAA was used as the second reverse primer; TTTGCTAGGGCAGACAGTCA CTCAACATCGGGGGCCTCGG was used as the third forward primer; GTAGTTGAACTTGGTGTAAG ACAGTCCATAGCCGAACTCG was used as the third reverse primer; CGAGTTCGGCTATGGACTGT CTTACACCAAGTTCAACTAC was used as the fourth forward primer; acggtatcgataagcttgat CTACGCTACCGACAGAGTGC was used as the fourth reverse primer; By using homologous recombination, the pbs2ks+ plasmid is connected to the first exon using the second forward primer, the first exon is connected to the second exon using the second reverse primer, the first exon is connected to the second exon using the third forward primer, the second exon is connected to the third exon using the third reverse primer, the second exon is connected to the third exon using the fourth forward primer, and the third exon is connected to the pbs2ks+ plasmid using the fourth reverse primer to obtain a vector having the CEL3A gene.

4. The method for producing β-glucosidase according to claim 1, characterized in that: The CEL3A gene was extracted from the pbs2ks+ plasmid using XbaI and HindIII enzymes.

5. The method for producing β-glucosidase according to claim 1, characterized in that: The expression of the CEL3A gene by using E. coli BL21 cells is achieved by inserting the CEL3A gene into an expression vector compatible with the E. coli BL21 cells.

6. The method for producing β-glucosidase according to claim 5, characterized in that: The expression vector compatible with E. coli BL21 cells is the pET-22b expression vector.

7. The method for producing β-glucosidase according to claim 6, characterized in that: Step 2 includes: Step 2.1, inserting the CEL3A gene into the pET-22b expression vector using T4 DNA ligase to obtain the pET22b-CEL3A expression vector; Step 2.2, transform the pET22b-CEL3A expression vector into Escherichia coli BL21 cells, and then induce with isopropyl β-D-thiogalactoside to trigger the transcription cascade reaction and induce the expression of β-glucosidase.

8. The method for producing β-glucosidase according to claim 7, characterized in that: In step 2.2, an E. coli colony consisting of E. coli BL21 cells carrying the pET22b-CEL3A expression vector is cultured in LB medium, and when the optical density at a wavelength of 600 nm reaches 0.6, isopropyl β-D-thiogalactoside is added to induce β-glucosidase expression.

9. The method for producing β-glucosidase according to claim 8, characterized in that: LB medium included 1 wt% casein peptone, 1 wt% sodium chloride, and 0.5 wt% yeast extract.

10. A use of β-glucosidase, characterized in that: Used to break down cellulose.

Images