SiRNA for targeted inhibition of chicken PLCD4 gene expression and application thereof

Abstract

The invention belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken PLCD4 gene expression and application thereof. The siRNA comprises PLCD4-853, PLCD4-528 and PLCD4-1870, and the siRNA comprises PLCD4-853, the siRNA can inhibit the expression of the chicken PLCD4 gene in a targeted manner, after the siRNA is transferred into chicken primary subcutaneous fat cells, the expression of the chicken PLCD4 gene can be effectively reduced, the inhibition efficiency reaches 50% or above, and the knock-down efficiency is very high; the siRNA identifies the gene function by specifically knocking down the expression of the chicken PLCD4 gene in vitro, can be used as a molecular marker to be applied to genetic breeding of subcutaneous fat deposition of high-quality broilers, and has great economic value and scientific research value.

Description

Technical Field

[0001] The present invention belongs to the technical field of poultry breeding, and in particular relates to an siRNA for targeted inhibition of chicken PLCD4 gene expression and an application thereof. Background Art

[0002] The PLCD4 gene, or phospholipase C delta 4, is a key member of the phospholipase C (PLC) delta family. As a key enzyme, PLCs play a crucial role in cell signaling. PLCD4 hydrolyzes phosphatidylinositol-4,5-bisphosphate (PIP2) to produce second messenger molecules, which further regulate various intracellular physiological processes. Studies have shown that PLCD4 may influence the proliferation and differentiation of animal myoblasts by regulating signaling pathways within myoblasts. In poultry, little research has been conducted on the PLCD4 gene, and there are no reports of knocking down PLCD4 gene expression in chickens using siRNA. Therefore, knocking down PLCD4 gene expression using siRNA to determine the role of PLCD4 in subcutaneous fat deposition in chickens could serve as a molecular marker for molecular genetic selection of high-quality broiler chickens for subcutaneous fat deposition, shortening the generation interval and accelerating breeding progress. Summary of the Invention

[0003] The purpose of the present invention is to solve the deficiencies in the prior art and provide a siRNA that targets and inhibits the expression of the chicken PLCD4 gene and its application. After being transferred into primary chicken subcutaneous adipocytes, the expression of the chicken PLCD4 gene can be effectively reduced with an inhibition efficiency of more than 50%, and the knockdown efficiency is very high.

[0004] In order to achieve the above object, the present invention is achieved through the following technical solutions:

[0005] In a first aspect, the present invention provides a siRNA that targets and inhibits the expression of the chicken PLCD4 gene, wherein the siRNA includes PLCD4-853, PLCD4-528, and PLCD4-1870.

[0006] The sequence of the PLCD4-853 sense strand is GGGAGGAACGGAGAGAUAATT, and the sequence of the antisense strand is UUAUCUCUCCGUUCCUCCCTT, with a TT base overhang added to each siRNA sequence;

[0007] The sequence of the PLCD4-528 sense strand is TTCCAGAAAGCTGACAAGAATAATT, and the sequence of the antisense strand is CCAGAAAGCUGACAAGAAUAATT, with a TT base overhang added to each siRNA sequence;

[0008] The sequence of the PLCD4-1870 sense strand is TGCTTAAACCAGCCTTCATGAGGTT, and the sequence of the antisense strand is CUUAAACCAGCCUUCAUGAGGTT, and each siRNA sequence is suffixed with a TT base overhang.

[0009] In a second aspect, the present invention provides the application of the siRNA targeting the inhibition of chicken PLCD4 gene expression in the genetic breeding of chicken subcutaneous fat deposition.

[0010] Preferably, siRNA for chicken PLCD4 gene expression is designed, and the siRNA is transfected into chicken primary subcutaneous adipocytes, and the chicken PLCD4 gene expression is specifically knocked down by the siRNA.

[0011] Preferably, the designed siRNA expressing chicken PLCD4 is diluted with 125ul of DEPC water per 1OD of siRNA to a final concentration of 20uM / ul, and stored at -20°C until use.

[0012] Preferably, the siRNA is transfected into primary chicken subcutaneous adipocytes, specifically in the following steps:

[0013] Primary chicken subcutaneous adipocytes isolated from subcutaneous adipose tissue of 21-day-old chickens were used as transfected cells. The isolated and extracted primary chicken subcutaneous adipocytes were inoculated into 12-well culture plates. When the cell density grew to 60-70%, the original culture medium in the culture dish was aspirated and replaced with fresh serum-free culture medium. siRNA targeting the chicken PLCD4 gene was transfected into the primary chicken subcutaneous adipocytes using the transfection reagent Lipofectamine 3000.

[0014] The specific transfection system is as follows: 175uLopti-MEM medium + 5ul siRNA with a final concentration of 20uM + 8ul Hiperfect transfection; incubate for 10 minutes to form a transfection complex, which is then transfected into the culture medium.

[0015] The present invention has the following beneficial effects: providing an siRNA capable of targetedly inhibiting the expression of the chicken PLCD4 gene. When introduced into primary chicken subcutaneous adipocytes, the siRNA effectively reduces the expression of the chicken PLCD4 gene, achieving an inhibition efficiency exceeding 50%, a high knockdown efficiency. The siRNA of the present invention identifies gene function by specifically knocking down the expression of the chicken PLCD4 gene in vitro. The siRNA can be used as a molecular marker in the genetic selection of high-quality broiler chickens for subcutaneous fat deposition, and can provide reference data for research on metabolic diseases caused by obesity in humans. The siRNA has significant economic and scientific value. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1Figure 2 is the expression of PLCD4 in subcutaneous adipose tissue of different chicken strains (different letters indicate significant differences (P < 0.05), the same letters indicate no significant differences (P > 0.05); ** indicates significant differences (P < 0.01)); S3, H, and F analyses represent S3, H, and F chicken strains;

[0017] Figure 2 is the expression of PLCD4 in subcutaneous adipocytes (different letters indicate significant differences (P < 0.05));

[0018] Figure 3 The expression changes of PLCD4 gene after exogenous transfection of PLCD4 siRNA (different letters represent significant differences (P < 0.05), and the same letters represent no significant differences (P > 0.05));

[0019] Figure 4 The changes in subcutaneous adipocyte proliferation after exogenous transfection of PLCD4 siRNA (* indicates significant difference (P < 0.05));

[0020] Figure 5 The changes in lipid droplet deposition in subcutaneous adipocytes after exogenous transfection of PLCD4 siRNA. DETAILED DESCRIPTION

[0021] The present invention is further described and defined by the following examples, but is not limited thereto. The experimental methods in the following examples are conventional methods unless otherwise specified. The present invention is further described below with reference to the accompanying drawings.

[0022] Example 1 Detection of PLCD4 gene expression in chicken subcutaneous adipose tissue and subcutaneous adipocytes by fluorescence quantitative PCR

[0023] 1.1 Expression of PLCD4 in subcutaneous adipose tissue

[0024] The expression of PLCD4 in the subcutaneous fat tissue of recessive white chickens and sex-linked dwarf chickens S3 at different developmental stages was detected by QPCR. Figure 1 As shown in the results, there are significant breed and developmental differences in the expression of PLCD4 in subcutaneous adipose tissue of different strains at different developmental stages, indicating that PLCD4 is involved in the process of subcutaneous fat deposition in chickens.

[0025] 1.2 Expression of PLCD4 in adipocytes

[0026] The expression of PLCD4 in subcutaneous adipocytes during proliferation and differentiation was detected using QPCR technology. Figure 2As shown, PLCD4 expression was higher in the proliferation phase of subcutaneous adipocytes than in the differentiation phase. The highest expression level was in the 50% proliferation phase, significantly higher than in all differentiation phases (P < 0.01). There was no significant difference between the 50% proliferation phase and the 100% proliferation phase (P > 0.05). This preliminarily suggests that PLCD4 may have a role in inhibiting subcutaneous fat deposition in chickens.

[0027] Case 2 Screening of the best siRNA sequence targeting the chicken PLCD4 gene

[0028] 2.1 PLCD4 siRNA Design

[0029] The chicken PLCD4 gene mRNA sequence was obtained from the NCBI online database (accession number: XM_040676606.2). Using siCatch™ siRNA design software, three pairs of siRNAs targeting the CDS region of the chicken PLCD4 gene were designed. Each siRNA sequence was suffixed with a TT overhang. The designed siRNAs were synthesized by Suzhou Gene Biotechnology Co., Ltd. After synthesis, 125 μL of DEPC water was added to each OD of siRNA to dilute it to a final concentration of 20 μM / μL and store it at -20°C until use. The sequences of the three designed siRNA pairs are shown in Table 1.

[0030] Table 1 Three pairs of siRNA sequences

[0031]

[0032]

[0033] 2.2siRNA transfection of primary chicken subcutaneous adipocytes

[0034] Subcutaneous adipocytes (SCs) isolated from subcutaneous adipose tissue of 21-day-old chickens were used as transfected cells. These primary SCs were seeded into 12-well culture plates. When the cells reached a density of 60-70%, the culture medium was aspirated and replaced with fresh serum-free medium. Three pairs of siRNAs targeting the chicken PLCD4 gene and a negative control siRNA (NC) were then transfected into the SCs using the transfection reagent Lipofectamine 3000. Three replicate wells were set up for each group.

[0035] The specific transfection system is as follows: experimental group: 175uL opti-MEM medium + 5ul final concentration of 20uM siRNA + 8ul Hiperfect transfection; control group: 175uL opti-MEM medium + 5ul final concentration of 20uM Negative + 8ul Hiperfect transfection, incubate for 10 minutes to form a transfection complex, and transfect into the culture medium.

[0036] 2.3 RNA extraction and cDNA preparation

[0037] 24 hours after transfection, each well was washed three times with PBS. 0.6 ml of TROZL was added to the culture dish to collect the cells. Total RNA was extracted from the PLCD4 siRNA-transfected and control groups using the RNA isolater Total RNA Extraction Reagent kit (Nanjing Novozymes Biotechnology Co., Ltd.). RNA concentration was measured using a nucleic acid quantifier. cDNA synthesis was performed according to the instructions for the reverse transcription kit (Dalian Takara Biotechnology Co., Ltd.).

[0038] 2.4 Real-time fluorescence quantitative PCR detection of siRNA interference efficiency

[0039] Real-time quantitative PCR (qPCR) was performed using SYBR Green I using Hi Script III RT Super Mix for qPCR (with g DNA wiper) from Nanjing Novozymes Biotech Co., Ltd. The efficiency of siRNA-specific knockdown of chicken PLCD4 gene expression was determined using three replicates per sample. The Q-PCR reaction protocol was as follows: 95°C for 15 minutes followed by 40 cycles (94°C for 15 seconds, 55°C for 30 seconds, and 70°C for 30 seconds).

[0040] Upstream primer (SEQ ID NO: 7): 5'-TGCCAATTCCATCAATCCTGT-3'

[0041] Downstream primer (SEQ ID NO: 8): 5'-ATAGCCTGAGTGTACTGCAA -3'

[0042] 2.5 The primer pair nucleic acid sequences for detecting chicken internal reference GAPDH gene expression are as follows:

[0043] Upstream primer (SEQ ID NO: 9): 5'-AGAAGGCTGGGGCTCATCT-3'

[0044] Downstream primer (SEQ ID NO: 10): 5'-CAATGCCAAAGTTGTCATG-3'

[0045] The efficiency of 3 pairs of siRNA in specifically knocking down chicken PLCD4 gene expression is as follows Figure 3 As shown. Figure 3 Of the three siRNA pairs, PLCD4-853 siRNA significantly inhibited PLCD4 gene expression in cells compared to the control group (P < 0.05), achieving the highest inhibition efficiency of over 50%. PLCD4-853 was selected for subsequent experiments to investigate the function of the PLCD4 gene in subcutaneous fat deposition in chickens. The sense strand of PLCD4-853 is GGGAGGAACGGAGAGAUAATT, and the antisense strand is UUAUCUCUCCGUUCCUCCCTT.

[0046] Effects of 2.6PLCD4 gene knockdown on cell proliferation and differentiation-related gene expression

[0047] After 24h and 72h of PLCD4-853 siRNA transfection, the changes in cell proliferation were detected using CCK8 kit. Figure 4 As shown in Figure 2, after transfection with PLCD4-853 siRNA, the proliferation of primary chicken subcutaneous adipocytes was significantly increased (P<0.05). Oil red O staining 4 days after transfection showed that the deposition of lipid droplets in adipocytes was significantly lower than that in the control group (P<0.01). Figure 5 Experiments have shown that the PLCD4 gene can promote the proliferation of chicken subcutaneous fat cells and inhibit fat deposition in subcutaneous fat cells.

[0048] The above description is only a preferred embodiment of the present invention, but is not intended to limit the present invention. Those skilled in the art can use the technical content disclosed above to make possible changes and modifications to the present invention without departing from the scope of the technical solution of the present invention, or modify it into an equivalent embodiment with equivalent changes. Without departing from the content of the technical solution of the present invention, any simple modification, equivalent change and modification made to the above embodiment based on the technical essence of the present invention shall fall within the protection scope of the technical solution of the present invention.

Claims

1. A siRNA targeting and inhibiting the expression of chicken PLCD4 gene, characterized in that: The siRNAs include PLCD4-853, PLCD4-528, and PLCD4-1870. The sequence of the PLCD4-853 sense strand is GGGAGGAACGGAGAGAUAATT, and the sequence of the antisense strand is UUAUCUCUCCGUUCCUCCCTT, and each siRNA sequence is suffixed with a TT base overhang; The sequence of the PLCD4-528 sense strand is TTCCAGAAAGCTGACAAGAATAATT, and the sequence of the antisense strand is CCAGAAAGCUGACAAGAAUAATT, and each siRNA sequence is suffixed with a TT base overhang; The sequence of the PLCD4-1870 positive strand is TGCTTAAACCAGCCTTCATGAGGTT, and the sequence of the antisense strand is CUUAAACCAGCCUUCAUGAGGTT, and each siRNA sequence is suffixed with a TT base overhang.

2. Use of the siRNA targeting and inhibiting the expression of the chicken PLCD4 gene according to claim 1 in the genetic breeding of subcutaneous fat deposition in chickens.

3. The use according to claim 2, characterized in that: The application is specifically as follows: designing siRNA for chicken PLCD4 gene expression, transfecting the siRNA into chicken primary subcutaneous adipocytes, and using the siRNA to specifically knock down chicken PLCD4 gene expression.

4. The use according to claim 3, characterized in that: The designed siRNA expressing chicken PLCD4 was diluted with 125ul of DEPC water per 1OD of siRNA to a final concentration of 20uM / ul and stored at -20°C until use.

5. The use according to claim 3, characterized in that: The siRNA is transfected into primary chicken subcutaneous adipocytes, and the specific steps are as follows: Primary chicken subcutaneous adipocytes isolated and extracted from subcutaneous fat tissue of 21-day-old chickens were used as transfected cells. The isolated and extracted primary chicken subcutaneous adipocytes were inoculated into a 12-well culture plate. When the cell density grew to 60-70%, the original culture medium in the culture dish was aspirated and replaced with fresh serum-free culture medium. The siRNA targeting the chicken PLCD4 gene was transfected into the primary chicken subcutaneous adipocytes with the help of the transfection reagent Lipofectamine 3000. The specific transfection system is as follows: 175uLopti-MEM culture medium + 5ul siRNA with a final concentration of 20uM + 8ul Hiperfect transfection; incubate for 10 minutes to form a transfection complex, and transfect into the culture medium.

Images