The Or-43884 gene of Coptotermes formosanus and its application in termite control

By targeting the Or-43884 gene in white ants to disrupt odor recognition, the method effectively interferes with their nest cleaning behavior, improving the effectiveness of chemical treatments within the ant colony.

CN119842724BActive Publication Date: 2025-07-15ZHEJIANG FORESTRY UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510347479.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-24
Publication Date
2025-07-15
Estimated Expiration
2045-03-24

AI Technical Summary

Technical Problem

The prior art is difficult to effectively interfere with the sense of smell of termites, resulting in the hindrance of drugs in termite nests, reducing prevention and control efficiency. The cleaning behavior of termites enhances herd immunity and hinders the spread of drugs in nests.

Method used

By interfering with the expression of the Or-43884 gene and its co-receptor Orco gene of Taiwan's milk termite, the olfactory sensitivity of termites to stimulating odor molecules is reduced, and its cleaning behavior is interfered with chemical control agents.

Benefits of technology

Effectively interfere with the olfactory recognition process of termites, inhibit their cleaning behavior, enhance the diffusion effect of drugs in the nest population, and improve prevention and treatment efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119842724B_ABST
    Figure CN119842724B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical field of insect genetic engineering, and particularly relates to the Or‑43884 gene of Coptotermes formosanus and its application in termite control. The Or‑43884 nucleotide sequence of the gene is shown in SEQ ID NO.1. The present invention discovers an odorant receptor protein gene of Coptotermes formosanus Or‑43884 gene. Through its expression in Xenopus laevis oocytes and molecular docking analysis of the Or-43884 protein, it is found that Or‑43884 the gene and its expression product are key odorant receptor genes for Coptotermes formosanus to recognize odor substances to trigger the nest cleaning behavior. Or‑43884 This function of the gene can be combined with the control methods of applying drugs and pathogenic microorganisms against termites, providing a new approach for termite control work.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of insect genetic engineering technology, specifically relating to the Formosan subterranean termite. Or-43884 Genes and their application in termite control. Background Technology

[0002] Termites are insect colonies that primarily feed on wood. Due to their specific diet, these insects can cause severe damage to human-made wooden structures (cultural relics, ancient buildings, wooden furniture, etc.). Therefore, in the fields of housing construction and cultural relic protection, termites are a very serious pest, requiring significant annual expenditures for their control. Termites are social insects with fixed nests. Controlling only the worker termites active outside the nest is insufficient to completely eradicate all individuals hidden underground or in wooden structures. Therefore, current integrated termite control efforts utilize chronic-acting pesticides, slow-release pesticides, or pathogenic microorganisms to target individual termites within the nest.

[0003] However, as social insects, termites exhibit behaviors such as cleaning each other's bodies of foreign objects and quickly removing or burying dead individuals within the nest. These behaviors, known as termite cleaning, help termites resist the harmful effects of external toxic compounds or microorganisms on the colony. Termites often live in high densities within unified colonies, a lifestyle that increases the risk of disease or toxic substance transmission within the colony, thus enhancing the selective pressure on individual and colony-level immunity at the evolutionary level. Therefore, over long-term evolution, termite colonies have developed social behaviors primarily based on cleaning to prevent the rapid spread of harmful substances within the colony. These behaviors include self-isolation of infected worker ants, removal of dead individuals (corpse cleaning), and colony cleaning. It is evident that these social behaviors can, to some extent, block the further spread of termite control drugs within the colony, reducing control efficiency. Therefore, targeted and comprehensive control measures are needed. Current research indicates that termite cleaning within the colony is a behavior manipulated by olfactory responses, influenced by the pungent odors of volatile compounds, fatty acid compounds, or some toxic compounds released from decaying corpses. Therefore, the detection mechanism of such warning compounds is crucial for maintaining the health of termite colonies, and research on the mechanism of their perception process is of great significance for further understanding the environmental adaptability of such social insects.

[0004] The olfactory information processing in insects is handled by olfactory receptor neurons (ORNs), the olfactory bulb, and projection neurons connected to the mushroom body in the brain. Among these neuronal components, olfactory receptors (ORs) located on the dendritic membrane of ORNs recognize olfactory signals and conditionally modulate the opening and closing of ligand-gated ion channels, thereby generating action potentials and triggering behavior. Olfactory receptors can detect volatile chemicals, including esters, alcohols, and phenolic compounds, thus inducing behavior. Smell is an important sensory mode in termites, which possess 50 to 60 types of olfactory receptors, forming an ORx / ORco (olfactory receptor co-receptor) tetramer complex. The Orco unit controls the opening and closing of ion channels, while the ORx unit controls the recognition of gas molecules. Studies have shown that odorant receptor recognition units can sense volatile compounds such as β-pinene in the colony, triggering colony cleaning behavior in worker ants. Therefore, if the termites' sense of smell can be interfered with, their behavior of cleaning the colony can be further disrupted. Combined with the use of drugs or pathogenic microorganisms targeting termites, green control of termites can be achieved. Summary of the Invention

[0005] In response to the existing need for products or methods that interfere with the olfactory senses of termites, this invention provides Formosan subterranean termite. Or-43884 The specific technical solutions for the study of genes and their application in termite control are as follows:

[0006] In a first aspect, the present invention provides Formosan subterranean termite. Or-43884 The gene, with its nucleotide sequence as shown in SEQ ID NO.1.

[0007] Secondly, the present invention provides the Or-43884 protein of the Formosan subterranean termite, the amino acid sequence of which is shown in SEQ ID NO.2.

[0008] Thirdly, the present invention provides a recombinant vector containing Formosan subterranean termites. Or- 43884 Genes, the Formosan subterranean termite Or-43884 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] Fourthly, the present invention provides a genetically engineered bacterium containing Formosan subterranean termites. Or- 43884 Genes, the Formosan subterranean termite Or-43884 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0010] Fifthly, the present invention provides the above-mentioned Or-43884 The application of genes, or the aforementioned recombinant vectors, or the aforementioned genetically engineered bacteria in the preparation of termite control products.

[0011] Furthermore, the present invention also provides a combinatorial gene, which includes Or-43884 Genes and their co-receptors Orco Genes, and the application of said gene combinations in termite control.

[0012] In this invention, the African clawed frog (Xenopus laevis) Xenopus laevis In vitro expression of oocytes Or-43884 Genes and their co-receptors Orco Genes, combined with bipolar voltage patch-clamp technology, have proven Or-43884 The gene's ability to recognize odor substances; through the recognition of odor substances. Or-43884 Interfering with gene expression revealed Or-43884 The absence of genes leads to the death of Formosan subterranean termites (Taiwan subterranean termites). Coptotermes formosanus The antennal potential response to β-pinene and fatty acid odor substances decreases, while β-pinene and fatty acid compounds are enriched in various tissues of termites. Changes in the content of these compounds in the termite body can help termites determine the physiological state of other individuals in the colony, which proves... Or-43884 The role of genes in the olfactory recognition of odor substances has also been confirmed. Or-43884 The gene is one of the key odor receptor genes regulating the nest-cleaning behavior of Formosan subterranean termites, therefore Or- 43884 The gene and the Or-43884 protein can be used as targets in the design and screening of olfactory and behavioral regulators in Formosan subterranean termites, and furthermore... Or-43884 The gene and the Or-43884 protein can be used as targets for termite control.

[0013] In the control of termites, odor receptors from Formosan subterranean termites can be targeted. Or-43884 The gene is interfered with, affecting its odor recognition and downstream ion channel switching functions, thus hindering its odor recognition process and assisting the use of other chemical control agents to achieve the effect of controlling termites.

[0014] Furthermore, the application is carried out by silencing or knocking down termites. Or-43884 Genes that reduce termites' olfactory sensitivity to irritating odor molecules, thus interfering with their cleaning behavior.

[0015] Furthermore, the pungent odor molecules include β-pinene and fatty acid compounds.

[0016] Furthermore, the irritating odor molecules are volatile compounds that can trigger cleaning behavior in termites.

[0017] Furthermore, the termite mentioned is the Formosan subterranean termite.

[0018] Sixthly, the present invention provides the aforementioned Formosan subterranean termite.Or-43884 The dsRNA of the gene, the nucleotide sequence of which is shown in SEQ ID NO.5.

[0019] Seventhly, the present invention provides Formosan subterranean termite. Or-43884 Application of dsRNA of genes in the preparation of termite control products.

[0020] Eighthly, the present invention provides a method for controlling termites, comprising: using Formosan subterranean termites... Or-43884 The dsRNA of the gene is introduced into termites, reducing the termites' olfactory sensitivity to stimulating odor molecules and interfering with their cleaning behavior.

[0021] Furthermore, the importation methods include:

[0022] (1) Formosan subterranean termites Or-43884 The dsRNA of the gene was injected into termites;

[0023] Or, (2) feed the termites with Formosan subterranean termites. Or-43884 dsRNA of genes.

[0024] Furthermore, the injection is an oral injection.

[0025] Furthermore, the termite is *Tetracentron formosanus*.

[0026] In a ninth aspect, the present invention provides the application of the above-mentioned Or-43884 protein in recognizing odor compounds, wherein the odor compounds are one or more of α-pinene, β-pinene, oleic acid, linoleic acid, cycloeicosane, and American cockroach alcohol (InChI key: LVSITINFLJGFCE-QPUJVOFHSA-N), Germacren A (InChI key: XMRKUJJDDKYUHV-SJRHNVSNSA-N), and Supellapyrone (InChI key: MXIKDHHQNDZAAJ-VXGBXAGGSA-N) purified from insect tissues.

[0027] Furthermore, the present invention also provides a complex of the Or-43884 protein and its co-receptor Orco protein, and the application of said complex in recognizing odor compounds.

[0028] In this application, it was discovered that the Or-43884 protein has the function of recognizing a variety of odor compounds. This application firstly... Or-43884 Genes and their co-receptors OrcoGene expression was performed in Xenopus laevis oocytes. Using bipolar voltage patch-clamp technology, the oocytes were found to acquire the ability to bind to α-pinene and β-pinene, as well as long-chain unsaturated fatty acids C18:1 and C18:2. Molecular docking analysis of the Or-43884 protein revealed that the unsaturated fatty acid C18:1 exhibited the strongest binding affinity to Or-43884. Other compounds, including cycloeicosane, periplanolide, germaxren A, and supellapyrone, also showed strong binding affinity to Or-43884. Furthermore, this application was conducted in vivo... Or-43884 The antennal potential response of gene-silenced Formosan subterranean termites to unsaturated fatty acid C18:1 was significantly lower than that of wild-type Formosan subterranean termites, which also proves the recognition function of Or-43884 protein for odor compounds. This recognition function of Or-43884 protein makes it applicable to compound detection, or to the preparation of products that can detect or treat olfactory diseases, or to the trapping and detection of pests.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] This invention discovered an odor receptor protein gene in Formosan subterranean termites. Or-43884 The gene, through expression analysis in Xenopus laevis oocytes and molecular docking analysis with the Or-43884 protein, revealed... Or-43884 The gene and its expression product are key odor receptor genes in the process by which Formosan subterranean termites recognize odor substances to trigger colony cleaning behavior. Or-43884 This gene function can be combined with the application of drugs and control methods targeting termites and pathogenic microorganisms, providing a new approach to termite control. Attached Figure Description

[0031] Figure 1 The images show representative potential response curves of membrane current recorded by dual-electrode voltage clamping of Xenopus laevis oocytes. A and B represent Xenopus laevis oocytes expressing the Or-43884 protein, while C and D represent untreated oocytes. A and C represent the electrophysiological responses of oocytes to α-pinene, β-pinene, linoleic acid, and oleic acid, while B and D represent the electrophysiological responses of oocytes to linolenic acid, leaf alcohol, geraniol, and DEET.

[0032] Figure 2 A statistical graph showing the mean values ​​of the maximum chemically induced currents produced by Xenopus laevis oocytes expressing the Or-43884 protein in response to different substances.

[0033] Figure 3 Statistical plot of mean maximum membrane current induced by oleic acid in Xenopus laevis oocytes expressing Or-43884 protein.

[0034] Figure 4 For the inside of the Formosan subterranean termite Or-43884 Schematic diagram of gene interference efficiency, ds GFP This serves as the negative control group.

[0035] Figure 5 This diagram illustrates the antennal potential response of Formosan subterranean termites to different types of fatty acids and their derivatives. A represents the potential response of wild-type Formosan subterranean termites, B represents the numerical value of the antennal potential response of wild-type Formosan subterranean termites, paraffin oil serves as a negative control, and phenol and indole serve as positive controls. The fatty acids and their derivatives include lauric acid (C12:0), myristic acid (C14:0), palmitic acid (C16:0), palmitic acid (C16:1), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), and linolenic acid (C18:3).

[0036] Figure 6 for Or-43884 A schematic diagram showing the antennal potential response of the Formosan subterranean termite whose gene is repressed by double-stranded RNA to different types of fatty acids and their derivatives; where A represents... Or-43884 Antennae potential response of *Tegus spp.* whose genes were suppressed by double-stranded RNA; B represents RNA interference. Or-43884 The antennal potential response values ​​of Formosan subterranean termites after gene sequencing were measured, with paraffin oil as a negative control and phenol and indole as positive controls. Fatty acids and their derivatives included lauric acid (C12:0), myristic acid (C14:0), palmitic acid (C16:0), palmitic acid (C16:1), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), and linolenic acid (C18:3).

[0037] Figure 7 This is a diagram of a 3D-printed device used to analyze the cleaning behavior of Formosan subterranean termites (Taiwanese termites). Termite carcasses are placed inside eight holes on a disc in the device, allowing the termites to cover the carcasses inside the holes with soil or move the carcasses around.

[0038] Figure 8 for Or-43884 A comparative diagram showing the colony-cleaning behavior of termites after gene interference; where Control represents the control group of termites, and ds Or-43884 express Or-43884 Termites whose genes have been interfered with.

[0039] Figure 9 A schematic diagram of the three-dimensional structure of the OrCo-Or-43884 complex (A) and a schematic diagram of the molecular docking prediction results of the key binding sites of the Or-43884 receptor and its ligand compound (B); where pLDDT (Predicted Local Model Decay Time) represents the prediction confidence of the protein 3D structure, and C is a diagram of the binding sites of the ligand compound and each amino acid of Or-43884.

[0040] Figure 10 The results show the molecular docking predictions for the binding affinity of the Or-43884 protein to pheromone-related chemical substances from different termite species. Detailed Implementation

[0041] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It should be noted that the following detailed descriptions are exemplary and are only some embodiments of the present invention, not all embodiments.

[0042] Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0043] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. The experimental materials used in the embodiments of this invention are all conventional experimental materials in the art and are commercially available. Experimental methods not specifying detailed conditions are performed according to conventional experimental methods or the operating instructions recommended by the supplier.

[0044] The Formosan subterranean termites used in this invention were collected from mature colonies in Ningbo, Jiaxing and Hangzhou, Zhejiang Province, China, and cultured in a dark environment at 27°C and 75% humidity using pine blocks as a food source.

[0045] Or-43884 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the Or-43884 protein is shown in SEQ ID NO.2. Orco The nucleotide sequence of the gene is shown in SEQ ID NO.3, and the amino acid sequence of the Orco protein is shown in SEQ ID NO.4.

[0046] SEQ ID NO.1:

[0047]

[0048] SEQ ID NO.2:

[0049] MVFGLLQASKNNPQEESTSKKILDLQMKCFVVGGIRPSENIRSSSRKLAAFNFYAAMTVIIYIPSLVGQAAAVYLESDDVAELTAIAFPAIAGYLHFLISSYLLLNRKPLEQIILRTEESFEECRCRLPLTREHNLIIDEAKKKIRKFSWIFMITNAVTWFLWMSLPLVFRLNHYMNKQGSWAQNITETDDKIQWDYVCYKMWLPRVIYQEPYYYFVWAYQAFLIGILLVDNTAYNSTYYALTIFTAAHFKVVANLIDDIDRYIMAPYSTNNPEQSSIWYDTKNENLLQEGKSFVKQKILKNSGFSRSGNNDDETSQLDEYRLLIPEGITAEDYLVNCIKYHQALLRYVEDVDGVFSNLLFIFFSLNGALMCITVFQATVGSGETGSFKFLGAMITVWVPIFLICWFGELLTEQSEAVERAIYACKWFNASQRFKKYVQFVIMRSQKVVRLSAGHFFAVSLEGFANMANTVYAYYTILMQAQE

[0050] SEQ ID NO.3:

[0051]

[0052] SEQ ID NO.4:

[0053] MYKFRLHGLVADMWPLIRVMQMTGFFLLDYHEDMSFGWASIRAGYATSVSCIMVIQFLLLFINLMKQAGDVNDLTANTITVLFFLHSVTKFFYFAIRRAKFYRTLATWNNANSHPLFSENQSRHHATAVSSMRRLVMYVGIGIIVSGIAWTGITFVGDSVHGIRDPDNRNETIFEEVPRLMLRSWYPWNALSGGGYVVSFIIQIIWLFLALSHAMMMDTMFCCWLIYTCEQLIHLKEIMKPLMELSASLDTVVPHSADLFRAVSATTNAPITSGDGEGIRAIYSNQHDFSNFRLNTGTLANVNSGSVGPNGLTKKQELLVRSAIKYWVERHKHVVRFVSNIGDTYGSALLLHMLTSTVTLTLLAYQATKIDTVNVYACTVIGYLVYTLAQVFLFCFFGNRLIEESSSVMEAAYSCQWYDGSEEAKTFIQIVCQQCQKAMSISGAKFFTVSLDLFASVLGAVVTYFMVLVQLN

[0054] SEQ ID NO.5:

[0055] TTGATGGCGTCTTCAGCAACCTCCTGTTCATATTCTTCTCTCTGAATGGGGCCCTCATGTGTATTACAGTGTTTCAGGCAACAGTGGGCTCTGGAGAGACGGGTTCTTTCAAATTCCTGGGCGCCATGATTACTGTTTGGGTTCCAATATTCCTTATCTGCTGGTTCGGAGAGCTTCTGACAGAGCAGAGCGAAGCCGTGGAACGAGCAATATATGCATGCAAATGGTTCAACGCTTCCCAGCGCTTCAAGAAATACGTACAGTTCGTTATCATGCGGTCTCAGAAAGTTGTGCGGCTGTCAGCAGGACACTTCTTTGCTGTATCTCTGGAAGGATTTGCTAACATGGCCAATACTGTTTACGCCTACTACACAATCCTGATGCAAGCCCAG。

[0056] Example 1 Or-43884 Cloning of genes

[0057] Or-43884 The genes were obtained through transcriptome analysis of Formosan subterranean termites.

[0058] Total RNA was extracted from Formosan subterranean termites using the TRIzol method. The RNA was then reverse transcribed into cDNA template using the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China), following the kit's instructions. Primers were designed to ligate the SpeⅠ and PstⅠ restriction sites to the Or-43884 gene.

[0059] Or-43884-F-bd (5'-GGACTAGTGCCACCTTACTCCTGGGCTTGCATCAG-3'),

[0060] Or-43884-R-bd (5'-GCTCTAGACATTGCACCCGGATTACGTTT-3').

[0061] The Or-43884 gene was amplified using reverse-transcribed cDNA as a template, and the amplification product was purified. The purified product and expression vector pT7Ts were double-digested with restriction endonucleases, ligated with T4 ligase, and transformed into *E. coli* competent cells. The reaction system is as follows:

[0062] Table 1. Reaction system for the Or-43884 gene cloning experiment

[0063]

[0064] After ligation and transformation, the cells were plated and cultured overnight. After picking bacteria and extracting DNA, they were subjected to first-generation Sanger sequencing. Plasmids were extracted from the correctly sequenced bacterial cultures according to the FastPure Plasmid Mini Kit-BOX 2 (Nanjing Novizan Biotechnology Co., Ltd.) instructions.

[0065] The open reading frame of the Or-43884 gene in the Formosan subterranean termite consists of 1452 nucleotides, encoding 483 amino acids. Or-43884 has a molecular weight of 55.75 kDa, an isoelectric point of 6.15, and an instability coefficient of 40.73.

[0066] Example 2 Or-43884 Genes' ability to recognize different odors

[0067] (1) Or-43884 In vitro gene transcription and Xenopus laevis oocyte microinjection

[0068] For injection into oocytes Or-43884 Genes and Orco The cRNA of the gene was synthesized using the SmaI-linearized pT7Ts vector and the mMACHINE T7 kit according to the manufacturer's instructions. To collect Xenopus oocytes in stages V and VI, frogs were first anesthetized with ethyl 3-aminobenzoate and then dissected. Fresh oocytes were washed three times with buffer (88 mM NaCl, 3 mM KCl, and 5 mM HEPES, pH 7.60) and then incubated for 2 hours in wash buffer containing 2 mg / mL collagenase S-1. Follicle-depleted oocytes were washed and incubated at 16°C for 24 hours in wash buffer containing 50 μg / mL gentamicin and 500 μM calcium chloride.

[0069] (2) Recording and Expression of Two-Electrode Voltage Clamp Technique Or-43884 Response of Xenopus laevis oocytes to odor substances

[0070] Healthy oocytes were selected, and 27.6 nL of each oocyte was injected. Or-43884 : ORco cRNA mixture (1:1). Oocyte currents were measured at resting potential −20 mV using a two-microelectrode voltage clamping device (OC-725D, Warner Instruments, Hamden, USA). Peak currents were limited to 0.02 A to 0.05 A. Chemicals were dissolved in DMSO to a final DMSO concentration of 0.1%. Electrophysiological recordings were analyzed using pCLAMP 6 software (Axon Instruments Inc., Foster City, USA). For each chemical, current and voltage curves were calculated by averaging the signal over a 30 ms window after transient decay to steady state (e.g., ...). Figure 1 (As shown). Two-electrode voltage-clamp recordings showed that untreated control Xenopus oocytes did not respond to any of the tested compounds, while Xenopus oocytes injected with the Or-43884 gene and its co-receptor Orco gene produced electrophysiological responses to α-pinene and β-pinene (termite alarm pheromones) and long-chain unsaturated fatty acids C18:1 (oleic acid) and C18:2 (linoleic acid), with response values ​​of approximately 20–30 nA (e.g., ...). Figure 2 (As shown). Subsequently, the response changes of Xenopus laevis oocytes co-expressing the Or-43884 / ORco gene to different concentrations of odor substances were tested. 10 -5 Long-chain unsaturated fatty acids at M concentrations can induce co-expression. Or-43884 / ORcoElectrophysiological responses of Xenopus laevis oocytes to the gene, with response values ​​increasing with increasing concentration (e.g.) Figure 3 (As shown).

[0071] Example 3: Determining the odor recognition function of the Or-43884 gene using gene interference (RNAi) and antennal potential techniques.

[0072] (1) Or-43884 Gene interference

[0073] Design forward and reverse primers containing the T7 RNA polymerase promoter using the NCBI website (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ):

[0074] Or-43884-F (5'-TAATACGACTCACTATAGGGCTGGGCTTGCATCAGGATTG-3'),

[0075] Or-43884-R (5'-TAATACGACTCACTATAGGGTTGATGGCGTCTTCAGCAAC-3').

[0076] by Or-43884 The PCR fragment amplified within the gene's open reading frame was used as a template for amplification and synthesis using the T7 High Yield Transcription Kit (Vazyme, China). Or-43884 Double-stranded RNA (dsRNA).

[0077] Double-stranded RNA (dsGFP) of the jellyfish green fluorescent protein gene was selected as a control. RNAi treatment was performed via oral injection. Termites anesthetized with ice were placed upside down on the surface and injected with approximately 200 ng of dsRNA. RNAi-treated termites were collected at 24 h, 48 h, and 72 h post-treatment.

[0078] (2) After genetic interference was performed on individual Formosan subterranean termites, their internal structures were tested. Or-43884 The expression status was analyzed, and the results showed that the average gene expression inhibition rate in the interference group of termites reached 53.3% (N = 6, e.g., ...). Figure 4 As shown in the figure, it can be concluded that the orally injected double-stranded RNA sequence successfully inhibited [the virus / organization]. Or-43884 Expression levels within the antennae of the Formosan subterranean termite.

[0079] (3) Or-43884 Changes in antennal potential response of Formosan subterranean termites before and after gene silencing

[0080] For feeding Or-43884Antennae potential (EAG) analysis of *Tegus formosanus* with dsRNA gene was performed using the Syntech EAG 2000 program. The heads of worker ants were removed on ice, and the tip of one antenna was inserted into a glass capillary electrode filled with 0.7% NaCl solution. The antenna was positioned between two electrodes, centered on the main airflow for stimulation. To measure the EAG response of the antennae, a piece of filter paper (3.5 × 1.5 cm, Whatman) was rinsed with the test chemical (10% v / v dissolved in paraffin oil) and used as an odor stimulus. Each EAG response was tested three times, and the depolarization peak height for each chemical was recorded in millivolts. Worker ants treated with dsGFP and paraffin oil served as a control group.

[0081] Antennae potential results indicate that Or-43884 Gene-silenced Formosan subterranean termites showed significantly lower antennal potential responses to unsaturated fatty acid C18:1 than wild-type Formosan subterranean termites and GFP gene-silenced Formosan subterranean termites (e.g., Figure 5 and Figure 6 (As shown).

[0082] (4) Verification using RNAi technology to process worker ants Or-43884 Do genes play a regulatory role in nest clearing?

[0083] Termite colony cleaning behavior was measured in a 3D-printed device with eight 5mm holes (e.g., Figure 7 (As shown). The bottom of these holes was filled with five layers of cotton yarn to maintain humidity. A dead termite was placed in each hole, and then 200 seemingly healthy worker termites were transferred into the device and allowed to remain inside for 24 hours. The soil accumulated on the cotton yarn was then carefully collected and weighed. The degree of termite colony cleaning behavior was assessed by the weight of the soil inside the holes. A large amount of soil inside the hole indicated that the termite colony was moving a significant amount of soil into the hole, suggesting strong cleaning behavior. Conversely, a small amount of soil indicated weak cleaning behavior.

[0084] The results are as follows Figure 8 As shown, Or-43884 In the group treated with genetically modified Formosan subterranean termites, the weight of the soil inside the cavities of the apparatus was significantly lower than that in the control group. Or-43884 Defects in gene function have suppressed termite colony cleaning behavior.

[0085] Example 4: Protein Modeling and Molecular Docking Analysis

[0086] A 3D protein model of Or-43884 was generated using AlphaFold2 ColabFold v1.5.276 (https: / / github.com / sokrypton / ColabFold). Molecular docking experiments were performed using Autodock Vina tools (ADT) 1.5.6 and PyMOL v2.5. 3D models of the chemical ligands were downloaded from the PubChem database or generated using MolView (https: / / molview.org / ). Prior to docking, all chemical ligands were subjected to energy minimization using molecular mechanics (MM2) methods, and the Or-43884 protein was optimized by removing potential water molecules from the PyMOL software. Molecular docking was performed after adding all hydrogen atoms and Kollman and Gasteiger charges to the Or-43884 protein. The binding geometry of the Or-43884 protein and selected chemical ligands was visualized using PyMOL (e.g., ...). Figure 9 (As shown).

[0087] Molecular docking results showed that, among all the compounds tested, the unsaturated fatty acid C18:1 exhibited a strong binding affinity (-7.00 kcal / mol) for the Or-43884 protein; compared to other long-chain alkanes, cycloeicosane was the most active ligand molecule for CforOR2 (-8.4 kcal / mol). Pheromones attractive to cockroaches, such as Periplanolide, Germacren A, and Supellapyrone, also showed strong binding affinity (<-7.0 kcal / mol) for the Or-43884 protein. Figure 10 (As shown). The 3D structure of the protein indicates that Or-43884 is a protein with 7 α-helices. Gas compounds can bind to Or-43884 in its interhelical regions, where amino acids Asn-232 and Asn-367 are the major binding sites for the ligands (e.g., ...). Figure 9 (As shown).

Claims

1. Taiwanese Coptotermes formosanus gene Or-43884 , characterized in that The said Or-43884 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. Coptotermes formosanus Or-43884 protein, characterized in that, The amino acid sequence of the Or-43884 protein is shown in SEQ ID NO.

2.

3. A recombinant vector, characterized in that, The recombinant vector contains the Or-43884 gene as described in claim 1.

4. A genetically engineered bacterium, characterized in that, The genetically engineered bacterium contains the Or-43884 gene as described in claim 1.

5. The Or-43884 gene according to claim 1, or the recombinant vector according to claim 3, or the genetically engineered bacterium according to claim 4, for use in the preparation of a product for preventing and controlling termites.

6. The Coptotermes formosanus as claimed in claim 1 Or-43884 dsRNA of the gene, characterized in that The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

5.

7. Use of the dsRNA according to claim 6 in the preparation of a product for controlling termites.

8. A method for controlling termites, characterized in that, Comprising: Introduce the dsRNA of the gene of *Coptotermes formosanus* Or-43884 into termites to reduce the olfactory sensitivity of termites to stimulating odor molecules and interfere with the cleaning behavior of termites; the nucleotide sequence of the dsRNA is as shown in SEQ ID NO.

5.

9. The method according to claim 8, wherein The introduced pathways include: (1)Inject dsRNA of the Or-43884 gene of Coptotermes formosanus into the termites; Or-43884 ​ Or, (2) feeding termites with dsRNA of the Or-43884 gene of Coptotermes formosanus Shiraki Or-43884 gene.

10. Use of the Or-43884 protein according to claim 2 in identifying odor compounds, characterized in that, The odor compounds are one or more of α-pinene, β-pinene, oleic acid, linoleic acid, cycloeicosane, periplanone B, germacrene A, and supella pheromone.

Citation Information

Patent Citations

  • Trap log production method to improve termite-attracting performance

    CN107980745A

  • Odorant receptor co-receptor

    CN109804067A