Application of excellent haplotype of corn potassium efficient gene NKT1

Abstract

The invention relates to application of an excellent haplotype of a corn potassium efficient gene NKT1. The invention finds that six linkage sites on a corn NKT1 gene promoter are significantly related to the expression level of the gene. Wherein the 7.1 kb large fragment insertion of the InDel (-1592) site inhibits the activity of the NKT1 promoter, so that the transcriptional level of the NKT1 promoter is reduced, and finally the potassium content and the nitrogen content in corn leaves are reduced. NKT1 which does not contain InDel (-1592) site large fragment insertion is an excellent haplotype, and a corn inbred line containing the excellent haplotype has a certain yield advantage. The identification of excellent allelic variation of the NKT1 gene provides important gene resources and theoretical guidance for cultivation of a new corn variety with synergistic and efficient potassium and nitrogen nutrients.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to an application of an excellent haplotype of a corn potassium efficient gene NKT1, and in particular to an application of an excellent haplotype of a corn potassium efficient gene NKT1 in regulating the distribution of potassium and nitrogen in corn leaves. Background Art

[0002] Potassium and nitrogen are essential nutrients for plant growth and development. They are also the two mineral elements with the highest content in plants. Their supply level and utilization efficiency directly affect the yield and quality of crops. + and NO3 - (A small amount of NH4 + ) are absorbed by the plant roots, then loaded into the vascular tissue, and then transported to the aboveground part and distributed to the required tissue parts. There is a synergistic effect in the absorption and transportation of the two. Gramineae plants have evolved a complex and rigorous vascular system to control the orderly distribution of mineral elements to leaves and ears, thereby affecting photosynthesis and yield, but the distribution mechanism is still unclear.

[0003] Maize potassium efficient gene NKT1 (N and K transporter 1) has K + and NO3 - The transport activity of K + and NO3 - The orderly distribution from nodes to leaves can improve the utilization efficiency of potassium and nitrogen nutrients in corn. Therefore, further analysis of the functional variation sites and excellent haplotypes of the NKT1 gene can provide a theoretical basis for breeding new varieties of corn with high potassium and nitrogen nutrient efficiency, and ultimately achieve stable production and increased production with less weight, so as to ensure my country's food security and sustainable development of green agriculture. Summary of the invention

[0004] In view of the defects existing in the prior art, the object of the present invention is to provide an application of an excellent haplotype of corn potassium efficient gene NKT1. According to the expression level of corn NKT1 gene (Zm00001d017666, MaizeGDB_v4) in ear nodes of different corn inbred lines, candidate gene association analysis was performed, and 6 linked natural variation sites were identified in the promoter region of NKT1 gene: SNP (-1278) site GCT / TCC base mutation, SNP (-1298) site G / T base mutation, SNP (-1400) site A / T base mutation, SNP (-1430) site A / T base mutation, InDel (-1592) site 7.1kb large fragment deletion / insertion, and InDel (-1638) site 7bp fragment (ATTGGAA) deletion / insertion. Among them, the 7.1kb large fragment deletion / insertion of InDel (-1592) site is a functional variation site that affects NKT1 expression. The NKT1 genotype lacking the InDel (-1592) locus was identified as an excellent haplotype for efficient distribution of potassium and nitrogen in maize leaves. The identification of excellent alleles of the NKT1 gene provides a new breeding idea for the cultivation and improvement of new varieties of maize with high potassium and nitrogen nutrient efficiency.

[0005] The above maize NKT1 gene promoter sequence is shown in SEQ ID NO.5, specifically:

[0006] In SEQ ID NO.5, there is a 7bp fragment (ATTGGAA) deletion after the 559bp site, corresponding to the 7bp fragment (ATTGGAA) deletion / insertion at the above-mentioned InDel (-1638) site; there is a 7.1kb large fragment deletion after the 631bp site, corresponding to the 7.1kb large fragment deletion / insertion at the above-mentioned InDel (-1592) site; the 700bp site is A, corresponding to the A / T base mutation at the above-mentioned SNP (-1430) site; the 725bp site is A, corresponding to the A / T base mutation at the above-mentioned SNP (-1400) site; the 826bp site is G, corresponding to the G / T base mutation at the above-mentioned SNP (-1298) site; the 844bp-846bp sites are GCT, corresponding to the GCT / TCC base mutation at the above-mentioned SNP (-1278) site.

[0007] The 7.1 kb large fragment insertion sequence at the InDel (-1592) site is shown in SEQ ID NO.6.

[0008] The specific technical solution is:

[0009] The application of the maize NKT1 gene in the breeding of maize varieties with efficient potassium and nitrogen distribution is characterized in that the application is: promoting the expression of the NKT1 gene in maize plants to cultivate maize varieties with efficient potassium and nitrogen distribution;

[0010] The corn NKT1 gene is shown as SEQ ID NO.1, and the NKT1 gene encodes the protein shown as SEQ ID NO.2.

[0011] The application of maize NKT1 gene in the identification of excellent haplotypes for efficient potassium and nitrogen distribution in maize leaves is characterized in that: the application identifies excellent haplotypes for efficient potassium and nitrogen distribution in maize leaves by detecting whether there is a large fragment inserted at the -1592 site in the maize NKT1 gene promoter region;

[0012] Among them, the haplotype without a large fragment insertion at the -1592 site in the promoter region of the maize NKT1 gene is an excellent haplotype for efficient potassium and nitrogen distribution in maize leaves.

[0013] The application of the maize NKT1 gene in the identification of maize varieties with high potassium and nitrogen distribution efficiency is characterized in that: the application identifies maize varieties with high potassium and nitrogen distribution efficiency in maize leaves by detecting whether there is a large fragment inserted at the -1592 site in the maize NKT1 gene promoter region;

[0014] Among them, the haplotype without a large fragment insertion at the -1592 site in the promoter region of the maize NKT1 gene is a maize variety with efficient potassium and nitrogen allocation.

[0015] A kit for detecting efficient potassium and nitrogen distribution in corn leaves, wherein a primer pair for detecting the genotype at the -1592th site in the promoter region of the corn NKT1 gene is shown in SEQ ID NO.3-4.

[0016] Application of the above kit in phenotypic identification of potassium content and nitrogen content in corn leaves.

[0017] The application of the above-mentioned kit in the improvement of corn leaf potassium and nitrogen efficient distribution varieties.

[0018] The application of the above-mentioned kit in the breeding of corn varieties with synergistic and efficient potassium and nitrogen nutrients is characterized in that, based on the detection result of the kit on the genotype of the -1592 site in the promoter region of the corn NKT1 gene, a homozygous sample lacking the -1592 site is selected for breeding.

[0019] The use of the above kit in any of the following:

[0020] (1) Preparing products for corn breeding or assisted breeding;

[0021] (2) preparing products for identifying or assisting in identifying the phenotype of potassium and nitrogen content in corn leaves;

[0022] (3) Prepare products for breeding or assisting in breeding corn varieties with high synergistic potassium and nitrogen nutrients.

[0023] The application of the excellent haplotype of the corn potassium efficient gene NKT1 of the present invention has the following beneficial effects:

[0024] (1) The present invention provides an application of an excellent haplotype of the NKT1 gene in regulating the distribution of potassium and nitrogen in corn leaves. The excellent haplotype of the gene improves the utilization efficiency of potassium and nitrogen in the aboveground part of corn by promoting the distribution of potassium and nitrogen in corn leaves, thereby obtaining a certain yield advantage. The identification of excellent allelic variation of the NKT1 gene provides a new breeding idea for the cultivation and improvement of new varieties of corn with high potassium and nitrogen nutrient efficiency.

[0025] (2) The present invention uses PCR technology to detect natural variation sites in the promoter region of the NKT1 gene in different maize inbred lines. This method has the advantages of simple operation, high sensitivity and good accuracy.

[0026] (3) The present invention divides different corn inbred line populations into two haplotypes based on the natural variation sites in the promoter region of the NKT1 gene. Statistical analysis shows that there are significant differences in the leaf potassium and nitrogen allocation phenotypic data between different haplotype populations, further proving that different haplotypes of the gene affect the potassium and nitrogen allocation efficiency of corn leaves. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The present invention has the following accompanying drawings:

[0028] Figure 1 Figure 1 is the association analysis of NKT1 candidate genes. A is the association analysis and linkage disequilibrium (LD) analysis of NKT1 genes in 125 maize inbred line materials: the upper part of the picture shows the natural variation sites associated with the expression level of NKT1 gene in the ear node, and the highlighted red sites represent the six natural variation sites most significantly associated with the expression level of NKT1 gene; the middle part of the picture is a schematic diagram of the gene structure of NKT1, with red boxes representing exons and blue lines representing introns and promoters; the lower part of the picture is the linkage disequilibrium (LD) analysis of NKT1 natural variation sites, and the association analysis and linkage disequilibrium analysis were performed using TASSEL5.0 software and Haploview software, respectively. B is the haplotype division of 125 maize inbred line materials: the left part shows that according to the six significant variation sites in the promoter region of the NKT1 gene, the 125 maize inbred line materials are divided into two haplotypes, Hap 1 and Hap 2; the right part shows the distribution of the expression level of the NKT1 gene in the ear node in the maize inbred line materials contained in the two haplotypes; n represents the number of maize inbred lines contained in each haplotype. The significance analysis method is t-test.

[0029] Figure 2The LUC activity of different haplotype promoters of NKT1 was detected. Schematic diagram of the vectors driven by the 1563bp promoter (A) and the 2023bp promoter (B) of the haplotype inbred lines Zheng58 (Zheng 58), CI7, Dan340 (Dan 340) of Hap 1 and Zong3 (Zong 3), 04K5702, CIMBL17 of Hap 2, and the results of promoter activity detection. LUC (Firefly luciferase) is the firefly luciferase gene as a reporter gene, and REN (Renilla luciferase) is the sea renilla luciferase gene as an internal reference gene. The ratio of the expression of the reporter gene and the internal reference gene, LUC / REN, represents the promoter activity. The statistical results are expressed as mean ± standard error (n = 4). The significance analysis method was ANOVA one-way analysis of variance and Tukey's multiple comparison method. Different letters indicate significant differences, P < 0.05.

[0030] Figure 3 Phenotypic analysis of the haploid inbred lines of Hap 1 and Hap 2. The expression level of NKT1 in the ear leaves of the haploid inbred lines of Hap 1 (n=30) and Hap 2 (n=17) in the plots with normal fertilization (CK) and no potassium fertilizer (LK) were measured (A), potassium content (B), and nitrogen content (C). The significance analysis method was t-test.

[0031] Figure 4 Yield analysis of haplotypes Hap 1 and Hap 2. Results of grain weight per ear of haplotype inbred lines Hap 1 and Hap 2 in high-nitrogen and low-nitrogen plots at Anyang Experimental Station in 2017 (A) and in 2018 (B). The significance analysis method was t-test. DETAILED DESCRIPTION

[0032] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0033] The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels:

[0034] The maize inbred line population materials used in the present invention were donated by Professor Yang Xiaohong's laboratory at China Agricultural University. The inbred lines tested in the experiment are shown in Table 1 below. The inbred line population materials in Table 1 can all be obtained through commercial channels:

[0035] Table 1 Inbred line names and genotypes

[0036]

[0037]

[0038]

[0039] The corn material in the embodiment of the present invention is cultivated in a field planting manner:

[0040] Field phenotypic experiments were conducted at the Zhuozhou Experimental Station of China Agricultural University and the Anyang Experimental Station. The field fertilization program was N 240kg / ha, P2O5 100kg / ha, and K2O 80kg / ha. No potassium fertilizer was applied to low-potassium nutrient plots, and no nitrogen fertilizer was applied to low-nitrogen nutrient plots. When fertilizing in the field, phosphorus fertilizer and potassium fertilizer were applied as base fertilizers at one time, 30% of the total nitrogen fertilizer applied was used as base fertilizer, and the remaining 70% was applied during the jointing stage. Sowing plots were set up in different nutrient plots, with each plot having a row length of 2.5m, a row spacing of 0.6m, a plant spacing of 0.25m, a spacing of 0.5m between plots, and a spacing of 1-2m between different nutrient plots. Single and double seeds were sown, and artificial thinning was performed at the three-leaf stage to ensure that there were 10 materials per row. Three plots were set up in different nutrient plots as three replicates.

[0041] Example 1 Detection of corn NKT1 gene expression level

[0042] The RNA of maize stem nodes was extracted using the plant RNA extraction kit (product number AG21019) of Acryl Biotech, and the integrity of RNA was checked by agarose gel electrophoresis. The cDNA product was synthesized using the reverse transcription premix kit (product number AG11728) of Acryl Biotech. Real-time fluorescence quantitative PCR was performed using 2×M5 HiPer RealtimePCR Super Mix (product number MF797) of PolyMe Biotechnology Co., Ltd. The synthesized cDNA product was diluted 5 times with ddH2O before use. The ZmUBI2 gene was used as an internal reference gene. The real-time PCR primer sequences are as follows (5'-3'):

[0043] qRT-NKT1-F:ACACGCAAGGGTTCAGTTTC

[0044] qRT-NKT1-R:CTGGGTGAAGACAACGGAGT

[0045] qRT-ZmUBI2-F:TGGTTGTGGCTTCGTTGGTT

[0046] qRT-ZmUBI2-R:GCTGCAGAAGAGTTTTGGGTACA

[0047] The reaction system is as follows:

[0048] Table 2 Fluorescence quantitative PCR system (20 μL)

[0049]

[0050] After the reaction system was mixed, the reaction was carried out using a real-time fluorescence quantitative PCR instrument (Applied Biosystems, model 7500 Real-Time PCR System). The reaction conditions were 95°C pre-denaturation for 10 min, 95°C denaturation for 15 s, 60°C annealing and extension for 1 min, and the reaction was terminated after 40 cycles of denaturation, annealing and extension. -△△CT For subsequent data processing.

[0051] Example 2 Maize NKT1 gene resequencing and candidate gene association analysis

[0052] 125 maize inbred lines (shown in Table 1 above) were randomly selected and DNA was extracted using the Plant Genomic DNA Extraction Kit (Product No. AG21011) of Acryl Biotech. The 6.3 kb region of the promoter, coding region and UTR region of NKT1 was amplified and three pairs of primers were designed. The primer sequences are as follows (5'-3'):

[0053] NKT1-Promoter-F:CAGAGAAGACAGGAGGGAAGA(SEQ ID NO.3)

[0054] NKT1-Promoter-R:GCAGGTTGATTTTTGTGTGG(SEQ ID NO.4)

[0055] NKT1-G1-F:ATACCTGCACGAGTGACATC(SEQ ID NO.7)

[0056] NKT1-G1-R: GATTAGGTAGAGGTGCGACGA (SEQ ID NO.8)

[0057] NKT1-G2-F:CCAACAACGTCAGCAAGTGG(SEQ ID NO.9)

[0058] NKT1-G2-R:CTCTCTCCCATCACCACTAAAA(SEQ ID NO.10)

[0059] The primer amplification system and procedure are as follows:

[0060] Table 3 Promoter and gene region PCR amplification system (50 μL)

[0061]

[0062]

[0063] Table 4 Promoter PCR amplification program

[0064]

[0065] Table 5 PCR amplification procedure for gene region

[0066]

[0067] The PCR products were sequenced by Beijing Qingke Biotechnology Co., Ltd. The promoter and gene regions of each inbred line were sequenced using SeqMan software to obtain the sequence information of the NKT1 gene in 125 maize inbred lines. The spliced ​​sequences were aligned and analyzed using BioEdit Sequence Alignment Editor software and organized into genotype files. After screening based on the Minor Allele Frequency (MAF) ≥ 0.05, 146 single nucleotide polymorphism sites (SNP) and 36 insertion / deletion sites (Insert and / or deletion, InDel) were identified. Combined with the expression level of NKT1 in the ear nodes of 125 maize inbred lines, candidate gene association analysis was performed using TASSEL5.0 software. The results are shown in the figure. Figure 1 As shown in Figure 2, SNP (-1278), SNP (-1298), SNP (-1400), SNP (-1430), InDel (-1592) and InDel (-1638) located on the promoter were most significantly correlated with the expression level of NKT1 (-Log10 (P) = 2.767). HaploView software was used for linkage disequilibrium analysis and mapping, and the results showed that the six most significantly correlated sites were completely linked ( Figure 1). Through PCR amplification, it was found that InDel (-1592) was a 7.1kb large fragment insertion site. According to the 6 most significantly correlated linkage loci, 125 maize inbred lines were divided into two different haplotypes (Haplotype, Hap), Hap 1 (n = 110) and Hap 2 (n = 15). Comparison of the expression levels of NKT1 in the ear node between the two haplotypes showed that the expression level of NKT1 in the Hap 1 haplotype inbred line was significantly higher than that in the Hap 2 haplotype inbred line ( Figure 1 ). The above results indicate that the six linked natural variation sites in the NKT1 promoter region affect its transcription level.

[0068] Example 3 Verification of functional variation sites of maize NKT1 gene

[0069] Three inbred lines were selected from each of the two haplotype populations, and promoter sequences of different lengths were amplified and constructed into the pGreen0800-LUC vector. After transient expression in corn protoplasts using the dual luciferase reporter system, the effects of different promoters on LUC activity were detected. Plasmids were extracted and purified using the plasmid large-scale extraction and purification kit (product number N001) of Vigras Biotechnology Co., Ltd. Transient transformation experiment of corn protoplasts was performed as follows:

[0070] (1) Use a mixed matrix (imported soil: black soil: vermiculite = 1:1:2) to germinate the maize inbred line ND101. Before the first true leaf unfolds, keep it away from light and grow it until the second leaf is fully unfolded. Select the middle part of the second fully unfolded leaf of the etiolated seedling, cut it into thin strips with a sharp blade and put it into the enzyme hydrolyzate.

[0071] (2) Wrap the enzymatic hydrolyzate containing leaves with tin foil, place it on a shaker, and rotate at a low speed of about 40 rpm for enzymatic hydrolysis at room temperature for 4-5 hours.

[0072] (3) Filter the W5 solution, 40% PEG solution and MMG solution in advance and precool the W5 solution.

[0073] (4) Rinse the 200-mesh nylon membrane and funnel with precooled W5 solution, and filter the hydrolyzed sample through the nylon membrane into a new 50-mL centrifuge tube. Be gentle throughout the process.

[0074] (5) Adjust the speed of the 4°C centrifuge to the lowest setting, centrifuge the filtered protoplast solution at 100 × g at 4°C for 5 min, and carefully discard the supernatant.

[0075] (6) Using a wide-mouth pipette, slowly add 30 mL of W5 solution to resuspend the protoplasts and place on ice for 30 min.

[0076] (7) Prepare a 2 mL round-bottom centrifuge tube and add 16 μg of the plasmid to be transformed to the bottom of the tube for later use.

[0077] (8) Centrifuge the protoplast solution after ice bath at 100×g at 4°C for 5 min, and carefully discard the supernatant. Add an appropriate amount of MMG solution to resuspend the protoplasts according to the total amount and dosage of protoplasts.

[0078] (9) Using a cut and flaked wide-mouth blue pipette tip, add 200 μL of the protoplast solution to the plasmid to be transformed and mix gently.

[0079] (10) Add 200 μL of 40% PEG solution, mix gently, and place horizontally for conversion reaction for 18 min.

[0080] (11) Add 1 mL of W5 solution to terminate the reaction, mix gently, centrifuge at 100 × g, 4°C for 3 min, and carefully discard the supernatant.

[0081] (12) Add 1 mL of W5 solution and mix gently. Place the centrifuge tube flat and incubate it in a 28 °C incubator in the dark for 16 h before performing dual luciferase reporter gene assay.

[0082] The dual luciferase reporter gene detection kit (product number 11402ES80) of Yisheng Biotechnology (Shanghai) Co., Ltd. was used for detection. The operation steps are as follows:

[0083] (1) Centrifuge the cultured protoplasts at 100 × g, 4°C for 3 min and carefully discard the supernatant.

[0084] (2) Add 50 μL of lysis buffer and incubate on ice for about 10 min to fully lyse the protoplasts.

[0085] (3) Centrifuge at 13,000 × g, 4°C for 10 min and carefully transfer the supernatant to a new 1.5 mL centrifuge tube.

[0086] (4) Thaw the firefly luciferase reaction solution to room temperature and dispense 50 μL into new 1.5 mL centrifuge tubes.

[0087] (5) Using Promega GLOMAX TM 20 / 20 luminescence detector was used for measurement. The instrument was preheated for 5 minutes, and the system was reset according to Tools-Setting-Reset, and the program was set according to Protocol→Run Promega Protocol→DLR-O-INJ→OK.

[0088] (6) Take 10 μL of the supernatant and add it to 50 μL of firefly luciferase reaction solution. Mix by pipetting 10 times and detect the activity of firefly luciferase.

[0089] (7) Remove the sample tube and add 50 μL of Renilla luciferase reaction solution. Pipet and mix 10 times. Detect the activity of Renilla luciferase. The instrument automatically calculates the LUC / REN Ratio value.

[0090] The results are as follows Figure 2 As shown, InDel (-1592) is the insertion site of the 7.1 kb large fragment (shown in SEQ ID NO.6). First, a 1563 bp promoter fragment not containing this site was amplified from different haploid inbred lines to construct Zheng58-1563, CI7-1563, Dan340-1563, Zong3-1563, 04K5702-1563, and CIMBL17-1563 vectors. After transient expression in maize protoplasts, LUC activity was detected. The results showed that the 1563 bp promoter fragments of the six inbred lines had no significant difference in the effect on LUC activity ( Figure 2 ), indicating that SNP(-1278), SNP(-1298), SNP(-1400), and SNP(-1430) sites are not functional variation sites that affect NKT1 expression.

[0091] The 2023 bp promoter fragment was further amplified, wherein the Hap 2 haploid inbred line contained a 460 bp insert at the InDel (-1592) site (the 460 bp fragment was located at the 6643 bp to 7102 bp of the 7.1 kb large fragment sequence shown in the above SEQ ID NO. 6), and Zheng58-2023, CI7-2023, Dan340-2023, Zong3-2023, 04K5702-2023, and CIMBL17-2023 vectors were constructed. After transient expression in maize protoplasts, the LUC activity of the promoter with the 460 bp insert was detected. Compared with the Hap 1 haploid inbred line, the LUC activity of the promoter with the 460 bp insert was significantly reduced ( Figure 2 ), indicating that the large fragment insertion at the InDel(-1592) site inhibited the activity of the NKT1 promoter and reduced its transcription level. The InDel(-1592) site is a functional variation site that affects the expression of NKT1.

[0092] Example 4 Phenotypic detection of different haplotypes of maize NKT1 gene

[0093] Thirty haploid inbred lines of Hap 1 and 17 haploid inbred lines of Hap 2 were selected for phenotypic experiments in the normal fertilization (CK) plot and the no potassium fertilizer (LK) plot of the Zhuozhou Experimental Station. The expression level of NKT1 in the ear node of different haploid inbred lines in different nutrient plots was detected. The results showed that in the normal fertilization (CK) plot and the no potassium fertilizer (LK) plot, the expression level of NKT1 in the haploid inbred lines of Hap 1 was significantly higher than that in the haploid inbred lines of Hap 2. For the same haploid inbred lines, the expression level of NKT1 in the low potassium plot was significantly lower than that in the normal fertilization plot ( Figure 3 ).

[0094] Detect the potassium and nitrogen content of the ear leaves of different haploid inbred lines in different nutrient plots. Method for determining potassium ions in corn materials:

[0095] (1) Place the sample in an oven at 80°C for 3-4 days to dry until constant weight.

[0096] (2) Soak the crucible used in the experiment in 0.1N HCl (measure 8.68 mL of concentrated hydrochloric acid and add it to ddH2O, and adjust the volume to 1 L). After overnight treatment, rinse it with single distilled water and dry it in an oven at 80°C for later use.

[0097] (3) Weigh the dry weight of the dried sample and record it. If the dry weight of the sample is greater than 0.2 g, use a grinder to crush the sample.

[0098] (4) Weigh about 0.2 g of the crushed sample into the treated crucible and use a muffle furnace to treat the sample. Set the muffle furnace program: carbonization at 300°C for 3 h and ashing at 575°C for 6 h. Close the muffle furnace, wait until the temperature drops to room temperature, and carefully remove the crucible.

[0099] (5) Add 20 mL of 0.1 N HCl to the ashed sample and extract overnight.

[0100] (6) Use a syringe without a needle to blow and mix the extract, and filter it through a 0.22 μm water filter membrane.

[0101] (7) Dilute the filtered solution with 0.1N HCl in proportion and prepare a potassium ion standard curve sample. K was measured using a microwave plasma atomic emission spectrometer (AGILENT, MP4100, USA). + content.

[0102] Determination method of nitrogen content in corn materials:

[0103] (1) Place the sample in an oven at 80°C for 3-4 days to dry until constant weight.

[0104] (2) Weigh and record the dry weight of the dried sample. Use a grinder to crush the sample.

[0105] (3) Prepare the catalyst by mixing sodium sulfate and copper sulfate in a mass ratio of 10:1, and crush them in a pulverizer for later use.

[0106] (4) Weigh 0.1 g of the crushed sample into a 50 mL digestion tube and add 0.1 g of the catalyst and mix well.

[0107] (5) Add 1 mL of ddH2O to the digestion tube to moisten the sample, then add 5 mL of concentrated hydrochloric acid.

[0108] (6) Carefully place the digestion tube on the digestion furnace and place a bent-necked funnel on the tube opening.

[0109] (7) Turn on the digestion furnace and set the temperature to 220°C. After the temperature of the digestion furnace rises to 220°C, keep it warm for 30 minutes. Then adjust the temperature of the digestion furnace to 380°C until the sample turns malachite green. Continue to keep it warm for 1 hour to ensure that the sample is thoroughly digested, and then turn off the digestion furnace.

[0110] (8) When the temperature of the digestion furnace drops to room temperature, carefully remove the digestion tube, clean the bent-necked funnel with ddH2O, and adjust the volume to 50 mL. Insert a rubber stopper and mix the digestion solution by inverting it upside down.

[0111] (9) The mixed digestion solution was filtered through a 0.22 μm water filter membrane and diluted to an appropriate concentration to prepare a standard curve sample. The nitrogen content was detected using a flow analyzer (AGILENT, MP4100, USA).

[0112] Statistical analysis of potassium content in ear leaves showed that in CK and LK plots, the potassium content in leaves of the Hap2 haploid inbred lines with low expression levels was significantly lower than that of the Hap1 haploid inbred lines with high expression levels ( Figure 3 ). At the same time, the nitrogen content of the leaves at the ear position of different haploid inbred lines was measured. In the CK and LK plots, the nitrogen content of the leaves of the Hap 2 haploid inbred line was significantly lower than that of the Hap 1 haploid inbred line ( Figure 3 ). The variation of NKT1 transcription level in different haploid inbred lines leads to the difference of leaf potassium and nitrogen content.

[0113] Example 5 Yield analysis of different haplotypes of maize NKT1 gene

[0114] The change in NKT1 expression level in the two haploid inbred lines of Hap 1 and Hap 2 leads to differences in corn response to different nutrient stresses. Will this cause differences in corn yield? The present invention further analyzes the yield differences between the haploid inbred lines of Hap 1 and Hap 2. Figure 4 A), and the high-nitrogen and low-nitrogen plots at the Anyang Experimental Station in 2018 ( Figure 4 B), the ear grain weight of the Hap 1 haplotype inbred line was significantly higher than that of the Hap2 haplotype inbred line. This indicates that the Hap 1 haplotype of the NKT1 gene is an excellent haplotype, which improves the utilization efficiency of potassium and nitrogen in the aboveground part of corn by promoting the distribution of potassium and nitrogen from nodes to leaves, thereby obtaining a certain yield advantage. The identification of excellent allele variation of the NKT1 gene provides a new breeding idea for the cultivation and improvement of new varieties of corn with high potassium and nitrogen nutrient efficiency.

[0115] In summary, the large fragment insertion at the InDel (-1592) site on the promoter of the maize NKT1 gene leads to changes in the expression level of NKT1 in different inbred lines, which in turn affects the potassium and nitrogen content of maize leaves under different nutrient stresses. NKT1 that does not contain the InDel (-1592) site is an excellent haplotype, and maize inbred lines containing this haplotype have certain yield advantages. In the breeding process, through the directional selection of excellent NKT1 haplotypes, the potassium and nitrogen nutrient distribution efficiency of maize stem nodes can be improved, which is beneficial to improving the stress resistance and yield of maize.

[0116] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

[0117] The contents not described in detail in this specification belong to the prior art known to professional and technical personnel in this field.

Claims

1. Application of maize NKT1 gene in breeding of maize varieties with efficient potassium and nitrogen distribution, characterized in that: The application is: promoting the expression of the corn NKT1 gene in corn plants to cultivate corn varieties with efficient potassium and nitrogen distribution; The corn NKT1 gene is shown as SEQ ID NO.1, and the NKT1 gene encodes the protein shown as SEQ ID NO.

2.

2. Application of maize NKT1 gene in identification of excellent haplotypes for efficient potassium and nitrogen distribution in maize leaves, characterized by: The application identifies an excellent haplotype for efficient potassium and nitrogen distribution in corn leaves by detecting whether a large fragment is inserted at the -1592 site in the promoter region of the corn NKT1 gene; Among them, the haplotype without a large fragment insertion at the -1592 site in the promoter region of the maize NKT1 gene is an excellent haplotype for efficient potassium and nitrogen distribution in maize leaves.

3. Application of maize NKT1 gene in identification of maize varieties with high potassium and nitrogen distribution efficiency, characterized by: The application identifies corn varieties with high potassium and nitrogen distribution efficiency in corn leaves by detecting whether a large fragment is inserted at the -1592 site in the promoter region of the corn NKT1 gene; Among them, the haplotype without a large fragment insertion at the -1592 site in the promoter region of the maize NKT1 gene is a maize variety with efficient potassium and nitrogen allocation.

4. A kit for detecting efficient potassium and nitrogen distribution in corn leaves, wherein the primer pair used to detect the genotype at the -1592th site in the promoter region of the corn NKT1 gene is shown in SEQ ID NO.3-4.

5. Use of the kit as claimed in claim 4 in phenotypic identification of potassium content and nitrogen content in corn leaves.

6. Use of the kit as claimed in claim 4 in improving the efficient distribution of potassium and nitrogen in corn leaves.

7. Use of the kit according to claim 4 in breeding corn varieties with high synergy of potassium and nitrogen nutrients, characterized in that: Based on the detection result of the kit on the genotype of the -1592th site in the promoter region of the maize NKT1 gene, a homozygous sample lacking the -1592 site is selected for breeding.

8. Use of the kit as claimed in claim 4 in any one of the following: (1) Preparing products for corn breeding or assisted breeding; (2) preparing products for identifying or assisting in identifying the phenotype of potassium and nitrogen content in corn leaves; (3) Prepare products for breeding or assisting in breeding corn varieties with high synergistic potassium and nitrogen nutrients.

Images