Alfalfa gene MtZW1 and application thereof in plant salt tolerance

Abstract

The invention belongs to the technical field of gene engineering and salt-tolerant plant cultivation, and particularly relates to an alfalfa gene MtZW1 and application thereof in plant salt tolerance. Specifically, the gene MtZW1 for negative regulation of the salt tolerance of medicago truncatula is found for the first time, and research finds that the salt tolerance phenotype of medicago truncatula is remarkably influenced by the function loss of the gene MtZW1. Compared with a wild plant, the survival rate of the gene mutant plant treated by 100mM NaCl is remarkably improved. According to the invention, only the action mechanism of the gene MtZW1 in the plant salt tolerance is clarified, a new tool and method are provided for improving the crop salt tolerance by utilizing a genetic engineering means, and the gene MtZW1 has important scientific significance and practical application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and salt-tolerant plant breeding, and in particular relates to an alfalfa gene MtZW1 and an application thereof in plant salt tolerance. Background Art

[0002] The information disclosed in the background of the invention is only intended to enhance the understanding of the overall background of the invention and should not be necessarily regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] In animal husbandry, alfalfa is known as the "king of forage grass" for its excellent yield, nutritional value and palatability, and is widely respected around the world. It is not only the fourth largest cash crop in the United States, but also plays an indispensable role in China's animal husbandry industry, providing an important source of high-quality feed. However, the yield and quality of alfalfa are restricted by a variety of environmental factors, especially the existence of saline-alkali land, which not only limits its planting range, but also directly affects its yield and quality.

[0004] Alfalfa has important economic and ecological value, but its adaptability to saline-alkali land has not been effectively solved. Although traditional breeding methods have improved the salt tolerance of crops to a certain extent, it is difficult to achieve significant genetic improvement due to the narrow genetic background. In addition, as a cross-pollinated heterozygous tetraploid plant, the complexity of its genetic background also increases the difficulty of direct genetic improvement.

[0005] With the development of molecular genetics, improving the salt resistance of alfalfa through genetic improvement has become an effective way. Therefore, using Medicago truncatula, a model organism for leguminous plant research, with its characteristics of self-pollination, small chromosome set, small genome, and high genetic transformation efficiency, basic research is carried out to discover genes with salt resistance. Then, the research results of these genes can be transferred to alfalfa to improve the salt tolerance of alfalfa, thereby expanding its planting range and improving yield and quality. However, most of the genes discovered so far are genes that are positively regulated by salt stress, and most of the studies are on heterologous expression to enhance the salt tolerance of Arabidopsis, which is not suitable for molecular breeding using gene editing technology. Summary of the invention

[0006] In view of the above-mentioned prior art, the purpose of the present invention is to provide an alfalfa gene MtZW1 and its application in plant salt tolerance. Specifically, the present invention first discovered a gene MtZW1 that negatively regulates the salt tolerance of Medicago truncatula. Studies have shown that the loss of function of the gene MtZW1 can significantly affect the salt tolerance phenotype of Medicago truncatula. Compared with wild-type plants, the survival rate of the gene mutant plants after 100mM NaCl treatment has been significantly improved. Based on the above research results, the present invention is completed.

[0007] In order to achieve the above technical objectives, the technical solution provided by the present invention is as follows:

[0008] In a first aspect of the present invention, a kind of alfalfa gene MtZW1 is provided, and the alfalfa gene MtZW1 has:

[0009] (a1) the nucleotide sequence shown in SEQ ID NO.1;

[0010] (a2) a nucleotide sequence encoding a protein having the same amino acid sequence as the nucleotide sequence shown in (a1), but differing in sequence due to the degeneracy of the genetic code;

[0011] (a3) a nucleotide sequence having ≥90% identity with the nucleotide sequence shown in (a1) or (a2) and encoding the same functional protein;

[0012] (a4) A nucleotide sequence complementary to any one of (a1) to (a3).

[0013] Furthermore, the alfalfa gene MtZW1 has the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3.

[0014] The second aspect of the present invention provides a recombinant expression vector, wherein the recombinant expression vector comprises the alfalfa gene MtZW1.

[0015] The recombinant expression vector is obtained by effectively connecting the alfalfa gene MtZW1 to an expression vector, and the expression vector can be any one or more of a viral vector, a plasmid, a phagemid, a cosmid, or an artificial chromosome.

[0016] The third aspect of the present invention provides a transgenic cell line, a host bacteria or a genetically engineered plant containing the alfalfa gene MtZW1 or the recombinant expression vector.

[0017] The transgenic cell line may be isolated, ex vivo, in culture, or preferably, part of a plant.

[0018] The host bacteria may be eukaryotic fungi (such as fungi, specifically yeast, etc.) or prokaryotic fungi (such as bacteria, specifically Escherichia coli, Bacillus, Agrobacterium, etc.).

[0019] In the present invention, the genetically engineered plant can be a crop, and further a leguminous crop, such as alfalfa (Medicago sativa).

[0020] The fourth aspect of the present invention provides the use of the alfalfa gene MtZW1, recombinant expression vector, transgenic cell line, host bacteria or genetically engineered plant in any one or more of the following:

[0021] (b1) regulating plant salt tolerance;

[0022] (b2) Screening and / or breeding of salt-tolerant plants.

[0023] A fifth aspect of the present invention provides a method for improving salt tolerance of plants, the method comprising: inhibiting the expression of the alfalfa gene MtZW1 in the plant.

[0024] The expression of the gene MtZW1 is inhibited in that, compared with the wild type, the expression level of the gene MtZW1 is reduced, and the lowest expression level can be 0, that is, the gene is knocked out.

[0025] The method can be carried out by existing known methods, such as T-DNA insertion mutation, transposon insertion mutation, retrotransposon insertion mutation, CRISPR / Cas9 gene editing or virus-mediated VIGS, etc. In a specific embodiment of the present invention, Tnt1 retrotransposon insertion mutation is used to inhibit the expression of the gene MtZW1. The nucleotide sequence of the mutated gene MtZW1 is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0026] The plant may be a crop, and may further be a leguminous crop, such as alfalfa, etc., which is not specifically limited here.

[0027] Beneficial technical effects of one or more of the above technical solutions:

[0028] The above technical scheme revealed the function of the Medicago truncatula gene MtZW1, confirming that it is a key gene for responding to salt stress. A mutant of the MtZW1 gene with Tnt1 retrotransposon insertion was obtained from the mutant library, and it was found that the mutation of this gene improved the salt tolerance of the plant, providing a new strategy for breeding new varieties of leguminous crops with strong stress tolerance.

[0029] The above technical scheme uses molecular biology and genetic methods to conduct an in-depth analysis of the expression pattern and function of the gene MtZW1 in Medicago truncatula. We observed that the loss of function of the gene MtZW1 can significantly affect the salt tolerance phenotype of Medicago truncatula. The experimental results show that compared with wild-type plants, the survival rate of the mutant plants of this gene after 100mM NaCl treatment was significantly improved.

[0030] Through repeated biological experiments and statistical analysis, the above technical scheme confirmed that the mutant plants of mtzw1-1 and mtzw1-2 Medicago truncatula had a higher survival rate under salt treatment conditions than the wild-type Medicago truncatula R108 plants. This result shows that the gene MtZW1 has important application potential in enhancing plant salt tolerance. It can not only be applied to improve the salt tolerance of alfalfa, but also be extended to other leguminous crops, providing a theoretical and practical basis for adversity management in agricultural production.

[0031] In summary, the above technical scheme not only clarifies the mechanism of action of the gene MtZW1 in plant salt tolerance, but also provides new tools and methods for improving crop salt tolerance using genetic engineering, which has important scientific significance and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0033] Figure 1 : qRT-PCR detection of the relative expression of MtZW1 gene at different times of salt treatment. Three biological replicates; 25 seedlings in each batch.

[0034] Figure 2 : RT-PCR was used to detect the expression level of the gene MtZW1 in the roots of mutant plants. The results showed that both mtzw1-1 and mtzw1-2 mutants were gene knockout mutants.

[0035] Figure 3 :After one month of 100mM NaCl treatment, the salt tolerance of mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants was improved compared with that of Medicago truncatula wild type R108 plants. A shows the growth status of Medicago truncatula wild type R108 plants and mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants at 0, 1, 2, 3, and 4 weeks after 100mM NaCl treatment. B shows the statistical analysis results of t-test. DETAILED DESCRIPTION

[0036] It should be noted that the following detailed descriptions are all illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0037] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0038] The present invention is further described in conjunction with specific examples. The following examples are only for explaining the present invention and are not intended to limit the content thereof. If the specific experimental conditions are not specified in the examples, they are usually carried out according to conventional conditions or the conditions recommended by the reagent company; the reagents and consumables used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0039] As mentioned earlier, most of the genes discovered so far are genes that positively regulate salt stress, and most of the studies are about heterologous expression to enhance the salt tolerance of Arabidopsis, which are not suitable for molecular breeding using gene editing technology.

[0040] In the early stage of the present invention, wild-type R108 plants of Medicago truncatula were divided into a control group and an experimental group. The experimental group was treated with 100mM NaCl, and its transcriptome data was analyzed. A gene whose relative expression was down-regulated after 100mM NaCl treatment was screened. After analysis, it had a salt-tolerant phenotype, and the WRKYs transcription factor involved in salt stress was down-regulated in the MtZW1 mutant, so this gene was named MtZW1 (its nucleotide sequence is shown in SEQ ID NO.1). Two Tnt1 retrotransposon mutants of this gene, mtzw1-1 and mtzw1-2, were screened and salt-tolerant experiments were carried out. It was found that the gene mutation could improve the survival rate of the plant after 100mM NaCl treatment. That is, the MtZW1 found by the present invention is a gene that negatively regulates the salt tolerance of Medicago truncatula, so the alfalfa homologous gene MsZW1 was knocked out by gene editing to obtain high-quality salt-tolerant alfalfa.

[0041] The present invention is further explained by the following examples, but they are not intended to limit the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The test methods for the specific conditions in the following examples are usually carried out under normal conditions.

[0042] Example 1: Expression analysis of MtZW1

[0043] The material culture was changed to hydroponic method: the hard outer skin of wild-type R108 seeds of Medicago truncatula was moderately polished with sandpaper to break the dormancy of the seeds, and then cultured on moist filter paper at 4°C for about a week. Then the germinated seeds were moved to 1 / 2 Hoagland nutrient solution and placed in an incubator for growth. The incubator environmental conditions were: long daylight (16h / 8h), temperature 23°C, 65% humidity, light intensity 150mmol m -2 s -1 When the seedlings were one month old, they were treated with 100 mM NaCl. After different treatment times, RNA was extracted from the seedling leaves using the Trizol method.

[0044] The primer sequences are as follows:

[0045] MtZW1-qF:GGTGGCCACATGAGAAAGCA;

[0046] MtZW1-qR:ACGGCGTCAAGTTCAAGTCC;

[0047] MtUBQ-qF:CTGACAGCCCACTGAATTGTGA;

[0048] MtUBQ-qR:TTTTGGCATTGCTGCAAGC.

[0049] Figure 1 Shown: qRT-PCR detection of the response of MtZW1 to salt stress in the roots of wild-type R108 plants of Medicago truncatula. The horizontal coordinates 0h, 1h, 3h, 6h, 9h, 12h, and 24h in the figure represent the different times of 100mM NaCl treatment, and the vertical coordinate represents the relative expression of the gene MtZW1. Within 0-24h after 100mM NaCl treatment, the expression of the gene MtZW1 has been maintained at a low level. Three biological replicates; * indicates P<0.05, and each batch of plants has 25 seedlings.

[0050] Example 2: Identification of mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants and RT-PCR identification of the gene MtZW1 in the mutants

[0051] The genomic DNA of the mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants was extracted, and PCR amplification was performed using the Tnt1 forward insertion F primer: tccttgttggattggtagccaactttgttg and the gene reverse primer: CATAACTGCAACCGCGACTACC. The RNA reverse cDNA of the above mutant plants and wild plants was extracted and RT-PCR was performed using the gene forward primer CCTAGACATGAAGAGAGGTAGAG and the gene reverse primer CATAACTGCAACCGCGACTACC. MtActin11-F: ACGAGCGTTTCAGATG and MtActin11-R: ACCTCCGATCCAGACA were used as internal references.

[0052] Results Figure 2 .

[0053] Figure 2 Shown: RT-PCR detection of the expression of MtZW1 in the roots of two Medicago truncatula mutant strains, which were named mtzw1-1 and mtzw1-2 according to the front and back of the Tnt1 insertion site. The upper gel map indicates the expression of MtZW1 in the roots of Medicago truncatula wild-type R108 plants and mtzw1-1, mtzw1-2 mutant plants. The lower gel map indicates the expression of the housekeeping gene MtActin11 in the roots of Medicago truncatula wild-type R108 plants and mtzw1-1, mtzw1-2 mutant plants. This shows that mtzw1-1 and mtzw1-2 are both gene knockout mutants.

[0054] Example 3: Analysis of salt tolerance of mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants

[0055] Wild-type R108 seeds of Medicago truncatula and mutants of mtzw1-1 and mtzw1-2 were ground with sandpaper to break seed dormancy, placed in a petri dish filled with moist filter paper for germination for one week, and then planted in seedling holes and grown in an incubator. The incubator environmental conditions were: long daylight (16h / 8h), temperature 23°C, 65% humidity, light intensity 150mmol m -2 s -1 After two weeks of growth, the plants were moved into 10 cm × 10 cm square pots and placed in a greenhouse for growth. The normal growth conditions in the greenhouse were: long daylight (16 h / 8 h), temperature 22 ° C ~ 25 ° C, 60% -70% humidity, light intensity 150mmol m -2 s -1After two weeks of acclimatization, 25 wild-type R108 plants of Medicago truncatula and 25 mutant plants of Medicago truncatula mtzw1-1 and mtzw1-2 with the same growth status were selected and treated with 100 mM NaCl for 4 weeks. The growth status of the plants was photographed and recorded every week. The biological replicates were repeated three times, and the survival rate was calculated.

[0056] Results Figure 3 .

[0057] Figure 3 Shown: salt treatment for one month shows that the salt tolerance of mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants is improved compared with the wild-type R108 plants of Medicago truncatula. A in the figure shows the growth status of wild-type R108 plants of Medicago truncatula and mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants after 100mM NaCl treatment for 0, 1, 2, 3, and 4 weeks. After 4 weeks of 100mM NaCl treatment, the wild-type plants showed yellowing leaves, wilting stems and branches, and even plant death compared with the mutant plants. B shows that the t-test statistical analysis shows that the survival rate of mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants is significantly improved compared with the wild-type R108 plants of Medicago truncatula after 100mM NaCl treatment. Three biological replicates; * indicates P<0.05, and each batch of plants has 25 seedlings.

[0058] The nucleotide sequence involved in the present invention is:

[0059] ZGar

[0060] >ATGAAGAGAGGTAGAGAAGATAAGAGTGAGTTAAATTGTTTGATGCT ACTATCCAAAGTTGGTGAAACAAAAGAGCCTAATACATTGAAAGAATGTGGTTTTAAGTGCAAAACATGCAACAAAGAATTCTCTTCTTTTCAAGCTTTAGGTGGCCATAGAGCAAGTCACAAGAGACCAAAACTCATGTACAAGTTACCAAACATGAAACCAAAGATGCATCCATGCC CTATTTGTGGACTTGAGTTTTCCATTGGACAAGCTCTTGGTGGCCACATGAGAAAGCATAATAGTAGTTTTTCCATCTTCAAAAAATCAAAAAAAGACCATTGTGAAAGGTTGAATTTTTGCTTGGACTTGAACTTGACGCCGTTAGAGAATGGTCTTGTTTGGACTTGTACTTGA(SEQ ID NO.1)

[0061] mtzw1-1

[0062] >ATGAAGAGAGGTAGAGAAGATAAGAGTGAGTTAAATTGTTTGATGCT ACTATCCAAAGTTGGTGAAACAAAAGAGCCTAATACATTGAAAGAATGTGGTTTTAAGTGCAAAACATGCAACAAAGAATTCTCTTCTTTTCAAGCTTTAGGTGGCCATAGAGCAAGTCACAAGAGACCAAAACTCATGTACAAGTTACCAAACATGAAACCAAAGATGCATCCATGCCCTATTTGTGGACTTGAGTTTTCCATTGGACAAGCTCTTGGTGGCCACATGAGAAAGCATAATAGTAGTTTTTCCATCTTCAAAAAATCAAAAAAAGACCATTGTGAAAGGTTGAATTTTTGCTTGGACTTGAACTT(SEQ IDNO.2)

[0063] mtzw1-2

[0064] >ATGAAGAGAGGTAGAGAAGATAAGAGTGAGTTAAATTGTTTGATGCT ACTATCCAAAGTTGGTGAAACAAAAGAGCCTAATACATTGAAAGAATGTGGTTTTAAGTGCAAAACATGCAACAAAGAATTCTCTTCTTTTCAAGCTTTAGGTGGCCATAGAGCAAGTCACAAGAGACCAAAACTCATGTACAAGTTACCAAACATGAAACCAAAGATGCATCCATGCCCTATTTGTGGACTTGAGTTTTCCATTGGACAAGCTCTTGGTGGCCACATGAGAAAGCATAATAGTAGTTTTTCCATCTTCAAAAAATCAAAAAAAGACCATTGTGAAAGGTTGAATTTTTGCTTGGACTTGAACTTGACGCCGTTAGAGAATGGTCTTGTTTGGACT(SEQ ID NO.3)

[0065] Matters not covered by the present invention are well-known technologies.

[0066] The above embodiments are only for illustrating the technical concept and features of the present invention, and their purpose is to enable people familiar with the technology to understand the content of the present invention and implement it accordingly, and they cannot be used to limit the protection scope of the present invention. Any equivalent changes or modifications made according to the spirit of the present invention should be included in the protection scope of the present invention.

Claims

1. An alfalfa gene MtZW1, characterized in that: The alfalfa gene MtZW1 has: (a1) the nucleotide sequence shown in SEQ ID NO.1; (a2) a nucleotide sequence encoding a protein having the same amino acid sequence as the nucleotide sequence shown in (a1), but differing in sequence due to the degeneracy of the genetic code; (a3) a nucleotide sequence having ≥90% identity with the nucleotide sequence shown in (a1) or (a2) and encoding the same functional protein; (a4) A nucleotide sequence complementary to any one of (a1) to (a3).

2. The alfalfa gene MtZW1 according to claim 1, characterized in that The alfalfa gene MtZW1 has the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.

3.

3. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the alfalfa gene MtZW1 according to claim 1 or 2.

4. The recombinant expression vector according to claim 3, characterized in that The recombinant expression vector is obtained by effectively connecting the alfalfa gene MtZW1 according to claim 1 or 2 to an expression vector, and the expression vector is any one or more of a viral vector, a plasmid, a phagemid, a cosmid, or an artificial chromosome.

5. A transgenic cell line, host bacteria or genetically engineered plant containing the alfalfa gene MtZW1 according to claim 1 or 2 or the recombinant expression vector according to claim 3.

6. Use of the alfalfa gene MtZW1 according to claim 1 or 2, the recombinant expression vector according to claim 3 or 4, or the transgenic cell line, host bacteria or genetically engineered plant according to claim 5 in any one or more of the following: (b1) regulating plant salt tolerance; (b2) Screening and / or breeding of salt-tolerant plants.

7. A method for improving plant salt tolerance, characterized in that: The method comprises: inhibiting the expression of the alfalfa gene MtZW1 according to claim 1 in a plant.

8. The method according to claim 7, characterized in that Methods for inhibiting the expression of the alfalfa gene MtZW1 include T-DNA insertion mutagenesis, transposon insertion mutagenesis, retrotransposon insertion mutagenesis, CRISPR / Cas9 gene editing or virus-mediated VIGS.

9. The method according to claim 8, characterized in that The expression of the gene MtZW1 was suppressed by inserting a Tnt1 retrotransposon into the gene.

10. The method according to claim 7, characterized in that The plant is a crop, and may further be a leguminous crop; and further includes alfalfa.

Images