Gene for regulating carotenoid accumulation of tomato fruits and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a gene for regulating and controlling accumulation of carotenoid in tomato fruits and application of the gene. The invention provides a gene SlLOXB capable of promoting accumulation of carotenoids in tomato fruits. The gene has a nucleotide sequence as shown in SEQ ID NO: 1. The invention also provides a protein coded by the gene. The protein has a protein sequence shown as SEQ ID NO: 2. The invention also provides application of the gene or protein in improving accumulation of carotenoids in tomato fruits. After the gene SlLOXB is knocked out, the accumulation of tomato fruit pigment is slowed down, and the accumulation of carotenoid is reduced.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a tomato S1LOXB gene and an application thereof in promoting carotenoids in tomato fruits. Background Art

[0002] Tomatoes have high nutritional value, economic value and scientific research value. The quality formation of tomato fruit is related to a series of physiological and biochemical changes in its ripening process, which are specifically manifested in fruit softening, reddening (organic quality formation), increased content of nutrients such as carotenoids and vitamin C (nutritional quality formation), improvement of aroma components, and accumulation of soluble sugars (flavor quality formation). With the development of the tomato industry, the public's demand for tomato production has been upgraded from a single output demand to nutritional quality and flavor quality demand. Improving the comprehensive quality traits of tomatoes is an urgent problem to be solved in the tomato industry in the new era and is also the most concerned issue for consumers. Volatile substances derived from carotenoids not only positively affect consumers' preferences, but also enhance the human taste system to amplify the perception of sweetness. Therefore, the accumulation of carotenoids is closely related to the appearance quality (color), nutritional quality (health function) and flavor quality (aroma volatiles) of tomatoes. The regulation of carotenoids in tomato fruits can not only improve the flavor quality of tomato fruits, but also has the potential application value of reducing consumers' sugar intake, which is of great research significance. In tomatoes, the synthesis of carotenoids is regulated by various transcription factors. At the same time, its accumulation is determined by the synthesis and storage capacity. Chromoplasts are the site of carotenoid synthesis and storage, and the development and function of chromoplasts are important guarantees for carotenoid metabolism. Chromoplasts in tomatoes are differentiated from chloroplasts and contain a variety of enzymes for carotenoid metabolism.

[0003] Lipoxygenase (LOX, EC 1.13.11.12) is a class of non-heme iron-containing dioxygenases that are widely present in bacteria, fungi, plants and animals. In animals, they can not only regulate cell metabolism, proliferation, differentiation and aging, but also affect redox balance and thus affect cell function. LOX is a key enzyme in the 18-carbonic acid metabolic pathway in plants, catalyzing the dioxygenation reaction of polyunsaturated fatty acids with cis, cis-1,4-pentadiene structure. Promoting the accumulation of carotenoids in tomato fruits by regulating SlLOXB, a member of the tomato LOX family, has good application prospects. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a gene and a protein capable of promoting the accumulation of carotenoids in tomato fruits and corresponding uses.

[0005] In order to solve the above technical problems, the present invention provides a gene SlLOXB capable of promoting the accumulation of carotenoids in tomato fruit. The gene has a nucleotide sequence shown in SEQ ID NO:1.

[0006] The present invention also provides a protein encoded by the gene, which has a protein sequence shown in SEQ ID NO:2.

[0007] The invention also provides a plasmid containing the gene and a plant knockout vector containing the gene.

[0008] The plant expression vector of the present invention is specifically: gene knockout vector pCAMBIA1300-pYAO-cas9

[0009] (SlLOXB-KO).

[0010] The present invention also provides a host cell, which is an Escherichia coli cell or an Agrobacterium cell.

[0011] The invention also provides application of the gene or protein in improving the accumulation of carotenoids in tomato fruit.

[0012] As an improvement of the application of the present invention: after knocking out the gene (after knocking out the gene S1LOXB), the accumulation of pigments in tomato fruits slows down, and the accumulation of carotenoids is reduced.

[0013] As a further improvement of the application of the present invention: the knockout strains obtained after knocking out the gene SlLOXB are #11-5, #12, #14-5, and #14-21.

[0015] The present invention constructs a tomato SlLOXB gene knockout plant for the first time and conducts functional studies, which show that SlLOXB positively regulates the ripening process of tomato fruits and promotes the accumulation of carotenoids. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0017] Figure 1 This is the vector map of the SlLOXB gene editing vector pCAMBIA1300-pYAO-cas9 (SlLOXB-KO).

[0018] Figure 2 It is the base change in the SlLOXB gene-edited strain.

[0019] Figure 3 This is a picture of the fruit ripening phenotype of the SlLOXB gene-edited material;

[0020] Figure 4The changes in carotenoid content in SlLOXB gene-edited materials and wild-type tomato fruits. DETAILED DESCRIPTION

[0021] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0022] 1. Construction of tomato SlLOXB gene editing vector:

[0023] The gene editing vector of SlLOXB (SlLOXB-KO) was constructed using the pYAO-based CRISPR / Cas9 system. The target for gene editing was designed according to the gene sequence of SlLOXB (SEQ ID No: 1). The target selected a 20bp nucleotide sequence in the exon region close to ATG. The target primers of the SlLOXB-KO vector were SlLOXB-target-F: ATTGATGATAGGCCAAAAGTGAA and SlLOXB-target-R: AAACTTCACTTTTGGCCTATCAT. The target primers were dissolved in water to a 10 μmol / L mother solution, 10 μL of each was taken into a PCR tube, 80 μL of ddH2O was added, and the PCR tube was placed in a PCR instrument and heated at 98°C for 3 min. The PCR tube was immediately taken out and naturally cooled to room temperature to obtain the annealed target primers.

[0024] Take 1 μg of AtU6-26-sgRNA-SK plasmid and digest it at 37°C for 1 h in a 50 μL system (including 1 μl of restriction endonuclease BsaI-HF, 5 μl of plasmid (about 1 μg), 5 μl of 10X NEBuffer, and 39 μl of ddH2O). After purification, the digestion product was ligated with the annealed target primer using T4 DNA ligase.

[0025] Take 10 μL of the ligation product and transform it into DH5α Escherichia coli, evenly spread it on Amp-resistant LB solid culture medium, and culture it at 37°C for 12 h. Select a single clone and use SK-gRNA-F: CTCACTATAGGGCGAATTGG and SlLOXB-target-R primers for PCR identification. Select the correct single clone (i.e., PCR amplification band 499 bp) and shake the bacteria, extract the plasmid, and double-digest it with restriction endonucleases NheⅠ and SpeⅠ. After electrophoresis, the fragment with a size of about 642 bp is cut from the gel and recovered. The recovered fragment is the sgRNA cassette.

[0026] Take 1-2 μg of pCAMBIA1300-pYAO:Cas9 plasmid, digest it at 37℃ for 30min in 50μL system (including restriction endonuclease SpeⅠ1μl, plasmid 5μl (about 1μg), 10X NEBuffer 5μl, ddH2O 39μl), inactivate it at 80℃ for 20min, and then add 0.2μL alkaline phosphatase (Invitrogen TM , 20U / μL), treated at 37℃ for 10min to dephosphorylate the vector to prevent self-ligation of the vector, and the product was purified and ligated with sgRNA cassette under the action of T4 DNA ligase. 10μL of the ligation product was transformed into DH5α Escherichia coli and evenly spread on Kan-resistant LB solid medium. It was cultured at 37℃ for 16h, and single clones were selected and identified by PCR using 1300-gRNA-F:CCAGTCACGACGTTGTAAAAC and 1300-gRNA-R:CAATGAATTTCCCATCGTCGAG. The plasmid corresponding to the positive result was the constructed SlLOXB gene editing vector pCAMBIA1300-pYAO-cas9 (SlLOXB-KO) ( Figure 1 ).

[0027] 2. Detection of gene editing materials:

[0028] The gene editing vector pCAMBIA1300-pYAO-cas9 (SlLOXB-KO) was transformed into the Agrobacterium tumefaciens LBA4404 strain, and the cotyledons of the tomato variety AC (Solanum lycopersicum L.Mill.cv.Ailsa Craig) were used as explants and co-cultured with the bacterial solution to obtain callus tissue. The callus tissue was subjected to differentiation medium and rooting medium to obtain transgenic positive seedlings, and the gene-edited plants were detected by PCR and sequencing. The strains (knockout strains) with SlLOXB gene editing and predicted protein truncation and inactivation were selected as the research objects.

[0029] PCR Primers:

[0030] SlLOXB-KO identification F:GTGCTAAACTTCCATATTTTTGGATG

[0031] SlLOXB-KO identification R:AACAGAACCACTTATCAATTGGATAG

[0032] PCR procedure:

[0033] PCR amplification reaction system: 2xPrimerSTAR buffer 25ul, dNTP Mixture 5ul, PrimerSTARDNA polymerase 1ul, ddH2O 14ul, cDNA 2ul, upstream and downstream primers 1.5ul each, a total of 50ul. PCR reaction program: 98℃ pre-denaturation for 5 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 10 seconds, 72℃ extension for 90 seconds, 35 cycles; finally 72℃ final extension for 5 minutes.

[0034] A band of about 450 bp was obtained by PCR amplification. The amplified fragment was sequenced using the SlLOXB-KO identification F primer to obtain knockout strains #11-5, #12, #14-5, and #14-21. The comparison of the base changes between the above four knockout strains and AC was as follows: Figure 2 described.

[0035] 3. Study on carotenoid accumulation in gene-edited lines

[0036] The SlLOXB gene-edited lines (i.e., knockout lines #11-5, #12, #14-5, and #14-21) were planted in a greenhouse (25°C, 16 h light + 8 h dark) to observe the changes in fruit ripening and pigment accumulation in wild-type (AC) and SlLOXB knockout (SlLOXB-KO) tomato lines. Figure 3 The results showed that compared with the wild type, the fruit ripening process of SlLOXB-KO (knockout strains #11-5, #12, #14-5, #14-21) was slower and the pigment accumulation was less. Among them, the effect of strain #14-21 was the most significant, so this strain was selected for the analysis of carotenoid component content.

[0037] Tomato fruits 42 days after flowering were selected, and then quickly frozen in liquid nitrogen and ground into powder. Take 0.5g in a 10mL centrifuge tube, add 6mL of extract (2mL each of n-hexane, acetone, and ethanol), mix well, place on a shaker at 200rpm for 30min, add 20mL ddH2O, vortex mix, centrifuge at 4℃ and 1500rpm for 10min, draw 1.5mL of supernatant into a 2mL centrifuge tube, evaporate to dryness, add 0.5mL of eluent, and filter into a brown loading bottle using an organic filter. The loading bottle was placed in a liquid chromatograph for detection, and the chromatographic column was selected as a C18 column, the column temperature was 30℃, the mobile phase flow rate was 1.2mL / min, the detection wavelength was 475nm, and the detection time was 30min. Substituting the test results into the corresponding standard curve can obtain the content of different carotenoid components.

[0038] according to Figure 4The results showed that the contents of lycopene, β-carotene, and total carotenoids in SlLOXB-KO (#14-21) fruits were lower than those in AC ( Figure 4 ).

[0039] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. A gene S1LOXB that promotes carotenoid accumulation in tomato fruit, characterized in that: The nucleotide sequence of the gene S1LOXB is shown in SEQ ID No:

1.

2. The gene-encoded protein according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID No:

2.

3. A plasmid containing the gene as claimed in claim 1.

4. A plant expression vector containing the gene as claimed in claim 1.

5. The plant expression vector according to claim 4, characterized in that: It is the gene knockout vector pCAMBIA1300-pYAO-cas9 (SlLOXB-KO).

6. A host cell, characterized in that: The host cell contains the gene sequence according to claim 1.

7. The host cell according to claim 6, characterized in that: The cell is an Escherichia coli cell or an Agrobacterium cell.

8. Use of the gene according to claim 1 or the protein according to claim 2 in the accumulation of carotenoids in tomato fruit.

9. The use according to claim 8, characterized in that: After the gene SlLOXB was knocked out, the coloring of tomato fruit was delayed and the accumulation of carotenoids was reduced.

10. The use according to claim 9, characterized in that: The knockout strains obtained after knocking out the SlLOXB gene were #11-5, #12, #14-5, and #14-21.

Images