Lettuce LsGA3ox1 gene, application and lettuce preparation method of overexpressed gene LsGA3ox1

Abstract

The invention belongs to the technical field of lettuce yield increase, and particularly relates to a lettuce LsGA3ox1 gene, application and a lettuce preparation method of overexpressed gene LsGA3ox1, the CDS sequence of the lettuce LsGA3ox1 gene is shown as SEQ ID NO: 1, and experiments prove that the lettuce LsGA3ox1 gene can significantly improve the leaf area and biomass of lettuce.

Description

Technical Field

[0001] The present application relates to the field of biological yield increase technology, and more specifically, to lettuce LsGA3ox1 Genes, Applications and Overexpressed Genes LsGA3ox1 Method of preparing lettuce. Background Art

[0002] The information disclosed in this background section is intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] lettuce( Lactuca sativa L.) is one of the most important leafy vegetables in the world. During the planting process, it is considered as a pollution-free vegetable because it grows in a cool environment and rarely or rarely sprays pesticides. It is deeply loved by consumers. Lettuce is rich in folate, vitamin C, vitamin E and other vitamins, dietary minerals such as iron, and bioactive compounds such as carotenoids and phenolic compounds, and has rich nutritional value. In addition, lettuce also has high medicinal and health value. Its antioxidant compounds can protect the heart, inhibit inflammation, fight cancer, fight diabetes and antioxidants.

[0004] Lettuce leaves are the main edible organs. In recent years, the demand for lettuce in my country's market has increased dramatically and the planting area has continued to expand. Summary of the invention

[0005] The present application is provided to solve the above-mentioned defects existing in the prior art. LsGA3ox1 Genes, Applications and Overexpressed Genes LsGA3ox1 Preparation method of lettuce, the lettuce LsGA3ox1 Genes could be used to breed higher-yielding lettuce.

[0006] In a first aspect of the present application, there is provided a lettuce LsGA3ox1 Gene, the lettuce LsGA3ox1 The CDS sequence of the gene is shown in SEQ ID NO:1.

[0007] In a second aspect of the present application, there is provided a lettuce as described in any embodiment of the present application. LsGA3ox1 The application of genes in breeding high-yield lettuce.

[0008] In a third aspect of the present application, there is provided an overexpression gene LsGA3ox1 A method for preparing lettuce, the method comprising the following steps: (1) LsGA3ox1 The gene is cloned into an expression vector to obtain a recombinant vector; (2) The recombinant vector described in step (1) is transferred into Agrobacterium to obtain recombinant Agrobacterium, and then the recombinant Agrobacterium is transformed into wild-type lettuce plants to collect lettuce seeds; (3) The positive transgenic strain obtained after sowing the lettuce seeds is the target lettuce plant.

[0009] The lettuce provided in each embodiment of the present application LsGA3ox1 Genes, Applications and Overexpressed Genes LsGA3ox1 Method for preparing lettuce, lettuce LsGA3ox1 The gene can significantly increase the leaf area and biomass of commercial plants. The average fresh weight increased from 124.1 g / plant to 153.5 g / plant, with a yield increase of up to 23%, and the corresponding dry weight increased by about 18%. The leaf area of ​​commercial plants increased from 188 cm 2 , increased to 249 cm 2 , an increase of about 32%. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] In the drawings, which are not necessarily drawn to scale, the same reference numerals may describe similar parts in different views. The same reference numerals with letter suffixes or different letter suffixes may represent different instances of similar parts. The accompanying drawings generally illustrate various embodiments by way of example and not limitation, and together with the specification and claims, are used to illustrate the embodiments applied for. When appropriate, the same reference numerals are used throughout the drawings to refer to the same or similar parts. Such embodiments are illustrative and are not intended to be exhaustive or exclusive embodiments of the present apparatus or method.

[0011] Figure 1 For Example 1 LsGA3ox1 Amplified fragment map; Figure 2 This is a diagram showing the results of identification of some overexpression strains in Example 1; Figure 3 For Example 1 LsGA3ox1 Results of the analysis of significant differences in expression levels of overexpression strains; Figure 4 This is a diagram of nucleotide changes in the target sequence in the gene-edited strain in Example 2; Figure 5 The phenotypes of the wild type, the overexpression strain of Example 1, and the gene-edited strain of Example 2 grown for 28 days, wherein A is the phenotype of the wild type grown for 28 days, B is the phenotype of the overexpression strain of Example 1 grown for 28 days, and C is the phenotype of the gene-edited strain of Example 2 grown for 28 days; Figure 6The leaf phenotypes of the wild type, the overexpression strain of Example 1, and the gene-edited strain of Example 2 grown for 45 days, wherein A is the leaf phenotype of the wild type grown for 45 days, B is the leaf phenotype of the overexpression strain of Example 1 grown for 45 days, and C is the leaf phenotype of the gene-edited strain of Example 2 grown for 45 days; Figure 7 The figures are the measurement results of leaf area, plant fresh weight and dry weight of the wild type, the overexpression strain of Example 1 and the gene-edited strain of Example 2, wherein A is a statistical graph of leaf area of ​​the wild type, the overexpression strain of Example 1 and the gene-edited strain of Example 2, B is a statistical graph of plant fresh weight of the wild type, the overexpression strain of Example 1 and the gene-edited strain of Example 2, and C is a statistical graph of plant dry weight of the wild type, the overexpression strain of Example 1 and the gene-edited strain of Example 2. DETAILED DESCRIPTION

[0012] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0013] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. The reagents or raw materials used in the present invention can be purchased through conventional channels. If not otherwise specified, the reagents or raw materials used in the present invention are used in a conventional manner in the art or in accordance with the product instructions. In addition, any method and material similar to or equivalent to the described content can be applied to the method of the present invention. The preferred implementation methods and materials described in the present invention are for demonstration purposes only. The present invention is further described according to the accompanying drawings and specific embodiments of the specification.

[0014] According to an embodiment of the present application, a lettuce is provided. LsGA3ox1 Gene, the lettuce LsGA3ox1 The CDS sequence of the gene is shown in SEQ ID NO:1.

[0015] lettuce LsGA3ox1 The gene was extracted and amplified from wild-type lettuce plants, specifically from the wild-type lettuce plant "Lactuca Luya" (L46).

[0016] Specifically, lettuce LsGA3ox1 The CDS sequence of the gene is shown below.

[0017]

[0018] According to an embodiment of the present application, there is also provided a lettuce as described in any embodiment of the present application. LsGA3ox1 The application of genes in breeding high-yield lettuce. LsGA3ox1 Genetically modified lettuce plants can increase leaf area, fresh weight and dry weight, which can solve the problem of lettuce demand.

[0019] According to the embodiments of the present application, there is also provided an overexpression gene LsGA3ox1 A method for preparing lettuce, the method comprising the following steps: (1) LsGA3ox1 The gene is cloned into an expression vector to obtain a recombinant vector; (2) The recombinant vector described in step (1) is transferred into Agrobacterium to obtain recombinant Agrobacterium, and then the recombinant Agrobacterium is transformed into wild-type lettuce plants to collect lettuce seeds; (3) The positive transgenic strain obtained after sowing the lettuce seeds is the target lettuce plant.

[0020] Transgenic lettuce plants can be obtained by sowing the transformed lettuce seeds. LsGA3ox1 The yield of genetically modified lettuce plants is lower than that of normal lettuce plants due to base deletion, mutation or substitution in the genes. LsGA3ox1 Genetically modified lettuce plants have higher yields than wild-type lettuce plants. LsGA3ox1 Genetically modified lettuce can have a higher yield.

[0021] In some embodiments, in step (1), first LsGA3ox1 Gene amplification LsGA3ox1 Gene expression fragments; then the LsGA3ox1 The gene expression fragment is cloned into an expression vector to obtain a recombinant vector.

[0022] In some embodiments, first according to the LsGA3ox1 Gene amplification LsGA3ox1 Gene expression fragments, including: On Target LsGA3ox1 Homologous recombination fragments were introduced into the 5' and 3' ends of the gene; the full-length CDS sequence of the gene was obtained by PCR amplification using the cDNA of wild-type lettuce as a template and a high-fidelity enzyme.

[0023] In some embodiments, the amplification primers are: LsGA3ox1-F-1:ACACGCTCGAGCTCAAGCTT ATGCATACAAGAGTAGCTGA (SEQ ID NO: 2); LsGA3ox1-R-1: GTCGCGGCCCCGGTGGATCC TCAACCAACTGGTACACCAC (SEQ ID NO: 3).

[0024] In some embodiments, the LsGA3ox1 gene expression fragment is cloned into an expression vector, comprising: The expression vector was double-digested with endonucleases to form sticky ends to obtain the expression vector; then the cloning kit was used to clone the LsGA3ox1 The cDNA of the gene is connected to the expression vector to obtain a recombinant vector.

[0025] In some embodiments, the step (2) of transferring the recombinant vector described in step (1) into Agrobacterium to obtain the recombinant Agrobacterium comprises: The recombinant vector is introduced into Escherichia coli for cultivation, and the plasmid in the Escherichia coli is extracted; the extracted plasmid is transferred into Agrobacterium to obtain recombinant Agrobacterium.

[0026] In some embodiments, the step (2) of transforming the recombinant Agrobacterium into wild-type lettuce plants to obtain lettuce seeds comprises: Soaking wild-type lettuce seeds in a bacterial solution of recombinant Agrobacterium; The soaked wild lettuce seeds are genetically transformed using the leaf disc method to obtain lettuce seedlings; The lettuce seedlings are cultured and developed to obtain lettuce seeds.

[0027] In some embodiments, genetic transformation is performed using a leaf disc method, comprising: The seeds of wild lettuce are sterilized; the cotyledons of the sterilized wild lettuce seeds are infected in the bacterial solution of recombinant Agrobacterium; the infected cotyledons are differentiated and then cultured on a rooting medium, and the obtained positive transgenic plants are used as lettuce seedlings for the next step of culture and development.

[0028] Example 1 An overexpressed gene LsGA3ox The preparation method of lettuce comprises the following steps 1. Construction of vectors and transgenic plants (1) Cloning LsGA3ox1 Gene, through LsGA3ox1 A 15-20 bp homologous recombination fragment was introduced into the 5' and 3' ends of the gene. The cDNA of the wild-type lettuce variety "Latifolia Green Elegant" (L46) was used as a template and KOD-plus-Neo high-fidelity enzyme was used to obtain the full-length CDS sequence of the gene by PCR amplification. The primer sequences used for gene amplification were: LsGA3ox1-F-1 (forward primer of LsGA3ox1 gene) is: ACACGCTCGAGCTCAAGCTTATGCATACAAGAGTAGCTGA (SEQ ID NO: 2); LsGA3ox1-R-1 (reverse primer of LsGA3ox1 gene) is: GTCGCGGCCCCGGTGGATCCTCAACCAACTGGTACACCAC (SEQ ID NO: 3).

[0029] The system of the above PCR amplification reaction is shown in Table 1: Table 1 PCR amplification reaction system The PCR reaction program is: Pre-denaturation at 94℃ for 2 min; denaturation at 98℃ for 10 sec; annealing at 55℃ for 30 sec; extension at 68℃ for 1 min; 40 cycles; extension at 68℃ for another 7 min. Store at 4℃.

[0030] The CDS sequence of the LsGA3ox1 gene is shown in SEQ ID NO:1.

[0031] Figure 1 The amplified fragment is LsGA3ox1; (2) The obtained value in step (1) LsGA3ox1 The gene expression fragment was cloned into the pEZR(K)-LC expression vector by homologous recombination to obtain a recombinant vector; Will LsGA3ox1 The method for cloning a gene expression fragment into a pEZR(K)-LC expression vector comprises: double digesting the pEZR(K)-LC expression vector with HindIII and BamHI endonucleases to form sticky ends to obtain an expression vector; then using the Novozymes Single Fragment Rapid Cloning Kit (C112-02) to connect the cDNA of LsGA3ox1 with the expression vector to obtain an overexpression vector LsGA3ox1-pEZR(K)-LC, which is the recombinant vector; the connection system is as shown in Table 2: Table 2 Ligation system of overexpression vector LsGA3ox1-pEZR(K)-LC The procedure is: 37°C, react for 30 min, then cool to 4°C or immediately cool on ice; (3) Introducing the recombinant vector obtained in step (2) into Escherichia coli, extracting the plasmid, and then transferring it into EHA105 Agrobacterium to obtain recombinant Agrobacterium; (4) Disinfecting the seeds of wild-type lettuce with the loose-leaf lettuce variety "Lactuca Luya" (L46) as the background with alcohol and sodium hypochlorite, germinating them in MS culture medium, cutting off the cotyledons in a clean bench after the two cotyledons open, soaking them in the bacterial solution of the recombinant Agrobacterium obtained in step (3), and conducting a genetic transformation experiment using the leaf disc method; finally, dedifferentiation is performed to differentiate seedlings; the seedlings are transplanted into soil, and mature transgenic lettuce seeds are collected after flowering and fruiting; and then the seeds are propagated to screen positive pure line plants; Specific conversion method: ①Disinfection of lettuce seeds The plump lettuce seeds were first soaked in 75% ethanol for 1 min; then added with 20% sodium hypochlorite and soaked for 15 min, and washed three times with sterile water; the treated seeds were inoculated on the surface of MS solid culture medium and cultured at 25°C with a photoperiod of 16 h until two cotyledons grew; the preparation of MS solid culture medium: 4.43 g / L M519 (Phytotech), 30 g / L sucrose (Sigma), and 3.0 g / L plant gel (Sigma).

[0032] ②Cotyledon infection Cut the cotyledons of lettuce seedlings with sterile scissors, place them in the activated recombinant Agrobacterium 1 / 2MS suspension, infect for about 15 minutes, remove the infected cotyledons, absorb the excess bacterial liquid with sterile absorbent paper, place the leaves on the co-cultivation medium MS1, and culture in the dark at 25℃ for 48 hours. Preparation of MS1 solid culture medium: add 0.5 mg / L 6-BA and 0.1 mg / L NAA to the MS culture medium.

[0033] ③ Cotyledon differentiation Transfer the infected cotyledons to differentiation medium MS2, culture at 25℃, 16 h photoperiod, and subculture until kana-resistant differentiated seedlings are obtained. Preparation of MS2 solid medium: add 200 mg / L Timentin, 0.5 mg / L 6-BA, 0.1 mg / L NAA and 50 mg / L Kana antibiotics to MS medium.

[0034] ④ Rooting Cut the buds and transfer them to rooting medium MS4, so that plants with kanamycin resistance can be obtained. After the root system is well developed, transfer them to soil. Preparation of MS4 solid medium: Add 200 mg / L Timentin and 0.05 mg / L NAA to MS medium; ⑤ The lettuce seedlings obtained in step ④ were subjected to PCR identification to screen out positive transgenic plants. After obtaining the lettuce seedlings of independent transformation events, they were propagated again; the specific method was: using the total DNA of its leaves as a template, using the reverse primer on the vector and LsGA3ox1The gene's own primers were used to screen positive pure line transgenic strains, and 10 positive pure line plants were screened.

[0035] The primers for identification are: LC-R:TAACGGGTGATATATTCATTAG(SEQ ID NO:4) LsGA3ox1-F:GTGCCCTTGTGGTCAATGTAG (SEQ ID NO:5) The system of the PCR reaction for screening is shown in Table 3: Table 3 PCR reaction system for screening LsGA3ox1 overexpression strains The PCR reaction program for screening is: Pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 sec; annealing at 55℃ for 30 sec; extension at 72℃ for 1 min; 31 cycles; extension at 72℃ for another 5 min. Store at 4℃.

[0036] The positive lines were analyzed by qRT-PCR. LsGA3ox1 The expression level was measured, and the strains with higher expression levels were selected for subsequent experiments. Figure 2 The results of screening some overexpression strains are shown in Figure 1. The results show that the PCR identification results of the 10 seedlings obtained were all positive. Figure 2 The 10 seedlings numbered 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 correspond to Figure 3 OE-1, OE-2, OE-3, OE-4, OE-5, OE-6, OE-7, OE-8, OE-9, OE-10.

[0037] Figure 3 for LsGA3ox1 The results of the significant difference analysis of overexpression strains show that the expression levels of the two transgenic strains, OE7 and OE8, are relatively high, 27X and 16X respectively.

[0038] Example 2 Knockout LsGA3OX1 The preparation method of the gene-edited lettuce (gene-edited strain, referred to as CRISPR) comprises the following steps: 1. Construction of vectors and transgenic plants (1) Based on LsGA3OX1The target sequence CAAGCGGACTCCAGGCTCAC was selected by homologous comparison of the nucleotide sequence of the gene. A 4 bp homologous recombination fragment was introduced at the 5' and 3' ends of the target sequence. The forward primer + reverse primer (each with a concentration of 10 μmol) were mixed in a volume ratio of 1:1 to form a 40 μL system. The target sequence of the gene was obtained by PCR amplification. The primer sequence used for gene amplification was: LsGA3ox1-cas9-F1 (forward primer): TGCACAAGCGGACTCCAGGCTCAC (SEQ ID NO: 6); LsGA3ox1-cas9-R1 (reverse primer): AAACGTGAGCCTGGAGTCCGCTTG (SEQ ID NO: 7).

[0039] The primer annealing PCR reaction program is: 95℃ 5 min; 90℃ 1min; 80℃ 1min; 70℃ 1min; 60℃ 1min; 50℃ 1min; 40℃ 1min; 30℃ 1min; 20℃ 1min; store at 4℃.

[0040] (2) cloning the annealed primer obtained in step (1) into the PTG-Cas9 vector by homologous recombination to obtain a recombinant vector; The method of cloning the annealing primer into the PTG-Cas9 vector comprises: double digesting the PTG-Cas9 vector with Bsa1 endonuclease to form sticky ends to obtain an expression vector; then connecting the annealing primer with the expression vector using Thermo Fisher T4 DNA ligase (EL0011) to obtain a PTG-Cas9 vector containing a target sequence, namely the recombinant vector; The connection system is shown in Table 4: Table 4 PTG-Cas9 vector ligation system The procedure is: 37°C, react for 30 min, then cool to 4°C or immediately cool on ice; (3) Introducing the recombinant vector obtained in step (2) into Escherichia coli, extracting the plasmid, and then transferring it into EHA105 Agrobacterium to obtain recombinant Agrobacterium; (4) Disinfecting the seeds of wild-type lettuce with the loose-leaf lettuce variety "Lactuca Luya" (L46) as the background with alcohol and sodium hypochlorite, germinating them in MS culture medium, cutting off the cotyledons in a clean bench after the two cotyledons open, soaking them in the bacterial solution of the recombinant Agrobacterium obtained in step (3), and conducting a genetic transformation experiment using the leaf disc method; finally, dedifferentiation is performed to differentiate seedlings; the seedlings are transplanted into soil, and mature transgenic lettuce seeds are collected after flowering and fruiting; and then the seeds are propagated to screen positive pure line plants; The specific transformation method is the same as in Example 1.

[0041] The primers for identification are: LsGA3OX1-Crispr-F:CAAAGACTGATGTGGTTGATGC (SEQ ID NO:8) LsGA3OX1-Crispr-R:AGAGATAAGCGACTGACAAGCG (SEQ ID NO:9).

[0042] The system of the PCR reaction for screening is shown in Table 5: Table 5 PCR reaction system for screening LsGA3OX1 knockout plants The PCR reaction program for screening is: Pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 sec; annealing at 55℃ for 30 sec; extension at 72℃ for 1 min; 31 cycles; extension at 72℃ for another 5 min. Store at 4℃.

[0043] Figure 4 This is a diagram of the nucleotide changes in the target sequence in the gene editing strain. As shown in the figure, two types of editing occurred in the two plants: 4 base deletions and 1 base insertion.

[0044] Biomass detection The wild type, Example 1 LsGA3ox1 The lettuce seeds of the overexpressing strain and the Crispr of Example 2 were placed on moist filter paper for 3-4 days. After germination and rooting, they were planted in 7*7 cm seedling holes. About 20 days later, 25 WT and 25 Example 1 were planted. LsGA3ox1 Overexpression and 25 Crispr plants of Example 2 were planted in a 26*26 cm large pot. After growing to the 45th day, 10 plants with good growth were selected for leaf area and biomass determination. The leaf area was measured on the 4th fully expanded leaf; the fresh weight was weighed by weighing all the aboveground parts, and then the aboveground parts were placed in a 45°C oven and thoroughly dried after one week to weigh the dry weight. Figure 5The phenotypes of the wild type, the overexpression strain of Example 1, and the gene-edited strain of Example 2 grown for 45 days, wherein A is the phenotype of the wild type (WT) grown for 45 days, B is the phenotype of the overexpression strain of Example 1 grown for 45 days, and C is the phenotype of the gene-edited strain of Example 2 grown for 45 days; Figure 6 The leaf phenotypes of the wild type (WT), the overexpression strain of Example 1 (OE), and the gene-edited strain of Example 2 (CRISPR) after 45 days of growth; Figure 7 The results of the measurement of leaf area, plant fresh weight and dry weight of the wild type, the overexpression strain of Example 1 and the gene-edited strain of Example 2 are shown in Figure 1, wherein A is a statistical graph of leaf area of ​​the wild type, the overexpression strain of Example 1 and the gene-edited strain of Example 2, B is a statistical graph of plant fresh weight of the wild type, the overexpression strain of Example 1 and the gene-edited strain of Example 2, and C is a statistical graph of plant dry weight of the wild type, the overexpression strain of Example 1 and the gene-edited strain of Example 2. The results show that: overexpression LsGA3ox1 The transgenic lettuce lines significantly increased the leaf area and biomass during the commercial stage. The average fresh weight increased from 124.1 g / plant to 153.5 g / plant, with a yield increase of up to 23%, and the corresponding dry weight increased by about 18%. The leaf area of ​​commercial plants increased from 188 cm 2 , increased to 249 cm 2 , an increase of about 32%.

[0045] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A kind of lettuce LsGA3ox1 A gene characterized by The lettuce LsGA3ox1 The CDS sequence of the gene is shown in SEQ ID NO:

1.

2. The lettuce according to claim 1 LsGA3ox1 The application of genes in breeding high-yield lettuce.

3. An overexpressed gene LsGA3ox1 The method for preparing lettuce is characterized in that The preparation method comprises the following steps: (1) LsGA3ox1 The gene is cloned into an expression vector to obtain a recombinant vector; (2) The recombinant vector described in step (1) is transferred into Agrobacterium to obtain recombinant Agrobacterium, and then the recombinant Agrobacterium is transformed into wild-type lettuce plants to collect lettuce seeds; (3) The positive transgenic strain obtained after sowing the lettuce seeds is the target lettuce plant.

4. The preparation method according to claim 3, characterized in that: In the step (1), firstly LsGA3ox1 Gene amplification LsGA3ox1 Gene expression fragments; then the LsGA3ox1 The gene expression fragment is cloned into an expression vector to obtain a recombinant vector.

5. The preparation method according to claim 4, characterized in that: First according to the LsGA3ox1 Gene amplification LsGA3ox1 Gene expression fragments, including: On Target LsGA3ox1 Homologous recombination fragments were introduced into the 5' and 3' ends of the gene; the full-length CDS sequence of the gene was obtained by PCR amplification using the cDNA of wild-type lettuce as a template and a high-fidelity enzyme.

6. The preparation method according to claim 5, characterized in that: The amplification primers are: LsGA3ox1-F-1:ACACGCTCGAGCTCAAGCTT ATGCATACAAGAGTAGCTGA; LsGA3ox1-R-1:GTCGCGGCCCCGGTGGATCC TCAACCAACTGGTACACCAC.

7. The preparation method according to claim 4, characterized in that: The LsGA3ox1 The gene expression fragment is cloned into the expression vector, including: The expression vector was double-digested with endonucleases to form sticky ends to obtain the expression vector; then the cloning kit was used to clone the LsGA3ox1 The cDNA of the gene is connected to the expression vector to obtain a recombinant vector.

8. The preparation method according to claim 3, characterized in that: In step (2), the recombinant vector described in step (1) is transferred into Agrobacterium to obtain recombinant Agrobacterium, comprising: The recombinant vector is introduced into Escherichia coli for cultivation, and the plasmid in the Escherichia coli is extracted; the extracted plasmid is transferred into Agrobacterium to obtain recombinant Agrobacterium.

9. The preparation method according to claim 3, characterized in that: The step (2) of transforming the recombinant Agrobacterium into wild-type lettuce plants to obtain lettuce seeds comprises: Soaking wild-type lettuce seeds in a bacterial solution of recombinant Agrobacterium; The soaked wild lettuce seeds are genetically transformed using the leaf disc method to obtain lettuce seedlings; The lettuce seedlings are cultured and developed to obtain lettuce seeds.

10. The preparation method according to claim 3, characterized in that: Genetic transformation using the leaf disc method includes: The seeds of wild lettuce are sterilized; the cotyledons of the sterilized wild lettuce seeds are infected in the bacterial solution of recombinant Agrobacterium; the infected cotyledons are differentiated and then cultured on a rooting medium, and the obtained positive transgenic plants are used as lettuce seedlings for the next step of culture and development.

Images