A method for improving the growth rate and adductor muscle yield of Chlamys farreri
The expression of CfHPGD-2 and CfHPGD-3 genes of CfHPGD-3 by RNA interference technology has solved the shortcomings of HPGD genes in scallop growth regulation, achieved the improvement of scallop closed muscle yield and growth rate, and provided a potential method for breeding improvement.
Patent Information
- Application Number
- CN202510337469.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2045-03-21
AI Technical Summary
In the prior art, the role of HPGD gene in scallop closure muscle and overall growth regulation has not been clarified, and efficient gene regulation technology is lacking to improve the yield and growth rate of the closure muscle.
The expression of CfHPGD-2 and CfHPGD-3 genes in the scallops was inhibited by RNA interference technology. Scallops were fed with E. coli HT115 bacterial solution to construct a recombinant plasmid containing target genes to achieve specific inhibition of the HPGD gene.
The yield and growth rate of scallop closure muscles were significantly improved, revealing the negative regulatory effect of CfHPGD-2 and CfHPGD-3 genes on the crossin scallop closure muscles and overall growth, providing potential application value for scallop breeding.
Smart Images
Figure CN119842750B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of scallop cultivation, and particularly relates to an HPGD gene sequence related to the growth of scallop adductor muscle and its application. Background Art
[0002] With the rapid development of the global aquaculture industry, scallops have become important commercial aquaculture objects due to their extremely high nutritional value and economic benefits. As the main edible part of scallops, the adductor muscle not only is rich in various nutrients such as protein, minerals and vitamins, but also is an ideal model for studying the growth regulation mechanism. In recent years, with the continuous breakthroughs in molecular biology techniques such as CRISPR / Cas9 gene editing and RNA interference, the genetic improvement strategies for economic traits such as the production performance and growth rate of aquaculture animals have evolved from traditional phenotypic selection to molecular design breeding. In this context, systematically identifying the key functional genes that regulate the adductor muscle and overall growth of scallops and their interaction networks has double strategic significance: firstly, it can significantly improve the adductor muscle yield and growth rate, creating greater economic value; secondly, it provides an important reference for analyzing the muscle and overall growth regulation networks of marine invertebrates. Summary of the Invention
[0003] The purpose of the present invention is to provide an HPGD gene sequence related to the growth of scallop adductor muscle and provide the specific application of this sequence to make up for the deficiencies of the prior art.
[0004] The research on the HPGD gene in invertebrates is still relatively limited, and it is not clear whether the HPGD gene regulates prostaglandin metabolism through a conserved mechanism, thereby affecting the muscle and overall growth of marine invertebrates such as scallops. Therefore, there is an urgent need to develop an efficient and highly targeted gene regulation technology to analyze the role of the HPGD gene in the adductor muscle and overall growth of scallops and achieve trait improvement. The present invention discovers that there are four HPGD genes in Chlamys farreri, and they are expressed in all stages of embryonic development and major adult tissues. The research on the mechanism by which this gene regulates the growth of the adductor muscle and overall growth of Chlamys farreri by regulating the metabolism of lipid molecules such as prostaglandins provides an important reference for breeding scallop strains with high muscle mass and fast growth.
[0005] In order to achieve the above purpose, based on the above research findings, the present invention adopts the following technical solutions:
[0006] An HPGD gene sequence related to the growth of scallop adductor muscle, which includes CfHPGD-2 shown in SEQ NO.2 and CfHPGD-3 shown in SEQ NO.3.
[0007] The application of the gene sequences CfHPGD-2 and CfHPGD-3 in scallop cultivation.
[0008] Furthermore, the applications of the gene sequences CfHPGD-2 and CfHPGD-3 in regulating the growth traits of scallops.
[0009] Even further, the applications of the gene sequences CfHPGD-2 and CfHPGD-3 in regulating the growth of the adductor muscle of scallops.
[0010] A method for increasing the adductor muscle yield and growth rate of scallops based on the gene sequences CfHPGD-2 and CfHPGD-3, which inhibits the expression of the CfHPGD-2 and CfHPGD-3 genes in scallops by RNA interference technology.
[0011] Furthermore, the method includes the following steps:
[0012] (1) Obtain the target gene sequences of CfHPGD-2 and CfHPGD-3;
[0013] (2) Design RNA interference fragments and interference primers targeting the target genes respectively. The interference fragment of the CfHPGD-2 gene sequence is as shown in SEQ ID NO.6, and the interference fragment of the CfHPGD-3 gene sequence is SEQ ID NO.7;
[0014] (3) Amplify the interference fragments;
[0015] (4) Construct the L4440 recombinant plasmid containing the interference fragments;
[0016] (5) Induce the expression of double-stranded RNA (dsRNA) by IPTG;
[0017] (6) Mix the bacteria expressing dsRNA with microalgae and feed the Zhikong scallops to achieve the inhibition of the expression of the CfHPGD-2 and CfHPGD-3 genes.
[0018] Furthermore, in the step (2), based on the CDS sequences of the CfHPGD-2 and CfHPGD-3 genes, use an online tool to predict and select highly efficient siRNA interference fragments; then use an online tool to design interference primers containing restriction enzyme sites and their protective bases for each interference fragment. The primer sequences are as follows:
[0019] CfHPGD-2-RNAi-F-HindIII CAAGCTTGGTGATGTCACAGACCACGATCAA CfHPGD-2-RNAi-R-XhoI CCTCGAGGCATCGAGTCAGAACTTGAGCTATCA CfHPGD-3-RNAi-F-HindIII CAAGCTTGATTACTCAACAAAGGGGCGAAGATT CfHPGD-3-RNAi-R-XhoI CCTCGAGGGTTCTTTGCATTTGTGGCTTGGAC
[0020] Further, in the step (3), using scallop cDNA as a template, a high-fidelity DNA polymerase was used to amplify the interfering fragments targeting each CfHPGD-2 and CfHPGD-3 gene. After the amplified products were verified by electrophoresis, they were subjected to gel extraction and purification, and then ligated to the Blunt vector and transformed into DH5α competent cells. The sequence accuracy of the positive clones was verified by colony PCR and sequencing.
[0021] Further, in the step (4), the Blunt plasmid with correct sequencing and the L4440 empty plasmid were extracted. Through double digestion, gel extraction, and T4 ligation, the interfering fragments of each target gene were ligated to the L4440 plasmid respectively, and the products were transformed into HT115(DE3) competent cells. The sequence accuracy of the positive clones was verified by colony PCR and sequencing again to obtain Escherichia coli containing each CfHPGD-L4440 recombinant plasmid.
[0022] Further, in the step (5), the Escherichia coli strain with correct sequencing was cultured on a large scale, and IPTG was added when it entered the exponential growth phase (OD 600 = 0.4 - 0.6) to induce the high-efficiency expression of dsRNA.
[0023] Further, in the step (6), the bacterial cell precipitate after inducing dsRNA was collected by centrifugation and resuspended and mixed with the mixed concentrated microalgae solution to obtain a bacteria-algae mixture as bait for feeding the scallop Chlamys farreri.
[0024] The above method also includes verification steps: (1) Detection of the interference efficiency of CfHPGD-2 and CfHPGD-3 genes: After 40 days of continuous feeding interference, samples were taken from five main tissues of the scallop Chlamys farreri, namely the mantle, gill, striated muscle, smooth muscle, and foot, and the relative expression levels of the corresponding target genes in different tissues of each experimental group were detected by real-time fluorescence quantitative PCR (qRT-PCR). (2) Detection of growth traits: After 40 days of continuous interference, key growth traits of the scallop Chlamys farreri in each experimental group, such as shell length, shell width, shell height, body weight, soft tissue weight, and adductor muscle weight, were accurately measured and analyzed for significant differences, so as to reflect the effects of CfHPGD-2 and CfHPGD-3 genes on the growth of the scallop Chlamys farreri. (3) Detection of adductor muscle growth traits: After 40 days of continuous interference, the number and cross-sectional area of muscle fibers in the cross-section of the adductor muscle tissue of the scallop Chlamys farreri in each experimental group were counted and analyzed for significant differences, so as to reflect the effects of CfHPGD-2 and CfHPGD-3 genes on the growth of the adductor muscle of the scallop Chlamys farreri.
[0025] The above method can be applied to the research on the adductor muscle and overall growth regulation of other scallops and even bivalve mollusks. Specifically, by using RNA interference technology to inhibit the expression of the HPGD gene, the yield and growth rate of the adductor muscle of bivalve mollusks can be promoted.
[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0027] The method of the present invention for inhibiting the expression of the HPGD gene by RNA interference (RNAi) technology to improve the yield and growth rate of the adductor muscle of scallops feeds the Escherichia coli HT115 bacterial solution containing the recombinant plasmid targeting the target gene to scallops, realizing the inhibition of the expression of the CfHPGD gene.
[0028] Through the interference of the CfHPGD gene, the present invention first reveals the negative regulatory effects of the CfHPGD-2 and CfHPGD-3 genes on the adductor muscle and overall growth of Chlamys farreri. Therefore, inhibiting the HPGD gene of scallops and other bivalve mollusks in scallop cultivation to obtain high-quality varieties with high adductor muscle mass and fast growth provides potential application value for the genetic and breeding practices of aquatic organisms. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0030] Figure 1 It is a schematic structural diagram of each CfHPGD-L4440 recombinant interference plasmid of Chlamys farreri.
[0031] Figure 2 It is a gel electrophoresis detection diagram of the extraction of dsRNA of each CfHPGD gene of Chlamys farreri.
[0032] Figure 3 It is a relative expression quantification result diagram of each CfHPGD gene of Chlamys farreri in 5 main tissues 40 days after interference.
[0033] Figure 4 It is a statistical analysis result diagram of the growth traits of Chlamys farreri 40 days after interference of each CfHPGD gene.
[0034] Figure 5 It is a statistical analysis result of the growth traits of the adductor muscle of Chlamys farreri 40 days after interference of each CfHPGD gene Figure 1 .
[0035] Figure 6Statistical analysis results of the growth traits of the adductor muscle of Chlamys farreri after 40 days of interference with each CfHPGD gene Figure 2 。 Detailed implementation manners
[0036] In order to make the objectives, technical solutions and key points of the present invention clearer, the following further details the present invention in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0037] Example 1: Construction of each CfHPGD-L4440 recombinant interference plasmid of Chlamys farreri
[0038] (1) Screening and analysis of homologous sequences of the HPGD gene in Chlamys farreri:
[0039] Taking the HPGD protein sequences of other representative species as reference sequences, homologous alignment was performed with the whole genome of Chlamys farreri, and four HPGD genes of Chlamys farreri were identified, namely CfHPGD-1 (the sequence list is shown in SEQ ID NO.1), CfHPGD-2 (the sequence list is shown in SEQ ID NO.2), CfHPGD-3 (the sequence list is shown in SEQ ID NO.3) and CfHPGD-4 (the sequence list is shown in SEQ ID NO.4) genes. The CfHPGD-1 contains 13 exons, the full-length CDS is 1,686 bp, encoding 561 amino acids; the CfHPGD-2 gene contains 6 exons, the full-length CDS is 627 bp, encoding 208 amino acids; the CfHPGD-3 gene contains 4 exons, the full-length CDS is 561 bp, encoding 186 amino acids; the CfHPGD-4 gene contains 10 exons, the full-length CDS is 987 bp, encoding 328 amino acids.
[0040] (2) Design of RNA interference fragments and interference primers targeting four target genes:
[0041] Based on the CDS sequences of each CfHPGD gene, an online tool siDirect 2.0 (http: / / sidirect2.rnai.jp / ) was used to predict highly efficient siRNA interference fragments. To ensure targeting specificity, BLAST alignment was used to verify the uniqueness of the selected target sequences in the genome, aiming to design RNA interference fragments with highly efficient and specific interference functions and minimize the generation of off-target effects.
[0042] Design corresponding primers using Primer Premier 5.0 software, and use the online tool NEBcutter3.0 (https: / / nc3.neb.com / NEBcutter / ) to screen two restriction endonucleases that are appropriate (without their restriction sites within the entire interfering fragment) and have their restriction sites in the L4440 plasmid. After determining the XhoI and HindIII restriction sites, add them and the corresponding protection bases to the 5'-end of the primers. The primers used in this example are shown in Table 1.
[0043] Table 1 Primer sequence list of RNA interference target fragments
[0044]
[0045] (3) Amplification and sequencing verification of the interfering fragment:
[0046] Using the cDNA of Chlamys farreri as a template, use Phanta Max Super-Fidelity DNA polymerase to amplify the interfering fragments of four CfHPGD genes (the interfering fragment of the CfHPGD-1 gene sequence is shown in SEQ ID NO.5, the interfering fragment of the CfHPGD-2 gene sequence is shown in SEQ ID NO.6, the interfering fragment of the CfHPGD-3 gene sequence is shown in SEQ ID NO.7, and the interfering fragment of the CfHPGD-4 gene sequence is shown in SEQ ID NO.8). The specific reaction system is shown in Table 2, and a total of 200 μL is amplified. The PCR program is set as follows: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, for a total of 32 cycles; final extension at 72 °C for 10 min.
[0047] Table 2 DNA polymerase reaction system for amplifying interfering fragments
[0048]
[0049] After amplification, detect the band correctness of the PCR product by 1.5% agarose gel electrophoresis. Subsequently, use the QIAquick PCR Purification Kit gel recovery kit to recover the RNA interference fragment in the gel, and use the Nanodrop One spectrophotometer to detect the product concentration and quality. Next, construct a ligation system (10 μL) containing the interfering fragment and the Blunt vector. After ligation at 25 °C for 15 min, transform it into DH5α Escherichia coli competent cells by heat shock method, and culture it with shaking at 37 °C for 40 min. Then, evenly coat the product on the LB solid medium containing ampicillin (Amp + ) and culture it inverted at 37 °C for 10 - 12 h.
[0050] The next day, use a sterilized toothpick to pick a single colony and prepare + 800 μL of LB liquid culture medium and PCR amplification system (Table 3) were added. After the single clone was picked, the toothpick was repeatedly shaken in the PCR reaction system, and then the toothpick was placed in the liquid culture medium (note the corresponding number). Subsequently, the colony PCR amplification verification was performed, and the PCR program was set as follows: 95℃ pre-denaturation for 5min; 95℃ denaturation for 1min, 60℃ annealing for 30s, 72℃ extension for 1min, a total of 25 cycles; 72℃ final extension for 10min. At the same time, the liquid culture inoculated with a single colony was cultured at 37℃ for 4-6h. After the amplification was completed, it was detected by 1.5% agarose gel electrophoresis, and the culture verified as a positive clone was sent to a sequencing company (Sangon Biotech) for sequence determination.
[0051] Table 3 DNA polymerase reaction system for colony PCR amplification verification
[0052]
[0053] (4) Construction and sequencing verification of L4440 interference plasmid:
[0054] After obtaining the strain with the correct sequencing, expand the culture and use the endotoxin-free plasmid extraction kit to extract the plasmid contained therein. According to the following reaction system (Table 4), the obtained Blunt plasmid and L4440 blank vector were double-digested, and the PCR program was set to 37°C for 20min. After the digestion was completed, refer to the previous operation, and perform 1.5% agarose gel electrophoresis detection, gel recovery and other steps in sequence to obtain RNA interference fragments with sticky ends and L4440 empty plasmid fragments and measure their concentrations.
[0055] Table 4 Double enzyme digestion reaction system
[0056]
[0057] Afterwards, the amount of ligation was calculated using the online tool NEBioCalculator (https: / / nebiocalculator.neb.com / ), and the RNA interference fragment was ligated with the L4440 empty plasmid fragment using T4 ligase. The specific ligation system is shown in Table 5. The PCR program was set to 25°C for 10 min. After the ligation was completed, each CfHPGD-L4440 recombinant plasmid was obtained, and its structural schematic diagram is shown in Figure 1 shown.
[0058] Finally, referring to the previous operations, the above-mentioned ligation products and the L4440 empty plasmid were respectively transformed into competent HT115(DE3) Escherichia coli cells, and the products were evenly spread on LB solid medium containing Amp + and tetracycline (TET + ). After incubating inverted at 37 °C for 10 - 12 h, single colonies were picked for colony PCR amplification. The strains verified as positive clones were cultured in LB liquid medium containing Amp + and TET + for scale-up culture, and then sequenced again.
[0059] Table 5 T4 ligase ligation reaction system
[0060]
[0061] (5) Induced expression and extraction verification of dsRNA:
[0062] Take 10 μL of the above-mentioned positive strains with correct sequencing and inoculate them into 3 - 5 mL of LB liquid medium containing Amp + and TET + . Incubate with shaking at 37 °C for 10 - 12 h. The next day, transfer them to fresh LB liquid medium containing Amp + and TET + for scale-up culture at a ratio of 1:100. After culturing for a period of time, use a spectrophotometer to measure the absorbance (OD 600 ) of the bacterial solution at a wavelength of 600 nm. When it enters the exponential growth phase (OD 600 = 0.4 - 0.6), add 0.5 mM isopropyl-β-D-thiogalactoside (IPTG) to induce the high-level expression of dsRNA. Continue to culture for 4 h, then centrifuge at 8,000 rpm for 3 min, discard the supernatant and collect the bacterial cell precipitate, and store it at -80 °C for later use.
[0063] Total RNA was extracted from the induced and uninduced bacterial solutions by the traditional TRIzol method. After digesting single-stranded RNA (ssRNA) with RNase T1, use a Nanodrop One spectrophotometer to measure the concentration and quality of the extracted dsRNA, and use 1.5% agarose gel electrophoresis to detect the correctness of the dsRNA band. The results are as Figure 2As shown, lanes 5, 8, 11, and 14 represent the RNAs of the strains containing the CfHPGD-L4440 recombinant plasmids without IPTG induction; lanes 6, 9, 12, and 15 represent the RNAs of the strains containing the CfHPGD-L4440 recombinant plasmids with IPTG induction; lane 2 represents the RNA of the strain containing the L4440 empty plasmid without IPTG induction; lane 3 represents the RNA of the strain containing the L4440 empty plasmid with IPTG induction; lanes 1, 4, 7, 10, and 13 represent the 100bp DNA ladder. This result indicates that after IPTG induction, Escherichia coli HT115 successfully expressed the target dsRNA fragments targeting each CfHPGD gene (indicated by white arrows), and at the same time verified the necessity of IPTG induction and the L4440 empty plasmid can be used as a negative control group to exclude false positives.
[0064] Example 2: RNA interference of each CfHPGD gene in Chlamys farreri by feeding a mixture of bacteria and algae
[0065] (1) Experimental animals:
[0066] Randomly select 250 one-year-old live Chlamys farreri from the same population with relatively uniform individuals, and systematically measure their initial growth traits, including shell length (46.31 ± 3.19 mm), shell width (13.40 ± 1.27 mm), shell height (50.40 ± 2.79 mm), and body weight (12.59 ± 2.45 g). Then, randomly divide the above Chlamys farreri into five groups, namely the Control group, RNAi-CfHPGD-1 group, RNAi-CfHPGD-2 group, RNAi-CfHPGD-3 group, and RNAi-CfHPGD-4 group, with 50 individuals in each group. Finally, place each group of Chlamys farreri in an independent and strictly disinfected 500L water tank (filled with about 400L of 20°C constant temperature filtered seawater, replaced once a day), and continuously oxygenate the water tank to maintain suitable living conditions.
[0067] (2) Preparation of dsRNA:
[0068] Refer to the operation in Example 1 to induce the expression of dsRNA. Then, take 200 mL of the Escherichia coli HT115 bacterial solutions containing the L4440 empty plasmid, CfHPGD-1-L4440, CfHPGD-2-L4440, CfHPGD-3-L4440, and CfHPGD-4-L4440 recombinant plasmids respectively, centrifuge to discard the supernatant, collect the bacterial cell precipitate, and resuspend and mix it with 20 - 30 mL of the mixed concentrated algal solution of Chlorella pyrenoidesa and Chaetoceros muelleri to obtain a bacteria-algae mixture as bait.
[0069] (3) Feeding protocol:
[0070] During RNA interference, scallops in each group were fed an equal amount of mixed concentrated algal solution four times a day (at 9:00, 13:00, 17:00, and 21:00), and the concentration of algal cells in the water was maintained at about 5 - 10×10 5 cells / mL during each feeding. Among them, a bacteria-algae mixture was used for the second and fourth feedings. The Control group was fed a bacteria-algae mixture containing the empty vector L4440 plasmid, the RNAi-CfHPGD-1 group was fed a bacteria-algae mixture containing the CfHPGD-1-L4440 recombinant plasmid, the RNAi-CfHPGD-2 group was fed a bacteria-algae mixture containing the CfHPGD-2-L4440 recombinant plasmid, the RNAi-CfHPGD-3 group was fed a bacteria-algae mixture containing the CfHPGD-3-L4440 recombinant plasmid, and the RNAi-CfHPGD-4 group was fed a bacteria-algae mixture containing the CfHPGD-4-L4440 recombinant plasmid.
[0071] The technical effects of the present invention will be described in detail below in combination with the experimental results.
[0072] (1) Detection of the expression level after interference of each CfHPGD gene:
[0073] qRT-PCR primers for each CfHPGD gene were designed, avoiding the RNA interference fragment to ensure the accuracy of target gene quantification. Ef1α was selected as the internal reference gene, and the specific primer sequences are shown in Table 6.
[0074] Table 6 Quantitative primer sequence table
[0075]
[0076]
[0077] After 40 days of feeding, 30 scallops were randomly selected from each experimental group for dissection, and five main tissues including the mantle, gill, striated muscle, smooth muscle, and foot were collected. The above tissues were cut into small pieces with a diameter of about 1 cm, frozen in liquid nitrogen, and stored at -80°C. Total RNA was extracted from each main tissue of scallops in each group, and after reverse transcription to obtain cDNA, it was diluted to 10 ng / μL as the quantitative template.
[0078] After that, an experimental design was pre-conducted, with 3 technical replicates for each sample and 5 biological replicates for each group to minimize experimental errors. Subsequently, a qRT-PCR reaction system (Table 7) was constructed and placed In the 480 instrument, the program was set as follows: pre-denaturation at 50 °C for 2 min, pre-denaturation at 94 °C for 10 min; denaturation at 94 °C for 15 s, annealing at 60 °C for 1 min, for a total of 40 cycles; finally, the temperature was decreased by 0.5 °C every 10 s until 55 °C, and held at 55 °C for 1 min. After the reaction, the specificity of the amplification was verified according to the dissociation curve, and the relative expression levels of each CfHPGD were calculated by the method of 2 -△△Ct . After that, the significance of the difference in the expression levels of the target genes between each RNA interference group and the control group was analyzed by t-test (Student’s t-test), with * representing P < 0.050 and ** representing P < 0.01.
[0079] Table 7 qRT-PCR reaction system
[0080]
[0081] The results of the analysis of the expression levels of the corresponding CfHPGD genes in the five main tissues of the mantle, gill, striated muscle, smooth muscle, and foot of the scallop Chlamys farreri in each RNA interference group and the differences between them and the control group are as Figure 3 shown. After continuously carrying out RNA interference for 40 days, compared with the control group, the expression levels of the CfHPGD-1 gene in the mantle, gill, striated muscle, smooth muscle, and foot of the RNAi-CfHPGD-1 group were significantly decreased by 71.03%, 51.09%, 66.40%, 60.93%, and 30.74%, respectively; the expression levels of the CfHPGD-2 gene in the mantle, gill, striated muscle, smooth muscle, and foot of the RNAi-CfHPGD-2 group were significantly decreased by 50.55%, 66.55%, 57.57%, 57.10%, and 54.92%, respectively; the expression levels of the CfHPGD-3 gene in the mantle, gill, striated muscle, smooth muscle, and foot of the RNAi-CfHPGD-3 group were significantly decreased by 87.99%, 84.89%, 47.00%, 58.03%, and 42.94%, respectively; the expression levels of the CfHPGD-4 gene in the mantle, gill, striated muscle, smooth muscle, and foot of the RNAi-CfHPGD-4 group were significantly decreased by 60.89%, 55.90%, 84.99%, 86.72%, and 66.17%, respectively. This quantitative result shows that this RNA interference has an efficient and systematic inhibitory effect on each CfHPGD gene of the scallop Chlamys farreri.
[0082] (2) Detection of the growth traits of the scallop Chlamys farreri:
[0083] After continuously interfering for 40 days, the key growth traits of the scallop Chlamys farreri in each experimental group, such as shell length, shell width, shell height, body weight, soft tissue weight, and adductor muscle weight, were accurately measured and the significance of the differences was analyzed. The results are as Figure 4As shown, compared with the control group, there were no significant changes in the growth traits of scallops in the RNAi-CfHPGD-1 group (P>0.05); the average shell length, shell width, shell height, body weight, soft tissue weight, and adductor muscle weight of scallops in the RNAi-CfHPGD-2 group increased significantly by 2.98% (P<0.05), 6.77% (P<0.01), 2.90% (P<0.05), 18.02% (P<0.01), 20.60% (P<0.01), and 37.36% (P<0.01), respectively; the average shell length, shell width, shell height, body weight, soft tissue weight, and adductor muscle weight of scallops in the RNAi-CfHPGD-3 group increased significantly by 3.99% (P<0.01), 4.92% (P<0.01), 2.96% (P<0.05), 22.60% (P<0.01), 34.07% (P<0.01), and 15.38% (P<0.05), respectively; only the average body weight of scallops in the RNAi-CfHPGD-4 group increased significantly by 9.53% (P<0.05), while there were no significant changes in other growth traits (P>0.05). This statistical result shows that the CfHPGD-2 and CfHPGD-3 genes have the function of negatively regulating the overall growth of scallops. When the expression of these two genes is inhibited, the growth rate of scallops is significantly accelerated. Targeted inhibition of the CfHPGD-1 and CfHPGD-4 genes did not cause systematic growth phenotype changes, suggesting that they do not participate in the core regulatory function in the growth of scallops and are not the key regulatory genes directly affecting the growth phenotype. It is worth noting that the two experimental groups of RNAi-CfHPGD-2 and RNAi-CfHPGD-3 showed a more significant growth promotion effect in terms of adductor muscle and soft tissue weight, indicating that the CfHPGD-2 and CfHPGD-3 genes are closely related to the growth of tissues such as the adductor muscle of scallops.
[0084] (3) Detection of the growth traits of the adductor muscle of scallops:
[0085] After 40 days of continuous interference, using tissue morphological research methods such as paraffin embedding, tissue sectioning, and hematoxylin-eosin (HE) staining, the number and cross-sectional area of muscle fibers in the cross-section of the adductor muscle tissue of scallops in each experimental group were statistically analyzed and the significance of differences was analyzed. The results are as Figure 5 and Figure 6As shown, compared with the control group, the number of striated muscle fibers in the scallop Chlamys farreri in the RNAi-CfHPGD-2 group increased by 19.43% (P<0.01), the number of smooth muscle fibers increased by 5.72% (P<0.01), and there were no significant changes in the cross-sectional areas of the two adductor muscle fibers (P>0.05); in the RNAi-CfHPGD-3 group of scallops, the number of striated muscle fibers increased by 27.89% (P<0.01), the number of smooth muscle fibers increased by 10.10% (P<0.01), and there were no significant changes in the cross-sectional areas of the two adductor muscle fibers (P>0.05); in the RNAi-CfHPGD-1 and RNAi-CfHPGD-4 groups of scallops, there were no significant changes in the number and cross-sectional area of the two adductor muscle fibers (P>0.05). This statistical result shows that the CfHPGD-2 and CfHPGD-3 genes have the function of negatively regulating the growth of the adductor muscle of Chlamys farreri. When the expression of these two genes is inhibited, the striated and smooth muscle fibers of the scallop proliferate significantly.
[0086] Based on RNA interference technology, the present invention achieved systemic inhibition of the gene encoding 15-hydroxyprostaglandin dehydrogenase (HPGD) in the scallop Chlamys farreri by feeding Escherichia coli that can induce the production of target gene-specific dsRNA for 40 consecutive days. By combining the measurement of the growth traits of Chlamys farreri, it was found that after the CfHPGD-2 and CfHPGD-3 genes were interfered, the overall and adductor muscle growth rates of the scallop were significantly increased, and the muscle fibers proliferated significantly, reflecting the negative regulatory effects of these two genes on the adductor muscle and even the overall growth of Chlamys farreri. Therefore, the present invention provides a method for promoting the yield and growth rate of the adductor muscle of scallops, that is, by inhibiting the expression of the HPGD gene through the RNA interference technology of feeding dsRNA, thereby promoting the growth of the soft tissues such as the adductor muscle and the whole body of the scallop.
[0087] The specific embodiments described above further elaborate on the purpose, technical solutions, and beneficial effects of the present disclosure. It should be understood that the above are only specific embodiments of the present disclosure and are not used to limit the present disclosure. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present disclosure should be included within the protection scope of the present disclosure.
Claims
1. Related to the growth of scallop adductor muscle HPGD The gene is characterized in that The gene includes those shown in SEQ NO.2 CfHPGD-2 , and those shown in SEQ NO.3 CfHPGD-3 .
2. Silencing the gene described in claim 1 CfHPGD-2 and CfHPGD-3 its application in promoting the growth of the adductor muscle of Chlamys farreri; characterized in that The method of silencing is to inhibit the expression of CfHPGD-2 and CfHPGD-3 genes in Chlamys farreri through RNA interference technology. CfHPGD-2 The interfering fragment of the CfHPGD-3 gene is shown in SEQ ID NO.6, and the interfering fragment of the CfHPGD-3 gene is shown in SEQ ID NO.
7.
3. A method for improving the yield and growth rate of scallop adductor muscle, characterized in that, The method comprises the following steps: (1) Obtain CfHPGD-2 , CfHPGD-3 the target gene sequence; (2)Design RNA interference fragments and interference primers that specifically target the target gene, CfHPGD-2 The interference fragment of the gene is shown in SEQ ID NO.6, CfHPGD-3 The interference fragment of the gene is shown in SEQ ID NO.7; (3) Amplifying the interfering fragment; (4) Constructing an L4440 recombinant plasmid containing the interfering fragment; (5) Inducing the expression of double-stranded RNA by IPTG; (6) Mix the dsRNA-expressing bacteria with microalgae and feed the scallop Chlamys farreri to achieve the inhibition of the expression of CfHPGD-2 and CfHPGD-3 genes.
4. The method according to claim 3, characterized in that, In the step (2), based on CfHPGD-2 , CfHPGD-3 the CDS sequences of the genes, use an online tool to predict and select siRNA interference fragments; then use an online tool to design interference primers containing restriction enzyme sites and their protection bases for each interference fragment; the primer sequences are as follows: 。 5. The method according to claim 3, wherein In the step (3), using the scallop cDNA as a template, a high-fidelity DNA polymerase is used to amplify the interfering fragments targeting each CfHPGD-2 , CfHPGD-3 gene. After the amplified product is verified by electrophoresis, it is subjected to gel recovery and purification, and then ligated to a Blunt vector and transformed into DH5α competent cells. The sequence accuracy of the positive clone is verified by colony PCR and sequencing.
6. The method according to claim 3, wherein In the step (4), the Blunt plasmid with correct sequencing and the L4440 empty plasmid are extracted. Through double digestion, gel recovery, and T4 ligation, the interfering fragments of each target gene are respectively ligated with the L4440 plasmid, and the products are transformed into HT115(DE3) competent cells. The sequence accuracy of the positive clones is verified again through colony PCR and sequencing to obtain Escherichia coli containing each CfHPGD -L4440 recombinant plasmid.
7. The method according to claim 3, wherein In the step (5), the Escherichia coli strain with correct sequencing is amplified and cultured, and IPTG is added when it enters the exponential growth phase to induce the high-efficient expression of dsRNA; in the step (6), the cell precipitate after inducing dsRNA is collected by centrifugation and resuspended and mixed with the mixed concentrated microalgae solution to obtain a bacteria-algae mixture as bait for feeding scallops.
Citation Information
Patent Citations
Method for increasing growth speed of mulinialateralis
CN115927339A
G-type lysozyme gene of Chlamys farreri and encoded protein and cloning method thereof
CN1763201A