Gene GhBGLU and VIGS vector, host cell and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a gene GhBGLU as well as a VIGS vector, a host cell and application of the gene GhBGLU. The nucleotide sequence of the gene GhBGLU is as shown in SEQ ID NO. 1. The invention discloses that the gene GhBGLU participates in regulating and controlling the drought stress response of the upland cotton for the first time, the drought resistance of the upland cotton can be enhanced, and the gene can be used for cultivating new varieties of drought-resistant plants and has potential application value.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a gene GhBGLU and a VIGS vector, a host cell and application thereof. Background Art

[0002] As an important global cash crop and a major source of natural fiber, cotton occupies a core position in my country's textile industry. my country's cotton is mainly grown in Xinjiang, with Xinjiang's production accounting for 91% of the country's total. However, Xinjiang's drought, lack of rain, and water shortage have become key factors restricting cotton production. Therefore, improving cotton quality and drought resistance has become a breeding focus. Flavonoids can increase the water absorption and water storage capacity of plant roots, thereby improving the survival ability of plants under drought stress.

[0003] Among plant secondary metabolites, flavonoids have attracted widespread attention for their diverse biological functions. These compounds are usually found in organs such as flowers, leaves, and seeds, stored in the vacuoles of plant cells in the form of glycosides, and exert their biological functions in the cytoplasm in a free form. It can not only participate in pigment synthesis to regulate the color of plant organs, but also regulate root growth, signal transduction, auxin transport and other processes. More importantly, flavonoids can also help plants resist various biological and abiotic stresses.

[0004] Therefore, it is extremely important to explore the genes related to flavonoids in cotton. Summary of the invention

[0005] In order to improve the stress resistance of cotton, the present invention provides a gene GhBGLU associated with drought resistance of upland cotton. The gene GhBGLU provided by the present invention can not only regulate the content of flavonoid compounds and enhance the drought resistance of upland cotton, but also can be used to cultivate new varieties of drought-resistant plants, and has potential application value.

[0006] A gene GhBGLU for regulating the content of flavonoid compounds, wherein the nucleotide sequence of the gene GhBGLU is shown as SEQ ID NO.1, and the coding region sequence thereof is shown as SEQ ID NO.4.

[0007] The present invention reveals for the first time that the upland cotton gene GhBGLU is involved in regulating the drought stress response of upland cotton, and can enhance the drought resistance of upland cotton. The gene GhBGLU provided by the present invention provides a valuable resource for breeding new varieties of drought-resistant upland cotton, and at the same time lays a theoretical foundation for studying the mechanism of upland cotton's response to drought stress and the molecular mechanism of resisting adverse environments.

[0008] The present invention provides a VIGS vector containing the gene GhBGLU, which is obtained by inserting the gene GhBGLU fragment shown in SEQ ID NO.4 into the EcoR1 and Kpn1 restriction sites of the overexpression vector pTRV2.

[0009] Furthermore, the amplification primers for the gene GhBGLU fragment shown in SEQ ID NO.4 include GhBGLU-F shown in SEQ ID NO.2 and GhBGLU-R shown in SEQ ID NO.3.

[0010] The present invention provides a recombinant cell, wherein the recombinant cell is obtained by transforming a VIGS vector into a host cell.

[0011] The present invention provides an application of a gene GhBGLU, a VIGS vector or a recombinant cell in cotton breeding.

[0012] Furthermore, the gene GhBGLU is used to increase the content of flavonoid compounds to improve the drought resistance of upland cotton.

[0013] Furthermore, the VIGS carrier is used to increase the content of H2O2 and malondialdehyde in upland cotton.

[0014] The present invention also provides a method for improving the drought resistance of upland cotton, comprising inserting the gene GhBGLU fragment shown in SEQ ID NO.4 into the EcoR1 and Kpn1 restriction sites of the overexpression vector pTRV2 to obtain a VIGS vector, transforming the vector into a host cell, extracting the positive plasmid and transforming it into Agrobacterium, and using Agrobacterium to infect the cotyledons of upland cotton seedlings to obtain drought-resistant transgenic upland cotton.

[0015] Furthermore, the infection requires a virus suspension, which is obtained by resuspending an Agrobacterium solution containing pTRV1 in VIGS buffer to obtain a mixed solution 1, resuspending an Agrobacterium solution containing a VIGS vector in VIGS buffer to obtain a mixed solution 2, and mixing the mixed solution 1 and the mixed solution 2 and then activating them.

[0016] Furthermore, the VIGS buffer contains MgCl2, MES and AS, the solvent is deionized water and the pH is 5.6-6.0.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] 1. The present invention reveals for the first time that the upland cotton gene GhBGLU is involved in regulating the drought stress response of upland cotton, and can enhance the drought resistance of upland cotton. The gene GhBGLU provided by the present invention provides a valuable resource for breeding new varieties of drought-resistant upland cotton, and at the same time lays a theoretical foundation for studying the mechanism of upland cotton's response to drought stress and the molecular mechanism of resisting adverse environments.

[0019] 2. The present invention picks the petals of cotton in the flowering period to detect the content of flavonoid compounds in cotton leaves, uses GWAS analysis to identify SNP sites highly correlated with flavonoids, determines the candidate gene GhBGLU, and successfully constructs a virus-induced gene GhBGLU silencing vector. The present invention found that silencing the gene GhBGLU makes cotton more sensitive to drought, revealing that the GhBGLU gene is involved in regulating the drought stress response of upland cotton. The gene can be used to cultivate new varieties of drought-resistant plants and has potential application value.

[0020] 3. The present invention uses VIGS technology to silence the GhBGLU gene in upland cotton TM-1 seedlings, and finds that after drought stress, the GhBGLU-silenced plants showed a certain degree of wilting compared with the control plants, and the H2O2 and malondialdehyde contents of the GhBGLU-silenced plants were significantly higher than those of the control group, indicating that the upland cotton gene GhBGLU plays a positive regulatory role in the mechanism of cotton's response to drought stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 The box plot in the upper part is the flavonoid content in the petals of upland cotton. The box plot in the upper part is the flavonoid data distribution statistics (logarithmic transformation), which represents the overall content of flavonoids in the petals and their distribution in the population. The lower part is a heat map of the diversity of flavonoid changes in the petals of 383 population materials.

[0023] Figure 2The GWAS results and haplotype analysis of the gene GhBGLU; in the figure, a is a Manhattan plot, the X-axis represents the 26 chromosomes of upland cotton, the scale represents the length of the corresponding chromosome, and the vertical axis represents the logarithm of the P-value of the association analysis significance. The blue dotted line represents the suggestive level threshold, and the orange dotted line represents the statistically significant level threshold. The points in the figure represent an independent SNP; b is the linkage disequilibrium analysis of the chromosome interval where the gene GhBGLU is located. The upper part is a partially enlarged Manhattan plot. The gene structure and physical position of the gene GhBGLU on the chromosome are marked on the x-axis, green represents exons, and the SNP site A11:91213290 connected by the dotted line is used for subsequent haplotype division. The lower part is the SNP linkage correlation R value within the interval. The redder the color, the stronger the linkage relationship between the two SNPs. Figure c shows the difference in mulberry pigment content and agronomic traits between different haplotypes, reflecting the impact of the emergence of this natural variation on mulberry pigment content and agronomic traits. The significance of the difference was calculated by a two-tailed student's t-test.

[0024] Figure 3 The figures are the phenotypic comparison and statistical difference diagrams between the GhBGLU gene silencing and the control group; in the figure, the standard line TM-1 of upland cotton was used as the experimental material, a is the drought test phenotype diagram; b is the statistical diagram of the difference in hydrogen peroxide content between the gene-silenced strain and the normal strain; c is the statistical diagram of the difference in malondialdehyde content between the gene-silenced strain and the normal strain; the significance of the difference was calculated by two-tailed student's t-test; the scale length is 8 cm. DETAILED DESCRIPTION

[0025] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0026] Example 1: Analysis of the accumulation pattern of flavonoids in petals of upland cotton

[0027] In order to analyze the effect of flavonoids in upland cotton petals on cotton drought resistance, we used 383 upland cotton varieties as materials and planted them in Anyang City, Henan Province. All materials were planted in the experimental field in sequence, with two replicates. Petal samples were taken on the day of flowering, which was recorded as 0 DPA. The petals were quickly frozen with liquid nitrogen and then stored in a -80°C refrigerator.

[0028] The petals of cotton at 0 DPA were taken as samples, with 0.5 g fresh weight of each material, and two biological replicates were set. Then, the content of 16 flavonoid compounds in cotton petals was detected by liquid chromatography-mass spectrometry using targeted metabolomics.

[0029] (1) Sample preparation: fresh materials were placed in 2 mL EP tubes, immediately frozen in liquid nitrogen, and stored in a -80°C ultra-low temperature refrigerator. The day before sample preparation, freeze-dried the corresponding tissue material for 16 h, accurately weighed 0.100 g with a 1 / 10,000 balance, crushed into powder with a ball mill, added with extract at a ratio of 0.1 g / mL, vortexed for 15 min, centrifuged in a refrigerated centrifuge at 4°C and 15,000 rpm for 30 min, filtered with a 0.22 μm filter membrane, and 180 μL was placed in a vial for testing using a liquid chromatography-mass spectrometry instrument QTrap4000. The extract was 80% methanol water by volume, containing chrysin as an internal standard.

[0030] (2) On-machine detection: This experimental instrument uses an ESI ion source. The retention time (RT / s) of the detected Q1 parent ion and Q3 fragment ion is compared with the retention time of the standard. The detected ions are qualitatively analyzed. If the retention time is the same, it can be determined to be the same compound. The peak area is integrated, and the concentration of the detected ions is absolutely quantified based on the standard curve. The mobile phases used in the experiment are phase A with a volume fraction of 0.05% formic acid aqueous solution and phase B with a volume fraction of 0.05% formic acid acetonitrile. The experiment uses flavonoid standards as external standards, sets a concentration gradient, and makes a standard curve. At the same time, chrysin in the extract is used as an internal standard to eliminate machine noise and reduce instrument errors.

[0031] Results: A total of 16 flavonoids from 7 categories were detected in the petals. It was found that the content of flavonols was high, while the content of other flavonoids was low, indicating that the metabolism of flavonols in the petals was relatively active. At the same time, it was found that the accumulation of flavonols had obvious group specificity, such as Figure 1 shown.

[0032] Example 2: Discovery of key genes regulating flavonoid content in cotton petals

[0033] (1) Descriptive statistical analysis: By sorting out the data distribution characteristics of all detected flavonoid compounds in the population and performing logarithmic transformation on the absolute content data of each flavonoid, it was found that the flavonoid content in the petals conformed to the normal or approximately normal distribution, which was suitable for subsequent GWAS analysis.

[0034] (2) Metabolite-based genome-wide association analysis: mGWAS was performed with the content of flavonoid metabolites in petals as the target trait. 1,076,652 high-quality SNP data were used to ensure that the minor allele frequency was >0.05 and the missing rate was <0.2. At the same time, a mixed linear model was used to perform mGWAS, and 3778 SNP sites that were highly correlated with flavonoids above the medium significance threshold were identified. At the same time, we drew a Manhattan plot for the content of morin in petals as the target trait, and simultaneously performed LD block analysis and haplotype analysis, such as Figure 2 shown.

[0035] (3) Determination of candidate genes: According to the above results, a total of 18 QTLs co-associated with multiple compounds were identified, including 116 candidate genes. Among them, the gene encoding β-glucosidase (Gh_A11G258100) was co-associated with kaempferol and morin content, and was named as gene GhBGLU. BGLU has β-glucosidase hydrolysis activity and plays an important role in the conversion of flavonoid glycosides and aglycones. Analysis of significant SNPs related to gene GhBGLU showed that a significant SNP (A11:91213290) located in the coding region of gene GhBGLU can lead to the conversion of alanine at position 176 into glutamate. According to this SNP, the population can be divided into two haplotypes: haplotype A (Hap A ) and haplotype C (Hap C ) which has Hap A The materials had higher morin content, but it did not cause significant changes in agronomic traits. Figure 2 shown.

[0036] Example 3: Functional verification of gene GhBGLU

[0037] The nucleotide sequence of the gene GhBGLU is shown in SEQ ID NO.1:

[0038]

[0039] 1. VIGS experiment

[0040] 1. VIGS vector construction

[0041] (1) Cloning of target gene fragment: Use PCR technology to amplify the target gene fragment. Select a sequence with a coding region length of about 300-500 bp, design primers F and R based on the coding region sequence analysis, and amplify the coding region of the gene. The upstream primer GhBGLU-F used is shown in SEQ ID NO.2; the downstream primer GhBGLU-R is shown in SEQ ID NO.3.

[0042] SEQ ID NO. 2: CGGGAATTCCATCCATATGCAGAGACAAAAGG.

[0043] SEQ ID NO. 3: AAAGGTACCCTGTGCTTTGGCTGGTTGAG.

[0044] The amplification reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 sec, annealing at 58°C for 30 sec, extension at 72°C for 30 sec, 34 cycles; and final extension at 72°C for 5 min.

[0045] The target gene fragment is shown in SEQ ID NO.4:

[0046] CATCCATATGCAGAGACAAAAGGAGACAACTTAAACTTGACAATTCCTGAACCAGGGCCAAGCACAATCACAAATGTATGTGGAACTGTGAAATGCGTTGTGGTTGTAGTTTCCGGTCGTCCTGTTGTGATCCAACCTTATGTTGCCTCCATGGAAGCTCTTGTCGCTGCATGGCTGCC AGGAAGCGAGGGTCAAGGAGTTGCTGATGTGTTGTTTGGTGATTTTGGCTTTACTGGCAAGCTTTCATTCACCTGGTTCAAGACTGTTGATCAGTTGCCAATGCATGTTGGAGATCCACATTATGATCCCCTCTTCCCATTAGGATTTGGCCTCACCACTCAACCAGCCAAAGCACAG.

[0047] (2) Construction of VIGS vector: The cloned SEQ ID NO.4 sequence was inserted into the pTRV2 vector using DNA recombination technology to obtain the VIGS vector, which was then sequenced to ensure that the vector was constructed correctly.

[0048] (3) Transformation of host cells: The universal vector pTRV1 and the constructed VIGS vector were transformed into Escherichia coli and identified.

[0049] 2. Virus reproduction and infection

[0050] (1) Transformation of Agrobacterium: pTRV1 vector and VIGS vector were extracted from Escherichia coli and transformed into Agrobacterium GV3101.

[0051] (2) Virus propagation: The Agrobacterium solution containing pTRV1 was resuspended in VIGS buffer to obtain mixed solution 1, and the Agrobacterium solution containing the VIGS vector was resuspended in VIGS buffer to obtain mixed solution 2. Mixed solution 1 and mixed solution 2 were mixed in equal proportions and activated at 28°C for 3 h to obtain a virus suspension. The VIGS buffer contained 10 mmol / L MgCl2, 10 mmol / L MES and 200 μmol / L AS. The solvent was deionized water and the pH was 5.6.

[0052] (3) Virus infection: Weigh an equal amount of soil to cultivate seedlings. One week later, inject the virus suspension obtained by propagation into the cotyledons of 1-week-old upland cotton TM-1 seedlings. The upland cotton TM-1 seedlings are used as the receptor material for gene silencing. In this experiment, TRV::00 (empty vector) is used to infect the receptor material as a negative control.

[0053] 3. Drought resistance testing

[0054] After infection, the soil was allowed to fully absorb water, and excess water was poured off after one day until drought stress occurred. It was observed that the leaves of the gene-silenced material wilted to a certain extent under drought conditions. The contents of H2O2 and malondialdehyde (MDA) were measured at the same time. The kits used were H2O2TestKit and MDATestKit produced by Grace Biotechnology, with item numbers G0112W and G0110W respectively. The measurement method was carried out in full accordance with the kit manual. The results showed that the contents of H2O2 and malondialdehyde (MDA) increased significantly compared with the control group, indicating that the expression of the gene GhBGLU can indeed improve the drought resistance of cotton plants, such as Figure 3 shown.

[0055] Although preferred embodiments of the present invention have been described, additional changes and modifications may occur to these embodiments once those skilled in the art are aware of the basic inventive concepts.

[0056] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A gene GhBGLU for regulating the content of flavonoids, characterized in that: The nucleotide sequence of the gene GhBGLU is shown in SEQ ID NO.1, and the coding region sequence is shown in SEQ ID NO.

4.

2. A VIGS vector comprising the gene GhBGLU according to claim 1, characterized in that: The gene GhBGLU fragment shown in SEQ ID NO.4 was inserted into the EcoR1 and Kpn1 restriction sites of the overexpression vector pTRV2 to obtain the fragment.

3. The VIGS vector of the gene GhBGLU according to claim 2, characterized in that: The amplification primers for the gene GhBGLU fragment shown in SEQ ID NO.4 include GhBGLU-F shown in SEQ ID NO.2 and GhBGLU-R shown in SEQ ID NO.

3.

4. A recombinant cell, characterized in that The recombinant cell is obtained by transforming the VIGS vector according to claim 3 into a host cell.

5. Use of the gene GhBGLU according to claim 1, the VIGS vector according to any one of claims 2 to 3, or the recombinant cell according to claim 4 in cotton breeding.

6. The use according to claim 5, characterized in that: The gene GhBGLU is used to increase the content of flavonoid compounds and improve the drought resistance of upland cotton.

7. The use according to claim 5, characterized in that: The VIGS carrier is used to increase the content of H2O2 and malondialdehyde in upland cotton.

8. A method for improving drought tolerance of upland cotton, characterized in that: The gene GhBGLU fragment shown in SEQ ID NO.4 described in claim 1 is inserted into the EcoR1 and Kpn1 restriction sites of the overexpression vector pTRV2 to obtain a VIGS vector, which is transformed into a host cell, and the positive plasmid is extracted and transformed into Agrobacterium, and the cotyledons of upland cotton seedlings are infected with Agrobacterium to obtain drought-resistant transgenic upland cotton.

9. The method for improving drought tolerance of upland cotton according to claim 8, characterized in that: The infection requires a virus suspension, which is obtained by resuspending a pTRV1 Agrobacterium solution in VIGS buffer to obtain a mixed solution 1, resuspending a VIGS vector Agrobacterium solution in VIGS buffer to obtain a mixed solution 2, and mixing the mixed solution 1 and the mixed solution 2 and activating them.

10. The method for improving drought tolerance of upland cotton according to claim 9, characterized in that: The VIGS buffer contains MgCl2, MES and AS, the solvent is deionized water and the pH is 5.6-6.0.

Images