Application of feather needle grass beta-glucosidase gene SpBGLU25 in improving plant drought resistance
By cloning and expressing the β-glucosidase gene SpBGLU25 of *Arabidopsis thaliana*, the gap in drought resistance gene research of *Arabidopsis thaliana* was filled, enhancing the drought resistance of *Arabidopsis thaliana* in arid environments, revealing its stress resistance mechanism and improving the plant's stress tolerance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-22
- Publication Date
- 2026-03-24
AI Technical Summary
Current research on drought-resistant genes in *Symplocos rubrum* is lacking, particularly the application of its β-glucosidase in plant drought stress has not been fully explored, limiting the plant's growth and ecological restoration potential in arid environments.
The β-glucosidase gene SpBGLU25 of *Arabidopsis thaliana* was cloned and expressed. A recombinant plasmid was constructed and transformed into plants to achieve overexpression of the gene in *Arabidopsis thaliana*, thereby enhancing the plant's resistance to drought stress.
Overexpression of the SpBGLU25 gene significantly improved the drought stress resistance of plants, revealing the stress resistance mechanism of *Symplocos pubescens*, enriching the molecular biology theory of plant stress resistance, and enhancing the plant's stress tolerance.
Smart Images

Figure CN119842758B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic engineering, in particular to the application of feather needle grass beta-glucosidase gene SpBGLU25 in improving plant drought resistance. BACKGROUND
[0002] Drought is a major non-biological factor limiting plant growth and development. According to statistics, one-third of the land in China is in a drought area. Soil water deficit can cause cell membrane damage, photosynthesis and respiration rate to decrease, and growth to be inhibited in plants, and even cause plant death in severe cases.
[0003] Stipagrostis pennata is a pioneer sand-fixing plant widely distributed in sand dunes. Due to its dry growing environment, low precipitation, severe wind erosion, and high degree of land desertification, S. pennata has the characteristics of drought tolerance, wind erosion tolerance, and sand burial tolerance. S. pennata has special sand cover structure, which can well adapt to extreme environments such as drought and high temperature, and can effectively improve the stability of sand dunes and increase plant diversity, and has the potential for ecological restoration. Therefore, the study of the drought-tolerant plant S. pennata has important scientific value and great practical significance.
[0004] β-Glucosidases belong to the class of hydrolases and are members of the glycosyl hydrolase family I. They participate in plant metabolism and regulate plant growth and development by catalyzing the hydrolysis of β-glycosidic bonds. Based on amino acid sequence and conserved domain similarity, β-glucosidases in plants can be divided into eight families: GH1 (glycoside hydrolase (GH) families 1), GH3, GH5, GH7, GH9, GH12, GH35, and GH116. The GH1 family has the most glycosidase members, and its proteins have transglycosidase activity, capable of synthesizing glycosides. In higher plants, these genes exist as gene families on chromosomes. Studies have shown that there are 48 BGLU genes in Arabidopsis and 40 in rice. Most AtBGLU family genes in Arabidopsis are regulated by salt and drought stress, while OsBGLU family genes in rice are insensitive to salt stress induction, with only a few genes induced by drought stress. This indicates that BGLU family genes are involved in plant responses to external stresses. In plants, β-glucosidases participate in various physiological processes, such as plant defense responses to adversity, hormone metabolism, cell wall lignification, and carbohydrate metabolism. Lignin is an important component of the cell wall, enhancing plant tolerance to drought, salt, and other stresses. β-glucosidases maintain the secondary structure of the cell wall by degrading oligosaccharides and releasing lignin monomers from glycosides. Recent studies have preliminarily demonstrated that the β-glucosidase AtBG1 can hydrolyze ABA-GE (ABA-glucose ester) to produce biologically active free ABA, participating in plant dehydration stress responses. In studies on polysaccharide metabolism, β-glucosidase genes are involved in polysaccharide metabolism through metabolomics analysis, and through their effects on polysaccharide metabolism, they participate in multiple processes, including the development of rice leaves, seeds, and other organs, as well as adversity resistance. Studies have found that β-glucosidase is involved in the EMP glycolysis pathway and participates in the sugar metabolism of organisms, making a significant contribution to the maintenance of normal physiological functions.
[0005] Currently, research on *Symplocos pubescens* is scarce both domestically and internationally, particularly regarding drought-resistance genes. Exploring β-glucosidase in *Symplocos pubescens* and its physiological processes within the plant, investigating its function in sandy dovetail development, and understanding its mechanisms of adaptation to extreme drought are crucial for expanding plant drought-resistance gene resources. Summary of the Invention
[0006] The purpose of this invention is to provide the application of the β-glucosidase gene SpBGLU25 in *Symplocos rubrum* in improving plant drought resistance, thereby addressing the problems existing in the prior art. This invention discovers a novel β-glucosidase BGLU25 in *Symplocos rubrum*, named SpBGLU25, and verifies in transgenic plants that this gene has an important function in enhancing the plant's resistance to drought stress. This is of great significance for revealing the stress resistance mechanism of *Symplocos rubrum*, enriching the molecular biology theory of plant stress resistance, and improving the plant's stress tolerance.
[0007] To achieve the above objectives, the present invention provides the following solution:
[0008] This invention provides a β-glucosidase gene SpBGLU25 of *Potamogeton crispus*, the CDS sequence of which is shown in SEQ ID NO.5.
[0009] The present invention also provides a protein encoded by the β-glucosidase gene SpBGLU25, the amino acid sequence of which is shown in SEQ ID NO.6.
[0010] The present invention also provides a recombinant plasmid containing the β-glucosidase gene SpBGLU25.
[0011] The present invention also provides a recombinant bacterium containing the recombinant plasmid.
[0012] The present invention also provides the application of the β-glucosidase gene SpBGLU25, the protein, the recombinant plasmid, or the recombinant bacteria in enhancing the drought stress resistance of plants.
[0013] The present invention also provides the application of the β-glucosidase gene SpBGLU25, the protein, the recombinant plasmid, or the recombinant bacteria in cultivating plants with strong resistance to drought stress.
[0014] Optionally, the plant includes Arabidopsis thaliana.
[0015] The present invention also provides a method for enhancing the drought stress resistance of plants, comprising the step of introducing the β-glucosidase gene SpBGLU25 into plants to overexpress the β-glucosidase gene SpBGLU25.
[0016] The present invention also provides a method for cultivating plants with strong resistance to drought stress, comprising the step of introducing the β-glucosidase gene SpBGLU25 into a plant to obtain a transgenic plant overexpressing the β-glucosidase gene SpBGLU25.
[0017] Optionally, the plant includes Arabidopsis thaliana.
[0018] The present invention discloses the following technical effects:
[0019] This invention discovered a novel β-glucosidase, BGLU25, in *Symplocos rubrum*, and named it SpBGLU25. A plant expression vector for this gene was successfully constructed and transformed, and the gene's important function in enhancing plant resistance to drought stress was verified in transgenic plants. This invention is of great significance for elucidating the stress resistance mechanism of *Symplocos rubrum*, enriching the molecular biology theory of plant stress resistance, and improving plant tolerance to stress. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 Gel electrophoresis image of PCR amplification products of the SpBGLU25 gene CDS sequence; where M is the marker and 1-2 are PCR amplification products.
[0022] Figure 2 Gel electrophoresis image of PCR products of Agrobacterium monoclonal strain transformed with SpBGLU25 gene overexpression vector; where M is Marker, and 1-9 are positive monoclonal clones.
[0023] Figure 3 Figure 1 shows the gel electrophoresis results of PCR products of Arabidopsis thaliana overexpressing the SpBGLU25 gene; where M is the marker and 1-7 are the selected transgenic plants.
[0024] Figure 4 The phenotypes of four Arabidopsis species after 12 h of treatment with 20% PEG were shown; CK was the control group with normal culture, and PEG was the drought stress group treated with 20% PEG for 12 h. Detailed Implementation
[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0027] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0028] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0029] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0030] The total RNA extraction kit, cDNA first-strand reverse transcription kit, 2×TaqPCRMaster Mix II, DNA gel extraction kit, and plasmid extraction kit used in this invention were all purchased from TIANGEN Biotech. The pMD-19T cloning vector and Real-time PCR reagent were purchased from TaKaRa Biotech. Kpn I, Xba I, and other related enzymes were purchased from TaKaRa Biotech. The chemical reagents, including penicillin ampicillin, kanamycin, gentamicin, MES, acetylsuccione, MgCl2, and culture medium preparation reagents, were all domestically produced analytical grade and purchased from Shanghai Sangon Biotech Co., Ltd. The competent Escherichia coli strain DH 5α was purchased from Beijing TransGen Biotech Co., Ltd. The synthesis of PCR primers and DNA sequencing were performed by Xinjiang Youkang Biotechnology Co., Ltd. and Shanghai Sangon Biotech Co., Ltd.
[0031] Biological materials used in the experiment:
[0032] Agrobacterium strain GV 3101 and plant expression vector pCAMBIA 1300 were provided by the Key Laboratory of Agricultural Biotechnology, College of Life Sciences, Shihezi University, Xinjiang. They can also be obtained by the public through any open channels.
[0033] Arabidopsis mutant material: The Atbglu25 gene deletion mutant is numbered AT1G26560 (publicly available at https: / / www.arabidopsis.org / pagenotfound). The mutant material was purchased from AraShare Science, publicly available at https: / / www.arashare.cn / index / Product / index.html.
[0034] Example 1: Cloning of the SpBGLU25 gene of *Hemiberlesia lataniae* β-glucosidase
[0035] 1. Cultivation and planting of *Symplocos pubescens*
[0036] Seeds of *Symplocos pubescens* were collected in June in the desert near Mosuowan Reservoir in Shihezi City, Xinjiang Uygur Autonomous Region, under bags. After drying the collected seeds and removing the seed coat, the seeds were soaked in gibberellin for 24 hours and then planted in sand at a depth of 1 cm. Samples were collected 45 days later for later use.
[0037] 2. Extraction of total RNA and synthesis of cDNA from *Symplocos rubrum*
[0038] Total RNA was extracted from the collected *Gnaphalium affine* samples using a total RNA extraction kit, following the instructions of the TIANGEN plant total RNA extraction kit. After extraction, RNA integrity was assessed by 1.1% agarose gel electrophoresis, and RNA concentration was determined. cDNA was then synthesized using a reverse transcription kit. The samples were stored at -20°C.
[0039] 3. Cloning of the β-glucosidase gene SpBGLU25 in *Hemiberlesia lataniae*
[0040] Primers SpBGLU25-F and SpBGLU25-R, as well as homologous arm primers SpBGLU25-tong-F and SpBGLU25-tong-R containing KpnI and XbaI restriction sites, were designed. PCR amplification was performed using *Hemiberlesia argyi* cDNA as a template. The reaction system was as follows: cDNA (50 ng / μL) -12 μL of PCR master mix, 25 μL of primer SpBGLU25-F, 2 μL of primer SpBGLU25-R, and 19 μL of ddH2O, totaling 50 μL. The amplification program was: 95℃ for 5 min; 95℃ for 30 s, 56℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min; stored at 4℃. The target band was detected and recovered using 1.2% agarose gel electrophoresis. Figure 1 The sample was sent to Xinjiang Youkang Biotechnology Co., Ltd. for sequencing. The primer sequences and the CDS sequence of the amplified SpBGLU25 gene are as follows.
[0041] SpBGLU25-F: 5'-ATGGAAGTACTTTGTGAAACC-3', SEQ ID NO.1;
[0042] SpBGLU25-R: 5'-CCTGGCGGTCATTGTCAT-3', SEQ ID NO. 2.
[0043] SpBGLU25-tong-F: attggagaggacagggtaccATGAAGGACATTGGCATGGATG, SEQ ID NO.3; SpBGLU25-tong-R: ggtactagtgtcgactctagaAAGTCCATTGCTCGTGATGCTG, SEQ ID NO.4.
[0044] SpBGLU25 gene CDS sequence (SEQ ID NO.5):
[0045] ATGAAGGACATTGGCATGGATGCTTACCGGTTCTCTATTTCATGGTCACGTATCTTTCCAAATGGAACAGGTGAACCTAATGAAGAAGGATTGAATTACTACAACAGCCTCATTGATGCTCTATTAGATAAAGGTATACAACCATATGTAACACTATTTCACTGGGATCTTCCGCAAGCACTAGAAGACAAATATGGTGGATGGTTAAACTCCCAAATTGTGGAGGATTTTGTTCAATTTGCCTCTACTTGCTTCAAGGAATTCGGAGATAGAGTGAAACACTGGATCACTTTCAATGAGCCCCACAACTTTGCAATTGAAGGTTATGACCTTGGCATCCAAGCACCTGGGAGATGTTCAATTATGTCACATCTGTTCTGTAGGGAGGGTAAATCATCGACTGAACCATATATTGTAGCTCACAACATACTCTTAGCTCATGCTGGTGCTTTTCATACTTACAAGCAACATTTCAAGAAAGAACAAGGAGGCCTCATTGGAATTTCACTTAATTCAAAGTGGTATGAACCATTTTCAGATGCTAATGAAGACAGAGGCAGCATCACGAGCAATGGACTTTGA。
[0046] Amino acid sequence encoded by the CDS sequence of the SpBGLU25 gene (SEQ ID NO.6):
[0047] MKDIGMDAYRFSISWSRIFPNGTGEPNEEGLNYYNSLIDALLDKGIQPYVTLFHWDLPQALEDKYGGWLNSQIVEDFVQFASTCFKEFGDRVKHWITFNEPHNFAIEGYDLGIQAPGRCSIMSHLFCREGKSSTEPYIVAHNILLAHAGAFHTYKQHFKKEQGGLIGISLNSKWYEPFSDANEDRGSITSNGL。
[0048] Example 2 Construction of the plant expression vector of the SpBGLU25 gene
[0049] Using the CDS sequence of the SpBGLU25 gene as a template, PCR amplification was performed using homologous arm primers SpBGLU25-tong-F and SpBGLU25-tong-R. The amplification system and procedure were the same as in Example 1. The PCR products were excised from the gel and sequenced, then compared with the original sequence. Once the alignment was correct, the sequence was used for further processing.
[0050] The plant expression vector pCAMBIA1300 containing the 35S promoter was double-digested with Kpn I and Xba I to obtain the vector fragment. The vector fragment was recovered. The gel-recovered product, after correct alignment, was ligated to the double-digested vector fragment using a homologous recombination kit. The reaction system was: 2 μL vector fragment; 3 μL target gene fragment; 5 μL C1162×CE Mix; the reaction program was 50℃ for 30 min. The reaction product was plated on LB solid medium containing ampicillin and incubated at 37℃ for 12 h. After incubation, positive single colonies were picked for colony PCR verification and then sent to Xinjiang Youkang Biotechnology Co., Ltd. for testing.
[0051] Example 3 Agrobacterium transformation
[0052] The submitted sequence was compared with the original sequence using SnapGene. Plasmids were extracted from the bacterial culture that matched correctly according to the plasmid extraction kit instructions. The plasmids were then transformed into Agrobacterium GV 3101 using the freeze-thaw method, in a solution containing triple antibodies (Gen 50 μg / mL). -1 Kan 50μg·mL -1 Rif 50 μg·mL -1 Spread the bacteria onto LB solid medium and incubate at 28°C for 36-48 hours. Select single colonies for colony PCR verification. Figure 2 The verified Agrobacterium tumefaciens solution is then preserved.
[0053] Example 4: Inoculation of Arabidopsis thaliana using the dripping method
[0054] Wild-type and Atbglu25 gene deletion mutant Arabidopsis seeds were sterilized and sown in 1 / 2 MS medium. Ten days later, the seedlings were transplanted into nutrient soil. Transformation was carried out after the seedlings bolted twenty days later.
[0055] Preparation of inoculum: Agrobacterium tumefaciens identified as containing the target gene was cultured overnight at 28°C in LB liquid medium containing triple antibodies (50 mg / L Kan, 50 mg / L Gen, 50 mg / L L LRif). The bacterial culture was then centrifuged at 25°C, 5000 rpm for 5 min. The supernatant was discarded, and the precipitate was resuspended in 1 / 2 MS liquid (5% sucrose + 0.02% Silwet L-77) to allow OD to adjust. 600The concentration was set to approximately 0.6. The inflorescences were immersed in the infection solution for 1 minute, then the residual solution was removed. The infected Arabidopsis were then cultured in the dark for 24 hours, followed by normal culture. Infection was repeated weekly until no inflorescences remained. After infection, the Arabidopsis were placed under normal light. Once the pods matured, the seeds were collected for subsequent screening experiments.
[0056] Example 5: Identification of transgenic Arabidopsis thaliana
[0057] The collected infected Arabidopsis seeds were sown on 1 / 2 MS (containing 4% hygromycin) solid medium under sterile conditions using standard planting methods. After two to three weeks of growth in an artificial climate chamber, untransformed Arabidopsis seedlings gradually turned white and died, while successfully transformed seedlings grew normally. The normally growing Arabidopsis were then transferred to culture soil for further cultivation. DNA was then extracted from the initially screened Arabidopsis seedlings for PCR identification. Figure 3 ).
[0058] Four species of Arabidopsis thaliana were subjected to 12 hours of 20% PEG drought stress: wild-type Arabidopsis thaliana (WT), Arabidopsis thaliana overexpressing the SpBGLU25 gene (SpBGLU25), Arabidopsis thaliana Atbglu25 gene deletion mutant (atbglu25), and Arabidopsis thaliana overexpressing the SpBGLU25 gene Atbglu25 gene deletion mutant (SpBGLU25-atbglu25). The results showed that the Arabidopsis thaliana Atbglu25 gene mutant exhibited the most severe wilting and drying, followed by wild-type Arabidopsis thaliana. Arabidopsis thaliana overexpressing the SpBGLU25 gene showed the best resistance to drought stress, followed by the Arabidopsis thaliana Atbglu25 gene mutant (SpBGLU25-atbglu25). Figure 4 This indicates that the SpBGLU25 gene can indeed increase the plant's resistance to drought stress.
[0059] This invention not only yielded the SpBGLU25 gene of *Symplocos rubra*, but also successfully constructed and transformed its plant expression vector. The important function of this gene in increasing drought stress resistance was investigated in transgenic plants. This is of great significance for revealing the stress resistance mechanism of *Symplocos rubra*, enriching the molecular biology theory of plant stress resistance, and improving the stress tolerance of plants.
[0060] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A β-glucosidase gene SpBGLU25 of *Potamogeton crispus*, characterized in that, The CDS sequence of the β-glucosidase gene SpBGLU25 is shown in SEQ ID NO.
5.
2. The protein encoded by the β-glucosidase gene SpBGLU25 according to claim 1, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.
6.
3. A recombinant plasmid comprising the β-glucosidase gene SpBGLU25 as described in claim 1.
4. A recombinant bacterium comprising the recombinant plasmid of claim 3.
5. The application of the β-glucosidase gene SpBGLU25 according to claim 1, the protein according to claim 2, the recombinant plasmid according to claim 3, or the recombinant bacteria according to claim 4 in enhancing the drought stress resistance of plants, characterized in that, Overexpression of the β-glucosidase gene SpBGLU25 enhances the plant's resistance to drought stress; the plant is Arabidopsis thaliana.
6. The application of the β-glucosidase gene SpBGLU25 according to claim 1, the protein according to claim 2, the recombinant plasmid according to claim 3, or the recombinant bacteria according to claim 4 in cultivating plants with strong resistance to drought stress, characterized in that, The β-glucosidase gene SpBGLU25 was introduced into the plant and stably overexpressed. After overexpression, the drought stress resistance of the plant was enhanced. The plant was Arabidopsis thaliana.
7. A method for enhancing the drought stress resistance of plants, characterized in that, The method includes the step of introducing the β-glucosidase gene SpBGLU25 as described in claim 1 into a plant to overexpress the β-glucosidase gene SpBGLU25; the plant is Arabidopsis thaliana.
8. A method for cultivating plants with strong resistance to drought stress, characterized in that, The method includes the step of introducing the β-glucosidase gene SpBGLU25 as described in claim 1 into a plant to obtain a transgenic plant overexpressing the β-glucosidase gene SpBGLU25; wherein the plant is Arabidopsis thaliana.
Citation Information
Patent Citations
Method for improving germination percentage of stipagrostis pennata seeds
CN108633377A
Application of AsBgluc 1 gene in improvement of plant drought tolerance
CN115976074A