Application of ppt1 gene in high-yield gibberellin GA4 and GA7

Abstract

The invention provides an application of a ppt1 gene in high yield of gibberellin GA4 and GA7. The application method comprises the step of expressing the ppt1 expression cassette in filamentous fungi in a manner of constructing expression plasmids. Through overexpression of an important gene ppt1 in a lysine synthesis route in filamentous fungi, the optimized strain only produces intermediate metabolites GA4 and GA7, and does not produce a metabolic end product GA3. The method is simple to operate and remarkable in effect, and a new way is provided for construction of high-yield GA4 and GA7 engineering strains. Compared with wild gibberellic gibberellic acid, the gibberellic gibberellic acid genetically engineered bacterium provided by the invention can more efficiently perform fermentation production of GA4 and GA7, so that the yield of a GA4 + 7 mixture is increased to 36 times.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of ppt1 gene in high-yield gibberellins GA4 and GA7. Background Art

[0002] Gibberellic acid is an endogenous growth regulator widely found in plants. It participates in many biological processes of plant growth and development and plays an important regulatory role in plant growth and development. So far, 136 types of gibberellins have been found in various organisms. Currently, only a few types of gibberellins such as free GA1, GA3, GA4 and GA7 have strong physiological activity. Among them, GA3 has the highest activity and the widest application. It is currently the only commercially large-scale produced gibberellin product. However, GA3 is too active and excessive use can cause plants to grow wildly. In recent years, GA 4+7 GA4 has attracted attention in its applications in flower and fruit preservation and dormancy breaking. When promoting the growth of stems and leaves of dwarf crops, GA4 has shown better activity than GA3; when used to adjust fruit shape, GA 4+7 Because of its higher activity and more direct effect, it is increasingly widely used as a plant growth regulator in agricultural and forestry production processes.

[0003] The main gibberellins on the market are GA3 and mixed dosage forms of GA 4+7 , however, currently GA 4+7 The production capacity is low, but its application scope is expanding, and the market demand is gradually increasing, making GA 4+7 The market price is about three times that of GA3, and the market price of the mixed dosage form rich in GA7 is more than 20% higher than that of the dosage form with the same content of GA4.

[0004] In the prior art, methods such as inference breeding and metabolic engineering directional transformation are usually used to improve gibberellin GA 4+7 For example, by knocking out the relevant enzymes or genes in the metabolic pathway using the gene knockout method, a mixed dosage form GA without gibberellin GA3 can be obtained. 4+7 Although the CRISPR / Cas9 system has been introduced and successfully used for genetic modification of filamentous fungi, the filamentous fungi have complex structures and often have multiple nuclei per cell, so the knockout efficiency of the CRISPR / Cas9 system in filamentous fungi is very low. 4+7 It is difficult to produce in industrial production and has low output, which cannot meet market demand and limits its large-scale application. Summary of the invention

[0005] In order to solve the problem of GA 4+7In order to solve the problem of high difficulty and low yield in industrial production, the present invention provides the application of ppt1 gene in high-yield gibberellin GA4 and GA7. By overexpressing ppt1, an important gene in the lysine synthesis pathway in filamentous fungi, the optimized strain only produces intermediate metabolites GA4 and GA7, but not the metabolic end product GA3, and GA 4+7 The yield of the mixture can reach 934.5 mg / L. The application method is simple to operate and has significant effects, providing a feasible route for the construction of high-yield GA4 and GA7 engineering strains.

[0006] The technical scheme adopted by the present invention is: the application of ppt1 gene in filamentous fungi to produce high gibberellins GA4 and / or GA7. ppt1 gene, i.e. phosphopantetheinyltransferase encoding gene, encodes Sfp type phosphopantetheinyltransferase (PPTase) protein involved in the biosynthesis of lysine, regulates the activity of polyketide synthase and non-ribosomal polypeptide synthetase, and modifies enzymes related to the synthesis pathway of multiple secondary metabolites. PPTase can perform post-translational modification of 4'-phosphopantethein transfer on the ACP domain, i.e. phosphopantetheinylation. The ppt1 gene encoding the enzyme is widely present in some filamentous fungi, such as Gibberella fujikura, Beauveria bassiana, etc., and plays an important regulatory role in the synthesis of multiple primary metabolisms and secondary metabolisms, such as protein modification of amino acid synthetase, polyketide synthase, and non-ribosomal polypeptide synthase, transferring the phosphopantetheinyl group on coenzyme A to the conserved serine residue of the above-mentioned protein, thereby synthesizing fatty acids, polyketides, and non-ribosomal peptides.

[0007] Specifically, the application method is: the ppt1 expression frame is transformed into filamentous fungi for expression. By overexpressing ppt1, an important gene in the lysine synthesis pathway in filamentous fungi, the optimized strain only produces intermediate metabolites GA4 and GA7, but not the metabolic end product GA3.

[0008] Furthermore, the ppt1 expression cassette includes a promoter, a ppt1 gene, and a terminator. The ppt1 expression cassette generally includes important regulatory sequences and functional regions that serve the target ppt1 gene, which helps to maintain the structural and functional integrity of the target gene. For example, the ppt1 expression cassette described in the present invention includes a promoter with a length of 1000 to 1200 bp, which can promote the transcription and translation of the target ppt1 gene in the host cell, making the expression efficiency higher and ultimately achieving the effect of overexpression. It is worth noting that due to the particularity of the nucleotide sequence, the ppt1 expression cassette referred to in the present invention may have polynucleotide variants, including polynucleotide variants of the promoter and polynucleotide variants of the ppt1 gene. Any polynucleotide variant shown in the present invention, as long as it has more than 90% homology with the aforementioned polynucleotide, belongs to the scope of protection of the present invention. The polynucleotide variant refers to a polynucleotide sequence with one or more nucleotide changes. This polynucleotide variant can be a natural positional variant or a non-natural variant, including a substitution variant, a deletion variant, and an insertion variant. As known in the art, an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion or insertion of a polynucleotide, but will not substantially change the function of the peptide protein encoded by it. For different filamentous fungi with gibberellin synthesis ability, the application method should select the ppt1 expression frame for the filamentous fungi.

[0009] Preferably, the filamentous fungus includes Fusarium fujikuroi. The ppt1 gene is widely present in fungi such as Fusarium graminearum, Fusarium moniliforme, Beauveria bassiana, and Fusarium fujikuroi, and is mainly involved in the biosynthesis of lysine, and the above-mentioned fungi are known to cause plant gibberellosis. At present, the industrial production of gibberellins mainly depends on the liquid fermentation of Fusarium fujikuroi. In addition, some species belonging to the genus Fusarium, such as Fusarium moniliforme, and species of Aspergillus, such as Aspergillus niger, have also been confirmed to have the potential for industrial synthesis of gibberellins. Stable and high-yield strains are crucial for industrial production. The present invention specifically provides the application of the ppt1 gene in the high-yield gibberellins GA4 and / or GA7 of Fusarium fujikuroi. The application method provided by the present invention can also be implemented in the above-mentioned filamentous fungi or in strains with the ability to synthesize gibberellins, and the ppt1 gene is overexpressed to increase the yield of metabolites GA4 and GA7 in the metabolic pathway.

[0010] The nucleotide sequence of the ppt1 expression frame includes the nucleotide sequence of the ppt1 gene. For different filamentous fungi with gibberellin synthesis ability, the application method can specifically select the ppt1 expression frame for the filamentous fungi. The filamentous fungi specifically involved in the present invention is Gibberella fujikura, the nucleotide sequence of the ppt1 gene of Sfp-type Gibberella fujikura is shown in SEQ ID NO.1, and the nucleotide sequence of the ppt1 expression frame for the Gibberella fujikura is shown in SEQ ID NO.2.

[0011] The present invention also provides a Fujikura Gibberella gene engineering bacterium with high production of gibberellins GA4 and GA7, which is obtained by the following method: constructing a ppt1 expression frame into an expression vector and then transforming it into Fujikura Gibberella.

[0012] Specifically, the expression plasmid also includes a resistance screening gene. The resistance screening gene generally includes hygromycin resistance gene Hygr, geneticin resistance gene G418, bleomycin resistance gene bleoR, etc. By introducing the resistance screening gene into the plasmid, only the successfully transformed transformants can grow in a culture medium containing the corresponding resistance substance, thereby effectively screening and separating positive transformants.

[0013] Preferably, the resistance screening gene includes the hygromycin resistance gene Hygr.

[0014] Furthermore, the Fujikura Gibberella genetically engineered bacteria is preferably constructed by the following method: constructing the ppt1 expression frame into an expression plasmid, and using polyethylene glycol (PEG) mediation to transfer the expression plasmid with the ppt1 expression frame into wild Fujikura Gibberella protoplasts. And transform it into Fujikura Gibberella. The PEG-mediated method is a simple method and is commonly used for the transformation of Fujikura Gibberella. This method increases the permeability of the cell membrane by treating with a CaCl2-PEG mixed solution, so that the cell is in an active state that is easy to accept external nucleic acid fragments or plasmids.

[0015] The present invention also provides a method for overexpressing the ppt1 gene to highly produce gibberellins GA4 and GA7, comprising the following steps: constructing a ppt1 expression frame into an expression vector and then transforming the vector into the protoplasts of Gibberella fujikura to obtain transformants, using hygromycin resistance as a screening marker, and fermenting and culturing the obtained positive transformants to prepare GA4 and GA7.

[0016] Preferably, the resistance screening gene is the hygromycin resistance gene Hygr.

[0017] Furthermore, the method is preferably carried out according to the following steps:

[0018] The ppt1 expression frame was constructed into the expression plasmid, and the expression plasmid was transformed into the protoplasts of Gibberella fujikura through the PEG-mediated method. Hygromycin resistance was used as a screening marker, and the positive transformants obtained by screening were verified by PCR and sequenced for rescreening. The verified positive transformants were fermented and cultured to prepare GA4 and GA7.

[0019] Beneficial effects of the present invention: The present invention provides an application of the ppt1 gene in high-yield gibberellins GA4 and GA7. By overexpressing the key gene ppt1 in the lysine synthesis pathway in filamentous fungi, the yields of gibberellins intermediate metabolites GA4 and GA7 in filamentous fungi are increased, and the yield of gibberellins final product GA3 is reduced to 0. The method is simple to operate and has significant effects, and provides a new approach for the construction of high-yield GA4 and GA7 engineering strains. Compared with wild-type Fujikura Gibberella, the Fujikura Gibberella genetically engineered bacteria provided by the present invention can more efficiently carry out the fermentation production of GA4 and GA7, making GA 4+7 The yield of the mixture was increased by 36 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a schematic diagram of the construction of the pOEorippt1 vector in Example 1.

[0021] Figure 2 This is a microscope image of the protoplasts of Gibberella fujikura in Example 1.

[0022] Figure 3 This is a comparison chart of the sequencing results of the positive transformants in Example 1.

[0023] Figure 4 The growth conditions of the genetically engineered strains of Gibberella fujikuraensis OE:ppt1-1, 3, 4, 5 with high production of gibberellins GA4 and GA7 in Example 1 on PDA agar plates. DETAILED DESCRIPTION

[0024] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0025] Embodiment 1:

[0026] This embodiment provides the use of the ppt1 gene in high production of gibberellins GA4 and / or GA7 by filamentous fungi.

[0027] This embodiment also provides a genetically engineered bacterium of Gibberella fujikura that produces high levels of gibberellins GA4 and GA7.

[0028] This embodiment also provides a method for overexpressing the ppt1 gene to high-produce gibberellins GA4 and GA7.

[0029] The specific experimental process is as follows.

[0030] Construction of expression plasmid pOEorippt1: Use two pairs of upstream and downstream primers F1, R1, F2, and R2 to amplify the ppt1 expression cassette and hygromycin resistance gene Hygr, respectively, as shown in SEQ ID NO.2. One-step cloning: Connect the previously obtained ppt1 expression cassette gene fragment and hygromycin resistance gene to the linearized vector pOEori to obtain the expression plasmid pOEorippt1. The expression plasmid pOEorippt1 is as shown in Figure 1 As shown, it includes DNA elements such as the ppt1 expression frame containing the ppt1 gene of Fusarium fujikura and the hygromycin resistance gene Hygr. The expression plasmid pOEorippt1 was transferred into Escherichia coli DH5α for storage for subsequent use. Among them, the transformation method of Escherichia coli DH5α is as follows: thaw the competent cells of Escherichia coli DH5α on ice; take 10μL of the recombinant Pcas-ppt1 vector plasmid and add it to 100μL competent cells, gently blow and mix the liquid, and let it stand in an ice bath for 30min; heat shock in a 42℃ water bath for 50s, place it on ice and let it stand for 5min to promote cell membrane contraction; add 600uLLB culture medium and blow and mix, and culture at 37℃, 200rpm for 1h. Pipette 200μL and apply it on the Amp resistance plate; invert it in a 37℃ incubator for 12 to 16h. Before using the pOEorippt1 vector, pick a single colony of Escherichia coli DH5α and place it in a test tube containing 10 mL of LB medium. Culture it in a constant temperature shaker at 30°C for 12 to 14 hours, and then use a plasmid extraction kit to extract the pOEorippt1 vector plasmid.

[0031] Preparation of protoplasts of Gibberella fujikura: Use a sterile toothpick to dig a thumb-sized plaque from PDA (PDA medium: 200 g / L potato, 20 g / L glucose, 15 g / L agar powder) medium of Gibberella fujikura and culture it in YEPD medium (YEPD medium: 30 g / L yeast powder, 10 g / L peptone, 20 g / L glucose) for 2 days. In the clean bench, pour the cultured bacterial solution in YEPD medium into a Buchner funnel padded with double-layer filter paper, filter to dryness, then wash 3 times with 0.8 mol / L sodium chloride solution, and filter until the bacteria are dry. Use a sterile gun tip to scrape about 1 g of bacteria into 10 mL of cell wall enzymatic solution (prepared with 1% Driselase, 2% Yatalase, 1% Snailase, 0.8 M NaCl solution), and enzymatically hydrolyze for 2 to 3 hours at 30°C and 150 rpm, gently inverting every half an hour to mix evenly. Filter the completely enzymatically hydrolyzed bacterial solution through a double layer of Miracloth into a sterilized 50mL centrifuge tube to remove the remaining bacteria and insoluble matter. Add 10mL of 0.8mol / L sodium chloride solution, mix it evenly with a sharpened pipette tip to fully suspend the protoplasts, centrifuge it at 600×g, 4℃ for 10min, and discard the supernatant. Repeat this step twice. Add 10mL of STC solution, mix it evenly with a sharpened pipette tip to fully suspend the protoplasts, centrifuge it at 900×g, 4℃ for 10min, and discard the supernatant. Repeat this step twice. Add 2mL of STC solution, mix it evenly with a sharpened pipette tip to fully suspend the protoplasts and dilute it to 10 7 / mL, and placed in a 4℃ refrigerator for later use. Figure 2 Under the microscope, the cell walls of the hyphae treated with cell wall enzymatic hydrolysis solution were completely enzymatically hydrolyzed to generate round protoplasts.

[0032] The expression plasmid pOEorippt1 was introduced into the protoplasts of Fusarium fujikura by PEG-mediated transformation. The transformation method was as follows: 160 μL of protoplast resuspension, 100 μL of expression plasmid pOEorippt1, and 60 μL of 60% PEG6000 solution were placed in a 2 mL centrifuge tube and mixed evenly. The plasmid and donor fragment needed to reach 10 μg respectively. Positive control group: 160 μL of protoplast resuspension, 100 μL STC solution, and 60 μL of 60% PEG6000 solution were placed in a 2 mL centrifuge tube and mixed evenly. Negative control group: 160 μL of protoplast resuspension, 100 μL STC solution, and 60 μL of 60% PEG6000 solution were placed in a 2 mL centrifuge tube and mixed evenly. The 2 mL centrifuge tube with the above mixture was placed on ice, mixed by inversion every 10 minutes, repeated 3 times, 1.5 mL of 60% PEG6000 solution was added, mixed by pipetting, and allowed to stand at room temperature for 25 minutes. In a 50mL centrifuge tube, add 6mL of soft agar MYG liquid medium containing 100ng / μL hygromycin resistance (MYG: maltose 5g / L, yeast extract 5g / L, glucose 10g / L, sucrose 171g / L, agar 20g / L, solvent is water), 3mL of preheated STC solution and the above transformation system, shake to mix and pour the plate onto MYG hard agar medium with the same hygromycin concentration; transfer the above plate to a 28°C incubator and culture upright for 5 days to obtain positive transformants.

[0033] Positive transformant rescreening: 10 positive transformants were picked with a sterile toothpick and spotted on PDA agar plates, and cultured at 28°C for 3 days; some mycelium was picked with a sterile toothpick and placed in a 2mL centrifuge tube containing 200μL lysis buffer, and the mycelium was fully homogenized with a tissue grinder; the genome of the transformant was crudely extracted using the TSINGKETSP501-50 high-purity plasmid DNA small-scale extraction kit, and the concentration was determined; the genome of the positive transformant was verified by PCR using the verification primers YZppt1F and YZppt1R and sequenced ( Figure 3 ) and obtained genetically engineered bacteria of Gibberella fujikura that can produce high levels of gibberellins GA4 and GA7, namely strains OE:ppt1-1, 3, 4, and 5.

[0034] Gibberellic acid metabolism: Four positive transformants verified by rescreening on PDA agar plates, i.e., the genetically engineered bacteria of Gibberellic acid Fujikura with high production of gibberellins GA4 and GA7 OE: ppt1-1, 3, 4, and 5, were shoveled into sterilized seed culture medium (seed culture medium: corn starch 20 g / L, sucrose 15 g / L, peanut powder 15 g / L, soybean meal 3 g / L, KH2PO4 1 g / L, MgSO4 1 g / L, solvent is water) using a sterile inoculation shovel and shaken at 28°C and 250 rpm for culture. After 2 days of cultivation, the culture medium was transferred to a fermentation medium (fermentation medium: corn starch 75 g / L, rice flour 87.5 g / L, soybean meal 5 g / L, peanut powder 5 g / L, KH2PO4 0.5 g / L, K2SO4 0.5 g / L, MgSO4·7H2O 0.11 g / L, and the solvent was water), with an inoculum size of 6%, and cultured in a shaking table at 28°C and 250 rpm. After 7 days of cultivation, the supernatant of the bacterial liquid was collected and diluted to measure the output of GA3, GA4, and GA7 by high performance liquid chromatography. The results are shown in Table 1.

[0035] Comparative Example 1:

[0036] Wild-type Gibberella fujikurai was fermented and cultured under the same conditions as in Example 1. The supernatant of the bacterial solution was collected and diluted, and the production of GA3, GA4 and GA7 was determined by high performance liquid chromatography. The results are shown in Table 1.

[0037] Table 1. Gibberellic acid metabolism

[0038]

[0039] like Figure 3 As shown in the figure, among all the 10 positive transformants, the GA3 production of OE:ppt1-1, 3, 4, and 5 was 0, while the GA4 and GA7 productions were greatly increased. 4+7 The mixture had the highest yield, reaching 934.5 mg / L, which was 36 times that of the wild-type Fusarium fujikura (Comparative Example 1), and the GA4 yield reached 147 mg / L, and the GA7 yield reached 787.5 mg / L.

[0040] Primer table

[0041] F1:CACTTAACGTTACTGAAATC

[0042] R1:ATCTGGTGCACTCTCAGTACA

[0043] F2: GAGAGTGCACCAGATGCGGAGGTTTCATGGCCATA

[0044] R2: CAGTAACGTTAAGTGTCATGGTTTGGATGCCTGTTC

[0045] YZPPT1F:GTACTGAGAGTGCACCAGAT

[0046] YZPPT1R: TATATCCAGATTCGTCAAGCTG

[0047] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. Application of ppt1 gene in high production of gibberellin GA4 and / or GA7 by filamentous fungi.

2. The use according to claim 1, characterized in that: The application method is: transforming the ppt1 expression frame into filamentous fungi for expression.

3. The use according to claim 2, characterized in that: The ppt1 expression frame includes a promoter, a ppt1 gene, and a terminator.

4. The use according to any one of claims 1 to 3, characterized in that: The filamentous fungi include Gibberella fujikura.

5. The use according to claim 4, characterized in that: The nucleotide sequence of the ppt1 gene is shown in SEQ ID NO.

1.

6. The use according to claim 4, characterized in that: The nucleotide sequence of the ppt1 expression frame is shown in SEQ ID NO.

2.

7. A genetically engineered bacterium of Gibberellin fujikura for high production of gibberellins GA4 and GA7, characterized in that: The ppt1 expression frame was constructed by the following method: the expression vector was transformed into Gibberella fujikura.

8. The genetically engineered bacteria of Gibberella fujikura according to claim 7, characterized in that The expression vector also includes a resistance selection gene.

9. The genetically engineered bacteria of Gibberella fujikura according to claim 8, characterized in that The resistance screening gene includes a hygromycin resistance gene.

10. A method for overexpressing the ppt1 gene to produce high gibberellins GA4 and GA7, characterized in that: The method comprises the following steps: constructing a ppt1 expression frame into an expression vector and then transforming the vector into the protoplast of Gibberella fujikura to obtain transformants, using hygromycin resistance as a screening marker, and fermenting and culturing the obtained positive transformants to synthesize GA4 and GA7.

Images