Application of PagYUCCA6a gene in regulation and control of poplar wood yield

Abstract

The invention relates to the technical field of biology, and particularly discloses application of a PagYUCCA6a gene in regulation and control of poplar wood yield. The PagYUCCA6a gene is cloned by taking a poplar variety 84K as a material and is constructed to an overexpression vector pMDC32, the gene is positioned behind a 35S promoter, and under the driving of the 35S promoter, the PagYUCCA6a can be overexpressed in a poplar body, so that the poplar wood yield is regulated and controlled, the PagYUCCA6a gene is a key gene for regulating and controlling the poplar wood yield, and the PagYUCCA6a gene can be used for regulating and controlling the poplar wood yield. The method has important application value in the field of forest high-yield gene engineering.

Description

Technical Field

[0001] The invention relates to application of PagYUCCA6a gene in regulating poplar wood yield in the field of biotechnology. Background Art

[0002] Poplars grow rapidly and are widely distributed. They are one of the important tree species for establishing artificial forests. In forestry production, poplar wood and its products have important economic value. Poplar stems are the main source of its biomass. The development of poplar stems includes two stages: primary growth and secondary growth. Among them, the accumulation of secondary xylem, the vascular tissue, in the secondary growth stage is directly linked to timber production.

[0003] Auxin has been considered as a key plant hormone regulating wood formation. In angiosperms and gymnosperms, there is an auxin concentration gradient in the vascular tissue, which gradually decreases from the cambium region to the xylem and phloem. It is reported that the application of exogenous auxin can promote secondary growth. How to regulate the development of secondary xylem, increase wood yield, and provide excellent strains for the cultivation of high-yield poplar trees is the problem to be solved by the present invention. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to increase the yield of poplar wood.

[0005] In order to solve the above technical problems, the present invention provides the use of the PagYUCCA6a gene in regulating poplar wood yield, wherein the PagYUCCA6a gene encodes the PagYUCCA6a protein, and the PagYUCCA6a protein is the following protein A1, A2 or A3:

[0006] A1, the amino acid sequence is the protein of SEQ ID No. 2 in the sequence list;

[0007] A2, a protein related to poplar yield obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2 in the sequence list, having more than 80% identity with the protein shown in A1;

[0008] A3: A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1 or A2.

[0009] In the above application, SEQ ID No. 2 in the sequence listing consists of 434 amino acid residues.

[0010] In the above application, identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be obtained.

[0011] In the above applications, the above 80% identity may be at least 81%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0012] In the above application, the PagYUCCA6a protein may be derived from poplar.

[0013] In the above application, the PagYUCCA6a gene may specifically be a DNA molecule whose coding sequence (ORF) of the coding chain is SEQ ID No. 1 in the sequence list.

[0014] In the above application, the regulation may be to increase the yield of poplar by promoting or enhancing the expression of the PagYUCCA6a gene.

[0015] In the above application, the increase in poplar yield can be embodied as the following Y1 and / or Y2:

[0016] Y1. Poplar tree height becomes taller;

[0017] Y2. The width of poplar xylem becomes wider.

[0018] In order to solve the above technical problems, the present invention also provides a plant agent for increasing poplar yield and / or plant height and / or xylem width, wherein the active ingredient of the plant agent is a substance that promotes or increases the abundance of the PagYUCCA6a gene and the PagYUCCA6a protein.

[0019] The active ingredients of the above-mentioned botanical agents may also contain other biological components and / or non-biological components. Those skilled in the art can determine the other active ingredients of the above-mentioned botanical agents based on the effects of increasing poplar yield and / or plant height and / or xylem width.

[0020] In order to solve the above technical problems, the present invention also provides a method for increasing poplar yield, comprising the step of introducing the PagYUCCA6a gene into a recipient poplar to obtain a poplar with increased yield; the yield of the poplar with increased yield is higher than that of the recipient poplar.

[0021] In the above method, the poplar with improved yield can be a transgenic poplar, or a poplar obtained by conventional breeding techniques such as hybridization.

[0022] In order to solve the above technical problems, the present invention also provides a method for increasing the height of poplars, comprising the step of introducing the PagYUCCA6a gene into a recipient poplar to obtain a poplar with increased plant height; the plant height of the poplar with increased plant height is higher than the plant height of the recipient poplar.

[0023] In the above method, the poplar with increased plant height can be a transgenic poplar, or a poplar obtained by conventional breeding techniques such as hybridization.

[0024] In order to solve the above technical problems, the present invention also provides a method for increasing the xylem width of poplar, comprising the step of introducing the PagYUCCA6a gene into a recipient poplar to obtain a poplar with a wider xylem width; the xylem width of the poplar with a wider xylem width is wider than the xylem width of the recipient poplar.

[0025] In the above method, the poplar with wider xylem width may be a transgenic poplar, or a poplar obtained by conventional breeding techniques such as hybridization.

[0026] In the above method, the PagYUCCA6a gene can be modified as follows before being introduced into the recipient poplar to achieve a better expression effect:

[0027] 1) Modifying the gene sequence adjacent to the initiation methionine to allow efficient initiation of translation; for example, using a sequence known to be effective in plants;

[0028] 2) connected to various plant-expressed promoters to facilitate their expression in plants; the promoters may include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and tissue-specific promoters; the choice of promoter will vary with the time and space requirements of expression, and also depends on the target species; for example, a tissue or organ-specific expression promoter, depending on the stage of development at which the receptor is required; although it has been demonstrated that many promoters derived from dicotyledons can function in monocotyledons and vice versa, ideally, dicotyledon promoters are selected for expression in dicotyledons, and monocotyledon promoters are used for expression in monocotyledons; in one embodiment of the present invention, promoter 35S is used to drive the PagYUCCA6a gene;

[0029] 3) Connecting with a suitable transcription terminator can also improve the expression efficiency of the gene of the present invention; for example, tml derived from CaMV, E9 derived from rbcS; any available terminator known to work in plants can be connected with the gene of the present invention;

[0030] 4) Introduction of enhancer sequences, such as intron sequences (e.g. from Adhl and bronzel) and viral leader sequences (e.g. from TMV, MCMV and AMV).

[0031] The PagYUCCA6a gene can be introduced into plant cells by conventional biotechnology methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).

[0032] The present invention also provides a protein, which is the PagYUCCA6a protein.

[0033] The present invention also provides biological materials related to the DNA molecules, which also fall within the protection scope of the present invention.

[0034] The biological material related to the PagYUCCA6a gene provided by the present invention is any one of the following B1 to B6:

[0035] B1, an expression cassette containing the PagYUCCA6a gene;

[0036] B2, a recombinant vector containing the PagYUCCA6a gene, or a recombinant vector containing the expression cassette described in B1;

[0037] B3, a recombinant microorganism containing the PagYUCCA6a gene, or a recombinant microorganism containing the expression cassette described in B1, or a recombinant microorganism containing the recombinant vector described in B2;

[0038] B4, a transgenic plant cell line containing the PagYUCCA6a gene, or a transgenic plant cell line containing the expression cassette of B1;

[0039] B5, transgenic plant tissue containing the PagYUCCA6a gene, or transgenic plant tissue containing the expression cassette described in B1;

[0040] B6. A transgenic plant organ containing the PagYUCCA6a gene, or a transgenic plant organ containing the expression cassette described in B1.

[0041] In the above-mentioned biological material, the expression cassette containing the PagYUCCA6a gene (PagYUCCA6a gene expression cassette) described in B2) refers to a DNA capable of expressing the PagYUCCA6a gene in a host cell, and the DNA may include not only a promoter for initiating transcription of the PagYUCCA6a gene, but also a terminator for terminating transcription of the PagYUCCA6a gene. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiology 120:979-992); the chemically inducible promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); the tomato proteinase inhibitor II promoter (PIN2) or the LAP promoter (both of which can be induced by methyl jasmonate); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (China Patent No. 2007 1 0099169.7)), seed storage protein-specific promoters (e.g., promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in their entirety. Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and nopaline and octopine synthase terminators (see, for example, Odell et al. (1996) EMBO J. 4:3047-3053). 985)Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0042] Available plant expression vector construction contains the recombinant expression vector of the PagYUCCA6a gene expression cassette. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, etc. Such as pMDC32, pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA company), etc. The plant expression vector can also include the 3' end non-translated region of the foreign gene, i.e., include polyadenylic acid signal and any other DNA fragments that participate in mRNA processing or gene expression. The polyadenylic acid signal can guide polyadenylic acid to be added to the 3' end of the mRNA precursor, such as the non-translated region transcribed at the 3' end of the Agrobacterium crown gall induction (Ti) plasmid gene (such as the nopaline synthase gene Nos) and the plant gene (such as the soybean storage protein gene) all have similar functions. When using the gene of the present invention to construct a plant expression vector, an enhancer can also be used, including a translation enhancer or a transcription enhancer. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive, and can be natural or synthetic. The translation initiation region can come from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic marker genes (such as nptII gene that confers resistance to kanamycin and related antibiotics, bar gene that confers resistance to the herbicide phosphinothricin, HPT gene and hph gene that confers resistance to the antibiotic hygromycin, dhfr gene that confers resistance to methatrexate, EPSPS gene that confers resistance to glyphosate), or chemical resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker gene can be added, and transformed plants can be directly screened by adversity.

[0043] In the above biological materials, the recombinant microorganisms can specifically be yeast, bacteria, algae and fungi.

[0044] The present invention uses silver gland poplar variety 84K as material, clones the PagYUCCA6a gene, and constructs it into an overexpression vector pMDC32. The gene is located after the 35S promoter. Driven by the 35S promoter, PagYUCCA6a can be overexpressed in the poplar, thereby regulating the poplar wood yield. This shows that the PagYUCCA6a gene is a key gene for regulating the poplar wood yield and has important application value in the field of high-yield genetic engineering of forest trees. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 It is a schematic diagram of the structure of the plant expression vector pMDC32-PagYUCCA6a of the present invention.

[0046] Figure 2 This is a real-time quantitative detection diagram of the transcription level of the non-transgenic poplar 84K (WT) and the transgenic poplars (OE6, OE24, OE26) overexpressing PagYUCCA6a of the present invention. In the figure, ** represents the significance analysis result of P<0.01.

[0047] Figure 3 The growth diagram of the non-transgenic poplar 84K (WT) and the transgenic poplar (OE6, OE24, OE26) overexpressing PagYUCCA6a of the present invention is shown in FIG. In the figure, ** represents the significance analysis result of P<0.01.

[0048] Figure 4 It is a cross-section diagram of the stem of the non-transgenic poplar 84K (WT) of the present invention and the transgenic poplar (OE6, OE24, OE26) overexpressing PagYUCCA6a. DETAILED DESCRIPTION

[0049] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0050] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0051] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0052] The poplar variety 84K in the following examples is recorded in the non-patent document "KNAT2 / 6b, a class I KNOX gene, impedes xylem differentiation by regulating NAC domain transcription factors in poplar. Zhao et al. (2020) New Phytol. 225: 1531-1544.", which can be obtained by the public from the applicant to repeat the experiments of the present invention.

[0053] Example 1 Cloning of PagYUCCA6a gene

[0054] 84K (P. alba X P. glandulosa) silver glandular poplar was used as the material. The total RNA of one-month soil-cultured seedlings was extracted using the RNeasy Plant Mini kit and the RNase-free DNase I kit (Qiagen, Hilden, Germany). 1.0 μg RNA was taken from each sample and the first strand of cDNA was synthesized by using the SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). With reference to the published genome sequence of Populus trichocarpa, the primers were designed using Primer 5 software (the amplicon contained the start codon and the stop codon), and the full-length gene was amplified (the GATEWAY linker was introduced into the primer);

[0055] The forward primer of PagYUCCA6a ORF is PagYUCCA6a ORF-F, and the reverse primer is PagYUCCA6aORF-R. The primer sequences are as follows:

[0056] PagYUCCA6a ORF-F: 5'-GGGGACAACTTTGTACAAAAAAGTTGGAATGGACTGCTTGAGAGAAAT-3' (as shown in SEQ ID No. 3 in the sequence list, wherein positions 1-28 are GATEWAY linkers, and positions 29-48 are identical to positions 1-20 of SEQ ID No. 1);

[0057] PagYUCCA6a ORF-R: 5'-GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTATCACGGTGATGGTGATGATG-3' (as shown in SEQ ID No. 4 in the sequence listing, wherein positions 1-35 are GATEWAY linkers, wherein positions 36-55 are reverse complementary to the sequence of positions 1286-1305 of SEQ ID No. 1).

[0058] The high-fidelity PCR reaction system was as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 12.5 μl, forward primer (10 μM) 1 μl, reverse primer (10 μM) 1 μl, template (84K poplar cDNA) 100 ng, sterile ddH 2 0 to make up to 25 μl.

[0059] Reaction program: pre-denaturation at 95°C for 5 min; 95°C for 20 s; 56°C for 20 s; 68°C for 60 s, 30 cycles; 68°C for 10 min.

[0060] The final obtained full-length cDNA sequence of the gene was 1305 bp, named PagYUCCA6a gene, the sequence is shown in SEQ ID No. 1 in the sequence list, and the compiled expressed protein sequence is shown in SEQ ID No. 2 in the sequence list.

[0061] SEQ ID No.1

[0062] ATGGACTGCTTGAGAGAAATAGAGGGCAAACAAGCTCATGATCCTCTTTTTGACAAATCATGAATAAATCTTCACGTCG

[0063] TGTTTTTGTCCCTGGTCCAGTTATTGTTGGCGCTGGTCCTTCTGGCCTTGCCGTGGCAGCTTGTCTCAAAGAAAAGGTT

[0064] TCCCAAGTATGGTACTAGAGAGATCTAGTTGTATAGCATCTTTGTGGCAGTTAAAGACTTATGATCGCCTACGCCTTCAC

[0065] TTACCGAAACAATTCTGTGAGCTTCCTCTCATGGGGTTCCCTAGTGAATTTCCAACTTACCCTACTAAGCAACAATTTAT

[0066] TCATTATTTAGAGACGTATGCACGCAAGTTTGAGATTAGACCACGGTTCAATGAGACTGTGTCACATGCCGAATATGATA

[0067] AAGCTATCGGGTTTTGGCGCGTGAAGACTGTTGGGAAAAAGTTAGAGGAGACTGAGTACATGTGCCGGTGGTTGGTGGCG

[0068] GCGACCGGAGAGAATGCGGAGGCAGTGGTGCCAGAGATTGATGGAATGGGAGAATTTGGAGGGGATATTCGGCATACAAG

[0069] TCATTACAAAAGTGGAGAGGAGTTTAAAAGCAAAAAGGTTTTGGTGGTGGGGTGTGGGAATTCAGGAATGGAAGTTTGTT

[0070] TGGATCTCTGCAATTATAGCGCTAAGCCTTCACTTGTTGTTAGAGATACAGTGCATGTTCTGCCTCGAGAGATGCTAGGC

[0071] AAATCAACTTTCGGGTTGTCCATGTGGTTGCTCAAGTGGCTGCCCATGCGCCTTGTCGACCGGTTCCTGCTGATAGTGTC

[0072] GAGGCTAATGCTCGGTGATACGGCACGATTGGGATTGGACCGGCCGGAATTGGGTCCCCTCGAACTCAAGAACTTGTCCG

[0073] GGAAGACCCCAGTATTAGATGTTGGGACACTGGCCAAGATCAAAAGTGGAGACGTTAAGGTATGTCCAGGAATTAAGAAG

[0074] CTAAAACGTCATACCGTTGAGTTTCTTGATGGGAAGATGGAGAATTTTGATGCTATTATTTTAGCAACAGGCTACAAAAG

[0075] TAATGTGCCATCTTGGCTAAAGGAAGGAGACATGTTCGAGAAAGATGGGTTTCCTAAAAGACCATTTCCAAATGGATGGA

[0076] GAGGAGAGTGTGGGCTATATGCAGTGGGGTTCACTAAACGTGGAATATTAGGAGCTTCAATGGATGCTAAAAGAATAGCT

[0077] GAAGACATTGAACGGTACTGTAGGAATGAAGAAGCGGCACCGTATGATCATCATCATCGGTCAGTACTGTTGTTGAAATC

[0078] ATCATCATCATCACCATCACCGTGA

[0079] SEQ ID No.2

[0080] MDCLREIEGKQAHDPLFDKIMNKSSRRVFVPGPVIVGAGPSGLAVAACLKEKGFPSMVLERSSCIASLWQLKTYDRLRLHLPKQFCELPLMGFPSEFPTYPTKQQFIHYLETYARKFEIRPRFNETVSHAEYDKAIGFWRVKTVGKKLEETEYMCRWLVAATGENAEAVVPEIDGMGEFGGDIRHTSHYKSGEEFKSKKVLVVGCGNSGMEVCLDLCNYSAKPSLVVRDTVHVLPREMLGKSTFGLSMWLLKWLPMRLVDRFLLIVSRLMLGDTARLGLDRPELGPLELKNLSGKTPVLDVGTLAKIKSGDVKVCPGIKKLKRHTVEFLDGKMENFDAIILATGYKSNVPSWLKEGDMFEKDGFPKRPFPNGWRGECGLYAVGFTKRGILGASMDAKRIAEDIERYCRNEEAAPYDHHHRSVLLLKSSSSSPSP

[0081] Example 2 Construction of the plant expression vector of PagYUCCA6a gene

[0082] The entry vector is PDNOR207, and the sequence is shown as SEQ ID No.5 in the sequence listing.

[0083] SEQ ID No.5

[0084]

[0085] The overexpression vector of the PagYUCCA6a gene was constructed by cloning technology. A specific PCR primer pair (composed of PagYUCCA6a ORF-F and PagYUCCA6a ORF-R in Example 1) was used to amplify the PagYUCCA6a gene ORF (as shown in SEQ ID No. 1 in the sequence table) using 84K cDNA as a template. The PagYUCCA6a gene ORF was constructed into the entry vector PDNOR207.

[0086] The reaction system was 150 ng of fresh PCR product; 75 ng of PDNOR207 vector; 0.8 μl of BP Clonase II enzyme mix; sterile ddH 2 O to 4 μl; reaction procedure: 25°C for more than 5 h.

[0087] Positive clones were picked from the screening culture plate for PCR detection and sequencing verification, and the entry vector carrying the PagYUCCA6a gene was linearized by Mlu I restriction endonuclease and then constructed into the plant expression vector pMDC32 by the Gateway system.

[0088] The sequence of the plant expression vector pMDC32 is shown as SEQ ID No. 6 in the sequence listing.

[0089] SEQ ID No.6

[0090]

[0091] LR reaction was carried out, and the reaction system was: Linearized entry clone (linearized clone) 75ng; purified destination vector (purified destination vector) 150ng; LR Clonase (cloning enzyme) II enzyme mix (mixed enzyme) 0.8μl; sterile ddH 2 O to make up 4μl; reaction conditions: 25℃ reaction for more than 5h; after LR reaction, PagYUCCA6a gene was introduced into plant expression vector pMDC32, and a strong expression promoter 35S was assembled at the 5' end of PagYUCCA6a gene, which can make PagYUCCA6a gene highly expressed in poplar; a strong terminator NOS was assembled at the 3' end of PagYUCCA6a gene, which can effectively terminate the transcription of PagYUCCA6a gene. Figure 1 As shown, the structure of the plant expression vector pMDC32-PagYUCCA6a of the present invention is shown, wherein, from the top left, there are the strong terminator NOS, the hygromycin selection marker sequence, the kanamycin selection marker sequence, the replication region sequence of pBR322, and the 2×35S strong expression promoter.

[0092] Hygromycin phosphotransferase HPT was assembled on the vector as a screening marker for transgenic poplars, and hygromycin was used to screen transgenic poplars. LB and RB sequences were assembled on the vector to promote the integration of the PagYUCCA6a gene expression framework and the screening marker gene HPT assembled therein into the poplar receptor chromosome. PCR detection and sequencing verification confirmed that the overexpression vector was successfully constructed and named pMDC32-PagYUCCA6a. The gene was located after promoter 35S. Driven by promoter 35S, the PagYUCCA6a gene can be efficiently expressed in the poplar.

[0093] Example 3 Genetic transformation of PagYUCCA6a gene

[0094] The pMDC32-PagYUCCA6a overexpression vector constructed in Example 2 was transferred into Agrobacterium GV3101 by electroporation to obtain Agrobacterium GV3101-pMDC32-PagYUCCA6a. The PagYUCCA6a gene was transferred into poplar (silver gland poplar, 84K poplar, the same below) by Agrobacterium-mediated transformation. The specific transformation steps are as follows:

[0095] The hybrid poplar clone 84K tissue culture seedlings used for genetic transformation were cultured at a temperature of 23-25°C, a light intensity of 16 / 8h (day / night), and a light intensity of 50 μM / m 2 / s.

[0096] Agrobacterium GV3101-pMDC32-PagYUCCA6a containing the expression vector pMDC32-PagYUCCA6a was expressed at OD 600 =0.6-0.8, the infected leaf discs were infected with 84K leaf discs, and the infected leaf discs were cultured in adventitious bud induction medium (SIM, 6-benzylaminopurine (6-BA) and naphthylacetic acid (NAA) were added to MS (Murashige-Skoog) basic medium to obtain adventitious bud induction medium, so that the concentration of 6-BA in the adventitious bud induction medium was 0.5 mg / l and the concentration of NAA was 0.05 mg / l) under dark conditions at a temperature of 23±2°C for 3-4 days; the leaf discs after co-cultivation were transferred to SIM containing 3 mg / L hygromycin B and 200 mg / L Timentin, and the culture temperature was 23-25°C, the light intensity was 16 / 8h (day / night), and the light intensity was 50μM / m 2 / s to induce and screen resistant adventitious buds; after about 20 days of induction culture, the resistant adventitious buds were transferred to a rooting medium (RIM, indolebutyric acid (IBA) and naphthylacetic acid (NAA) were added to 1 / 2MS basic medium to make the IBA concentration in the rooting medium to be 0.05 mg / L and the NAA concentration to be 0.02 mg / L) containing 3 mg / L hygromycin B and 200 mg / L Timentin until adventitious roots were induced; DNA was extracted from leaves of rooted plants and verified by PCR to obtain transgenic poplars overexpressing PagYUCCA6a, and subsequent phenotypic observations and functional studies were carried out using three transgenic poplar lines (OE6, OE24, and OE26) with higher PagYUCCA6a expression levels as representatives.

[0097] Example 4 Application of PagYUCCA6a gene

[0098] The transcription level of the transgenic poplars overexpressing PagYUCCA6a (OE6, OE24, OE26 obtained in Example 3) of the present invention was detected quantitatively in real time, with the wild type 84K as the control:

[0099] The plants OE6, OE24, and OE26 were propagated by tissue culture to obtain the OE6, OE24, and OE26 lines. The tissue culture seedlings of each line about one month old were used as materials to extract RNA and perform reverse transcription. The SYBR Premix ExTaqTM Kit (TaKaRa) was used, and the ACTIN gene was used as an internal reference, and the LightCycler 480 (Roche) real-time quantitative instrument was used to complete the detection.

[0100] The primers for the PagYUCCA6a gene are:

[0101] YUC6a-RT-F:5'-TGGGACACTGGCCAAGATCAAA-3';

[0102] YUC6a-RT-R:5'-TAGCCCACACTCTCCTCTCCAT-3'.

[0103] The primers for the internal reference ACTIN gene are:

[0104] ACTIN-F: 5'-AAACTGTAATGGTCCTCCCTCCG-3';

[0105] ACTIN-R: 5'-GCATCATCACAATCACTCTCCGA-3'.

[0106] Each sample was collected from at least 6 poplar trees and repeated at least 3 times.

[0107] Results Figure 2 The bar graph in the figure shows the expression levels of the PagYUCCA6a gene in non-transgenic poplar (84K) and transgenic poplar (OE6, OE24, OE26) (three lines of transgenic poplar overexpressing PagYUCCA6a). Compared with the non-transgenic poplar (84K), the expression level of PagYUCCA6a in the transgenic poplar (OE6, OE24, OE26) was significantly increased.

[0108] Figure 3 This is a comparison of the growth phenotypes of tissue culture seedlings of non-transgenic poplar (84K) and PagYUCCA6a transgenic poplar (OE6, OE24, OE26) of the present invention at about 1 month old, taken with an ordinary camera; Figure 3 It can be seen that compared with the non-transgenic silver gland poplar (84K), the plant height of PagYUCCA6a transgenic poplars (OE6, OE24, and OE26) is higher, indicating that the PagYUCCA6a gene affects the growth and development of poplars.

[0109] Figure 4 These are cross-sections of the stems of tissue culture seedlings of non-transgenic poplar (84K) and PagYUCCA6a transgenic poplar (OE6, OE24, OE26) of the present invention at about one month old. It can be seen that the xylem width of the transgenic poplars is significantly increased, indicating that overexpression of PagYUCCA6a promotes xylem development and has the potential to increase poplar wood yield.

[0110] The present invention transfers the PagYUCCA6a gene into 84K poplars. Compared with the wild type, the transgenic poplars overexpressing PagYUCCA6a show a phenotype of increased xylem width, indicating that the PagYUCCA6a gene is a key regulatory gene for regulating the development of poplar xylem and wood yield, and has important application value in the field of high-yield genetic engineering of forest trees.

[0111] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. The application of PagYUCCA6a gene in regulating poplar wood yield is characterized by: The PagYUCCA6a gene encodes the PagYUCCA6a protein, and the PagYUCCA6a protein is the following protein A1, A2 or A3: A1, the amino acid sequence is the protein of SEQ ID No. 2 in the sequence list; A2, a protein related to poplar yield obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2 in the sequence list, having more than 80% identity with the protein shown in A1; A3: A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1 or A2.

2. The use according to claim 1, characterized in that: The coding sequence of the PagYUCCA6a gene as the coding chain is a DNA molecule of SEQ ID No. 1 in the sequence list.

3. The use according to claim 1 or 2, characterized in that: The regulation is to increase poplar yield by promoting or enhancing the expression of the PagYUCCA6a gene.

4. The use according to claim 3, characterized in that: The improvement of poplar yield is embodied in the following Y1 and / or Y2: Y1. Poplar tree height becomes taller; Y2. The width of poplar xylem becomes wider.

5. A plant agent, characterized in that: The active ingredient of the reagent is a substance that promotes or increases the PagYUCCA6a gene described in claim 1 or 2, or increases the abundance of the PagYUCCA6a protein described in claim 1 or 2.

6. A method for increasing poplar yield, characterized in that: The method comprises the steps of introducing the PagYUCCA6a gene described in claim 1 or 2 into a recipient poplar to obtain a poplar with improved yield; the yield of the poplar with improved yield is higher than that of the recipient poplar.

7. A method for increasing the height of poplar trees, characterized in that: The method comprises the steps of introducing the PagYUCCA6a gene described in claim 1 or 2 into a recipient poplar to obtain a poplar with increased plant height; the plant height of the poplar with increased plant height is higher than the plant height of the recipient poplar.

8. A method for increasing the width of poplar xylem, characterized in that: The method comprises the steps of introducing the PagYUCCA6a gene described in claim 1 or 2 into a recipient poplar to obtain a poplar with a wider xylem width; the xylem width of the poplar with a wider xylem width is wider than the xylem width of the recipient poplar.

9. The PagYUCCA6a protein according to claim 1 or 2.

10. The biological material related to the PagYUCCA6a gene according to claim 1 or 2, which is any one of the following B1 to B6: B1, an expression cassette containing the PagYUCCA6a gene; B2, a recombinant vector containing the PagYUCCA6a gene, or a recombinant vector containing the expression cassette described in B1; B3, a recombinant microorganism containing the PagYUCCA6a gene, or a recombinant microorganism containing the expression cassette described in B1, or a recombinant microorganism containing the recombinant vector described in B2; B4, a transgenic plant cell line containing the PagYUCCA6a gene, or a transgenic plant cell line containing the expression cassette of B1; B5, transgenic plant tissue containing the PagYUCCA6a gene, or transgenic plant tissue containing the expression cassette described in B1; B6. A transgenic plant organ containing the PagYUCCA6a gene, or a transgenic plant organ containing the expression cassette described in B1.

Images