Application of WAK structural domain-containing protein coding gene ZmWAKL21 in corn to fungal disease resistance of corn

Abstract

The invention relates to application of a protein coding gene ZmWAKL21 containing a WAK structural domain in corn in resisting fungal diseases of corn, and belongs to the technical field of plant disease prevention and control and transgenosis. The nucleotide sequence of the gene ZmWAKL21 is as shown in SEQ ID No.1. The application of the gene ZmWAKL21 specifically refers to the application of the gene ZmWAKL21 in the breeding of puccinia polysora (Puccinia polysora) resistant corn. Research results of the invention show that ZmWAKL21 can influence the infection efficiency of puccinia polypoda, and the research of the invention also lays a foundation for the research of interaction of corn and pathogenic fungi. Meanwhile, the puccinia polypoda infection resistant transgenic corn is successfully obtained through a transgenic mode, and an unexpected technical effect is achieved.

Description

Technical Field

[0001] The invention relates to the field of plant disease prevention and control and transgenic technology, and mainly relates to an application of a WAK domain protein encoding gene ZmWAKL21 in corn in corn resistance to fungal diseases. Background Art

[0002] The multi-pile rust fungus that causes southern corn rust is an obligate parasitic fungus that can only infect, grow and reproduce on corn plants. In the early stages of the disease, chlorotic spots will appear on corn leaves, which will slowly develop into orange-yellow to brown-yellow circular spots with slight protrusions on the surface. The summer spores mature in about 1-2 weeks, and the epidermis ruptures to scatter powdery summer spores. Southern corn rust is a severely destructive fungal disease. Historically, this disease has broken out on a large scale many times, resulting in serious yield losses.

[0003] At present, the main method for preventing and controlling corn fungal diseases in agriculture is to spray chemical agents. Although this method is highly efficient, it will cause serious environmental pollution in the long run, which is not conducive to the sustainable development of green agriculture and ecological balance. Therefore, exploring resistance genes and cultivating resistant varieties are conducive to better prevention and control of corn fungal diseases. Based on current research, cultivating disease-resistant corn plant strains is currently the most effective means of preventing and controlling corn fungal diseases.

[0004] Cell wall-associated receptor kinases (WAKs) and WAK-likes (WAKLs), as representatives of pattern recognition receptors (PRRs), are increasingly being recognized as important contributors to plant immunity. In recent years, multiple new WAKs and WAKLs gene members have been cloned from various crops, revealing their direct roles in managing broad-spectrum and isolate-specific disease resistance. In maize, the ZmWAKL gene encodes a cell wall-associated receptor kinase-like protein and is the virulence gene for the major quantitative disease resistance locus against gray leaf spot (GLS). Another cell wall-associated kinase gene, ZmWAK, has been identified as the virulence gene for the qHSR1 locus, which can reduce disease incidence by approximately 25%. ZmWAK-RLK1 is a gene that confers quantitative resistance to northern corn leaf spot (NCLB).

[0005] In addition to maize, WAK and WAKL genes in other crops also play important roles in disease resistance. For example, in wheat, silencing TaWAK-6D weakened resistance to F. pseudograminearum and R. cerealis and reduced the expression of defense genes. TaWAK6 enhanced resistance to leaf rust (Puccinia triticina). In rice, OsWAK14, OsWAK91, and OsWAK92 enhanced resistance to rice blast, while OsWAK112d reduced resistance. In cotton, GhWAK7A plays a key role in resistance to fungal wilt by interacting with chitin receptors. In soybean, GmWAK1 has a positive effect on resistance to Phytophthora sojae (P. sojae). However, the functions of WAKs and WAKLs in host-pathogen interactions still need to be further analyzed, and their role in maize southern rust resistance has not been reported. Summary of the invention

[0006] Based on the above problems, the present invention provides an application of a gene encoding a protein containing a WAK domain in corn, ZmWAKL21, in corn resistance to fungal diseases. The research results of the present invention show that ZmWAKL21 can affect the infection efficiency of multiple piles of handle rust, and the research of the present invention can also lay a foundation for the study of the interaction between corn and pathogenic fungi. At the same time, the present invention successfully obtained transgenic corn with resistance to infection by multiple piles of handle rust through transgenic means, achieving unexpected technical effects.

[0007] To achieve the above object, the technical solution adopted by the present invention is: The invention discloses an application of a gene ZmWAKL21 encoding a protein containing a WAK domain in corn in resisting fungal diseases of corn. The nucleotide sequence of the gene ZmWAKL21 is shown in SEQ ID No.1.

[0008] Furthermore, the amino acid sequence of the protein encoded by the gene ZmWAKL21 is shown in SEQ ID No.2.

[0009] Furthermore, the biological material related to the protein encoded by the gene ZmWAKL21 is any one of the following A1) to A12): A1) a nucleic acid molecule encoding the protein; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) a recombinant microorganism containing the recombinant vector described in A4); A9) a transgenic plant cell line containing the nucleic acid molecule described in A1); A10) a transgenic plant cell line containing the expression cassette described in A2); A11) a transgenic plant cell line containing the recombinant vector described in A3); A12) A transgenic plant cell line containing the recombinant vector described in A4).

[0010] Furthermore, the application is specifically an application in corn breeding resistant to Puccinia polysora.

[0011] A method for preparing transgenic corn resistant to Puccinia polysora comprises the following steps: introducing a ZmWAKL21 overexpression vector into a starting corn to obtain resistant transgenic corn, wherein the resistant transgenic corn has resistance to Puccinia polysora compared with the starting corn, and the nucleotide sequence of the ZmWAKL21 gene is shown in SEQ ID No. 1.

[0012] Going further, the specific steps include: (1) Cloning of the maize ZmWAKL21 gene; (2) Construction of overexpression vector; (3) Agrobacterium transformation and callus induction culture; (4) Positive identification of genetically modified corn.

[0013] Furthermore, the cloning of the maize ZmWAKL21 gene comprises the following steps: 1) Design primers ZmWAKL21-F and ZmWAKL21-R based on the open reading frame (ORF) of ZmWAKL21 ZmWAKL21-F: CCACCACCTATCCTTTCCTTCCT, as shown in SEQ ID No. 3; ZmWAKL21-R: CAAGGCCTAAGTGACAGAACAAA, as shown in SEQ ID No. 4; 2) Carry out PCR reaction, recover the PCR product, connect it to pCE2-T vector, pick a single clone, send it for testing, and obtain the correct pCE2-T-ZmWAKL21 recombinant plasmid.

[0014] Furthermore, the construction of the overexpression vector comprises the following steps: 1) Design primers with XcmI restriction sites to amplify the ZmWAKL21 gene, and use the pCE2-T-ZmWAKL21 recombinant plasmid that has been sequenced and verified to be correct as a template; perform single restriction digestion of the pBECXUN vector with XcmI enzyme; 2) After the pBECXUN vector was digested, the PCR products were recovered and connected to the vectors respectively; positive clones were selected and sequenced to confirm that the pBECXUN-ZmWAKL21 overexpression vector had been successfully constructed; The primer sequences are as follows: pBECXUN-ZmWAKL21-F: AGATCTTCCAATACTTATGCAGACCACCGCC, as shown in SEQ ID No. 5; pBECXUN-ZmWAKL21-R: TCGGATCCCCAATACTCACTTGTCATCGTCGTCCTTGTAATCCTTGTCATCGTCGTCCTTGTAATCCTTGTCATCGTCGTCCTTGTAATCACTGCTGTTATGGGTAGTGG, as shown in SEQ ID No. 6.

[0015] Furthermore, the Agrobacterium transformation and callus induction culture comprises the following steps: 1. Agrobacterium Preparation Take 1µL of plasmid and add it to 50µL EHA105 Agrobacterium competent cells, mix thoroughly and then transfer to an electroporation cup. After electroporation, add 1mL LB liquid medium, mix thoroughly and then transfer to a 1.5mL centrifuge tube. Incubate in a shaker at 30℃ and 180rpm for 30min. Take 50µL of the activated Agrobacterium liquid and inoculate it on LB solid medium. Incubate in the dark at 30℃ for 48h. 2. Maize Genetic Transformation 2.1 Disinfection and embryo extraction Remove the husk of the ear and place it in a container for disinfection; take a sterilized 2mL EP tube, add the suspension into the tube, and take the young embryo; 2.2 Agrobacterium infection and co-cultivation Pick Agrobacterium in the infection solution and prepare OD 600 = 0.2 Agrobacterium resuspension, aspirate the suspension liquid in the EP tube, add the prepared Agrobacterium bacterial solution to infect; pour the infected young embryos together with the bacterial solution into the co-culture, aspirate the bacterial solution; culture in a dark incubator at 25°C for 2-3 days; 2.3 Callus induction and screening The co-cultured embryos were inoculated on the induction medium and cultured in a dark incubator at 28°C for 7-10 days. The induced calli were inoculated on the screening medium for screening culture and cultured in the dark at 28°C for 2 weeks. The calli that survived the first screening were selected for the second screening. 2.4 Differentiation and rooting The embryonic callus grown after screening was inoculated on a pre-differentiation medium and cultured in the dark at 28°C for 10 days; the pre-differentiated embryonic callus was inoculated on a differentiation medium and placed in a 25°C light incubator for light culture until seedlings were differentiated; the differentiated seedlings were transferred to a rooting medium and cultured in light at 25°C until the root system was fully developed; the developed seedlings were hardened and transplanted into a greenhouse substrate.

[0016] Furthermore, the positive identification of the transgenic corn comprises the following steps: The total RNA of the maize leaves to be tested and the control maize leaves was extracted using the TRIzol method and reverse transcribed into cDNA. The ZmEF1α gene of maize was used as an internal reference, and the ZmWAKL21 and ZmEF1α specific primers were used for detection. The relative gene expression results were used to determine whether the maize plants to be tested were resistant maize.

[0017] Furthermore, the specific primer sequences are as follows: qRT- ZmWAKL21-F: GACAAGAGCGACGTGTACAG, as shown in SEQ ID No. 7; qRT- ZmWAKL21-R: CTGGCCAGGTTGACGTC, as shown in SEQ ID No. 8; ZmEF1α-F: TGGGCCTACTGGTCTTACTACTGA, as shown in SEQ ID No. 9; ZmEF1α-R: ACATACCCACGCTTCAGATCCT, as shown in SEQ ID No.10.

[0018] Furthermore, the judgment method is: if the relative expression level of the ZmWAKL21 gene in the corn plant to be tested is significantly higher than that in the control, it is resistant corn.

[0019] The present invention uses plant transgenic technology to transform the full-length ZmWAKL21 gene into corn, and then screens and obtains transgenic strains with high expression levels. Experiments show that after multiple piles of rust fungi infect corn, the resistance of ZmWAKL21 overexpressing transgenics to fungal infection is significantly increased compared with the control wild type. ZmWAKL21 plays a positive regulatory role in the disease resistance process of corn.

[0020] The present invention mainly adopts the following scheme to achieve the above invention objectives: The invention takes ZmWAKL21 in corn as the object, constructs a recombinant expression vector pBECXUN-ZmWAKL21 of the ZmWAKL21 gene, transforms the constructed expression vector into corn embryos by using an Agrobacterium-mediated genetic transformation method, and finally induces callus formation. The selected Agrobacterium strain is EHA105. After obtaining the transgenic corn seedlings, the transgenic plants are identified. The expression amount of the ZmWAKL21 gene in corn is detected by real-time fluorescence quantitative PCR technology (qRT-PCR), and the homozygous transgenic corn with stable inheritance of the T3 generation is obtained. The resistance of the ZmWAKL21 transgenic corn is evaluated by artificial inoculation of multiple piles of handle rust. The results show that compared with the wild type control, the transgenic corn plant overexpressing ZmWAKL21 significantly enhances the resistance of corn to the infection of multiple piles of handle rust. Therefore, it is shown that the ZmWAKL21 overexpressing transgenic corn can significantly enhance the resistance of corn to the infection of multiple piles of handle rust. The research results not only show that ZmWAKL21 affects the infection efficiency of multiple piles of rust, but also lay the foundation for the study of the interaction between corn and pathogenic fungi.

[0021] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention obtains stably inherited overexpressed transgenic corn ZmWAKL21 by overexpressing ZmWAKL21, and analyzes the resistance of the transgenic corn to southern rust, which helps to deepen our understanding and knowledge of the interaction between pathogenic fungi and host plants, and enriches the molecular mechanism of the interaction between pathogenic fungi and corn.

[0022] (2) The present invention studies the mechanism of action of ZmWAKL21 in fungal infection and discovers the interaction between plants and pathogenic fungi, laying a foundation for further research on disease resistance theory. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 These are the experimental results of the relative expression level of ZmWAKL21 in ZmWAKL21 overexpressing transgenic corn.

[0024] Figure 2 Comparison results of disease symptoms between ZmWAKL21 overexpressing transgenic plants and wild type control after infection with multiple piles of Puccinia gracilis.

[0025] Figure 3 These are the results of the leaf spore biomass detection experiment of ZmWAKL21 overexpressing transgenic and wild type control after multiple piles of Puccinia repens infection. DETAILED DESCRIPTION

[0026] The invention provides an application of a gene ZmWAKL21 encoding a protein containing a WAK domain in corn in resisting fungal diseases of corn. The nucleotide sequence of the gene ZmWAKL21 is shown in SEQ ID No.1.

[0027] SEQ ID No.1: Furthermore, the amino acid sequence of the protein encoded by the gene ZmWAKL21 is shown in SEQ ID No.2.

[0028] SEQ ID No.2: * Furthermore, the biological material related to the protein encoded by the gene ZmWAKL21 is any one of the following A1) to A12): A1) a nucleic acid molecule encoding the protein; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) a recombinant microorganism containing the recombinant vector described in A4); A9) a transgenic plant cell line containing the nucleic acid molecule described in A1); A10) a transgenic plant cell line containing the expression cassette described in A2); A11) a transgenic plant cell line containing the recombinant vector described in A3); A12) A transgenic plant cell line containing the recombinant vector described in A4).

[0029] The application is specifically an application in corn breeding for resistance to Puccinia polysora, which is specifically described in detail in Examples 1 to 4.

[0030] Example 1 This example is the construction of a maize ZmWAKL21 overexpression vector.

[0031] (1) Cloning of the maize ZmWAKL21 gene Primers ZmWAKL21-F and ZmWAKL21-R were designed based on the open reading frame (ORF) of ZmWAKL21. The primer sequences are as follows: ZmWAKL21-F: CCACCACCTATCCTTTCCTTCCT, as shown in SEQ ID No. 3; ZmWAKL21-R: CAAGGCCTAAGTGACAGAACAAA, as shown in SEQ ID No.4.

[0032] PCR amplification system: The reaction system (25 μL) is as follows: 2×KOD ONE PCR Master Mix 12.5μL, upstream and downstream primers (10μM) 1μL each, cDNA template 1μL, ddH2O 9.5μL.

[0033] PCR amplification program: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 56°C for 5 s, extension at 68°C for 15 s, 35 cycles; final extension at 68°C for 5 min.

[0034] The PCR product was recovered, connected to the pCE2-T vector, single clones were selected, and sent for testing to obtain the correct pCE2-T-ZmWAKL21 recombinant plasmid, which was sent to Tianjin Qingke Biotechnology Co., Ltd. for sequencing. A sequence with a length of 2034 bp encoding 678 amino acids was obtained.

[0035] (2) Construction of overexpression vector Primers with XcmI restriction sites were designed to amplify ZmWAKL21. The pCE2-T-ZmWAKL21 plasmid with correct sequencing was used as the template. The pBECXUN vector was digested with XcmI enzyme for the construction of the ZmWAKL21 gene binary expression vector pBECXUN. The primer sequences are as follows: pBECXUN-ZmWAKL21-F: AGATCTTCCAATACTTATGCAGACCACCGCC, as shown in SEQ ID No. 5; pBECXUN-ZmWAKL21-R: TCGGATCCCCAATACTCACTTGTCATCGTCGTCCTTGTAATCCTTGTCATCGTCGTCCTTGTAATCCTTGTCATCGTCGTCCTTGTAATCACTGCTGTTATGGGTAGTGG, as shown in SEQ ID No. 6.

[0036] PCR amplification system: The reaction system (25 μL) is as follows: 2×KOD ONE PCR Master Mix 12.5μL, upstream and downstream primers (10μM) 1μL each, cDNA template 1μL, ddH2O 9.5μL.

[0037] PCR amplification program: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 56°C for 5 s, extension at 68°C for 15 s, 35 cycles; final extension at 68°C for 5 min.

[0038] After restriction digestion of the pBECXUN vector, the PCR products were recovered and connected to the vectors respectively; positive clones were selected and sequenced to confirm that the pBECXUN-ZmWAKL21 expression vector had been successfully constructed.

[0039] Example 2 This example is maize genetic transformation.

[0040] 1. Agrobacterium Preparation Take 1µL of plasmid and add it to 50µL EHA105 Agrobacterium competent cells, mix thoroughly and then transfer to an electroporation cup. After electroporation, add 1mL LB liquid culture medium, mix thoroughly and then transfer to a 1.5mL centrifuge tube. Incubate in a shaker at 30℃ and 180rpm for 30min. Take 50µL of the activated Agrobacterium liquid and inoculate it on LB solid culture medium, and incubate in the dark at 30℃ for 48h.

[0041] 2. Maize Genetic Transformation 2.1 Disinfection and embryo extraction Remove the husk of the ear and place it in a container for disinfection. Take a sterilized 2 mL EP tube, add the suspension into the tube, and take the young embryo.

[0042] 2.2 Agrobacterium infection and co-cultivation Pick Agrobacterium in the infection solution and prepare OD 600 = 0.2 Agrobacterium resuspension, aspirate the suspension liquid in the EP tube, add the prepared Agrobacterium bacterial solution, and infect. Pour the infected young embryos together with the bacterial solution into the co-culture, and dry the bacterial solution. Incubate in a dark incubator at 25℃ for 2-3 days.

[0043] 2.3 Callus induction and screening The co-cultured embryos were inoculated on the induction medium and cultured in a dark incubator at 28°C for 7-10 days. The induced calli were inoculated on the screening medium for screening culture and cultured in the dark at 28°C for 2 weeks. The calli that survived the first screening were selected for the second screening.

[0044] 2.4 Differentiation and rooting The embryonic callus grown after screening was inoculated on the pre-differentiation medium and cultured in the dark at 28°C for 10 days. The pre-differentiated embryonic callus was inoculated on the differentiation medium and placed in a 25°C light incubator for light culture until seedlings were differentiated. The differentiated seedlings were transferred to the rooting medium and cultured in light at 25°C until the root system was fully developed. The developed seedlings were hardened and transplanted into the greenhouse matrix to obtain the ZmWAKL21-OE transgenic lines ZmWAKL21-OE-1, ZmWAKL21-OE-2 and ZmWAKL21-OE-3 overexpressing the ZmWAKL21 gene.

[0045] Example 3 This example is a positive identification of transgenic plants.

[0046] Total RNA of positive transgenic plants was extracted and reverse transcribed into cDNA, and the ZmEF1α gene of maize was used as an internal reference. The quantitative primers are shown in SEQ ID No.7-10. The relative expression levels of ZmWAKL21-OE transgenic lines ZmWAKL21-OE-1, ZmWAKL21-OE-2 and ZmWAKL21-OE-3 overexpressing the ZmWAKL21 gene were significantly higher than those of the control ( Figure 1 ).

[0047] qRT-ZmWAKL21-F: GACAAGAGCGACGTGTACAG, as shown in SEQ ID No. 7; qRT-ZmWAKL21-R: CTGGCCAGGTTGACGTC, as shown in SEQ ID No. 8; ZmEF1α-F: TGGGCCTACTGGTCTTACTACTGA, as shown in SEQ ID No. 9; ZmEF1α-R: ACATACCCACGCTTCAGATCCT, as shown in SEQ ID No.10.

[0048] Example 4 This embodiment is to artificially inoculate multiple piles of Puccinia.

[0049] ZmWAKL21 transgenic maize and control maize materials were grown in a greenhouse until the four- to five-leaf stage. Multiple piles of Puccinia spore suspensions were diluted to 1×10 6 spores / mL, spray the corn at the four- to five-leaf stage until the leaf surface is moistened. The inoculated corn was cultured in the dark for 12 h in a greenhouse at 26°C and 70% to 90% humidity, and then cultured according to the normal photoperiod.

[0050] After the disease, the resistance of corn to multiple piles of Puccinia spores was determined by observing and detecting the biomass of multiple piles of Puccinia spores on corn leaves. Eight circular leaf discs were evenly taken from the diseased corn leaves (using a punch sampler with a diameter of 6 mm). DNA was extracted and uniformly diluted to 30 ng / μL as a template for qPCR quantitative analysis. The biomass was calculated using the standard curve using the CT value obtained by qPCR. The three ZmWAKL21-OE transgenic lines (OE-1, OE-2 and OE-3) showed obvious resistance to infection with multiple piles of Puccinia spores, such as Figure 2 Further testing of the biomass of multiple piles of Puccinia spores on corn leaves showed that the biomass of multiple piles of Puccinia spores on the leaves of the susceptible positive transgenic lines was significantly lower than that of the wild type. Figure 3 shown.

[0051] The sequences of qPCR primers for biomass detection are as follows: PPu-tub-qF: TCCCATCCCGAAACCTTG, as shown in SEQ ID NO. 11; PPu-tub-qR: ATCAATTCCTTCCCAACAGTA, as shown in SEQ ID NO.12.

[0052] Therefore, the present invention successfully obtained multiple piles of transgenic corns resistant to stem rust infection through transgenic means, achieving unexpected technical effects.

[0053] It should be understood that the specific examples and schemes described in the present invention are only given as examples for illustrative purposes and are not to be construed as limitations of the present invention. Various further modifications or changes within the spirit and scope of the present invention are to be considered as being included within the scope of the disclosure of the present invention.

Claims

1. An application of a gene ZmWAKL21 encoding a protein containing a WAK domain in corn in the resistance to fungal diseases of corn, characterized in that: The nucleotide sequence of gene ZmWAKL21 is shown in SEQ ID No.

1.

2. The use of the gene ZmWAKL21 encoding a WAK domain protein in corn in the resistance to fungal diseases of corn according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the gene ZmWAKL21 is shown in SEQ ID No.

2.

3. The use of the gene ZmWAKL21 encoding a WAK domain protein in corn in the resistance to fungal diseases of corn according to claim 1, characterized in that: The biological material related to the protein encoded by gene ZmWAKL21 is any one of the following A1) to A12): A1) a nucleic acid molecule encoding the protein; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) a recombinant microorganism containing the recombinant vector described in A4); A9) a transgenic plant cell line containing the nucleic acid molecule described in A1); A10) a transgenic plant cell line containing the expression cassette described in A2); A11) a transgenic plant cell line containing the recombinant vector described in A3); A12) A transgenic plant cell line containing the recombinant vector described in A4).

4. The use of the gene ZmWAKL21 encoding a WAK domain protein in corn in the resistance to fungal diseases of corn according to claim 1, characterized in that: The application is specifically an application in corn breeding resistant to Puccinia polysora.

5. A method for preparing multi-pile rust resistant transgenic corn, characterized in that: The method comprises the following steps: introducing a ZmWAKL21 overexpression vector into a starting corn to obtain resistant transgenic corn. Compared with the starting corn, the resistant transgenic corn has resistance to Puccinia polysora. The nucleotide sequence of the ZmWAKL21 gene is shown in SEQ ID No.

1.

6. The method for preparing multi-pile rust resistant transgenic corn according to claim 5, characterized in that: The specific steps include: (1) Cloning of the maize ZmWAKL21 gene; (2) Construction of overexpression vector; (3) Agrobacterium transformation and callus induction culture; (4) Positive identification of genetically modified corn.

7. The method for preparing multi-pile rust resistant transgenic corn according to claim 6, characterized in that: The positive identification of the transgenic corn comprises the following steps: The total RNA of the maize leaves to be tested and the control maize leaves was extracted using the TRIzol method and reverse transcribed into cDNA. The ZmEF1α gene of maize was used as an internal reference, and the ZmWAKL21 and ZmEF1α specific primers were used for detection. The relative gene expression results were used to determine whether the maize plants to be tested were resistant maize.

8. The method for preparing multi-pile rust resistant transgenic corn according to claim 7, characterized in that: The specific primer sequences are as follows: qRT- ZmWAKL21-F GACAAGAGCGACGTGTACAG, as shown in SEQ ID No. 7; qRT- ZmWAKL21-R CTGGCCAGGTTGACGTC, as shown in SEQ ID No. 8; ZmEF1α-F TGGGCCTACTGGTCTTACTACTGA, as shown in SEQ ID No. 9; ZmEF1α-R ACATACCCACGCTTCAGATCCT, as shown in SEQ ID No.

10.

9. The method for preparing multi-pile rust resistant transgenic corn according to claim 7, characterized in that: The judgment method is: if the relative expression level of the ZmWAKL21 gene in the corn plant to be tested is significantly higher than that in the control, it is resistant corn.

Images