Application of ESP1 gene in regulating resistance of plants to rice blast

Abstract

The invention discloses application of an ESP1 gene in regulating the resistance of plants to rice blast, and belongs to the technical field of molecular biology. The invention provides the application of the ESP1 gene in regulating the resistance of the plant to the rice blast, and experiments prove that a mutant plant with a silent ESP1 gene is susceptible to the rice blast, and a mutant plant with an overexpressed ESP1 gene is resistant to the rice blast. The invention is expected to provide a good theoretical basis for cultivating disease-resistant plants.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to the application of ESP1 gene in regulating plant resistance to rice blast. Background Art

[0002] Rice blast is a disease caused by fungal infection and is also a widespread disease worldwide. Rice blast can occur throughout the entire growth period of rice. According to the different parts of the rice, it can be divided into seedling blast, leaf blast, node blast, panicle neck blast, branch blast, and grain blast. Rice blast can reduce yields at the mildest and even cause no grains to be harvested at the worst. Rice blast in the seedling stage occurs before the 3-leaf stage and is caused by the bacteria in rice seeds. The lower part of the diseased rice seedlings is gray-black, the upper part turns brown, and they curl up and die. In humid climates, a large amount of gray-black mold layer is produced on the diseased part. Therefore, the study of the gene regulation rules during the occurrence of rice blast in the rice seedling stage has important theoretical and practical significance.

[0003] Alternative polyadenylation (APA) is a widely-existing post-transcriptional regulation mode of genes. It participates in the physiological and pathological processes of plants by producing transcripts of 3UTRs of different lengths or proteins of different properties. Studies have found that APA factors participate in plant stress resistance by regulating the APA of a large number of downstream related genes. One of the factors, ESP1, has a CDS of 1161bp and contains 7 exons. It is a subunit of the CSTF complex. The factor has a total of 37 amino acids, of which the 5th to 37th amino acids perform functions. There is a functional domain related to transcription termination and cleavage at the C-terminus of the protein, which participates in the recognition of APA sites and thus affects the 3' end processing of mRNA. However, the function of this factor in rice blast is unclear. Therefore, by reducing the expression level of the ESP1 gene in rice and identifying the phenotype of the knockdown rice against rice blast, it will lay an important foundation for studying the functional role of ESP1 in the occurrence of rice blast.

[0004] Precise targeting is a prerequisite for specific silencing of the ESP1 gene. In order to ensure precise targeting, designing and preparing sgRNA that accurately and specifically targets the ESP1 gene in rice has become a key technology for silencing the gene, and also provides an important theoretical basis for the discovery of rice blast-resistant materials. Summary of the invention

[0005] The purpose of the present invention is to provide an application of ESP1 gene in regulating plant resistance to rice blast, so as to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is the use of ESP1 gene in regulating plant resistance to rice blast.

[0008] The second technical solution of the present invention is the use of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the ESP1 gene in regulating plant resistance to rice blast.

[0009] The third technical solution of the present invention is the use of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the ESP1 gene in cultivating new varieties of rice blast-resistant plants.

[0010] A fourth technical solution of the present invention is the use of the protein encoded by the ESP1 gene in regulating plant resistance to rice blast.

[0011] A fifth technical solution of the present invention is a method for regulating plant resistance to rice blast, which involves overexpressing, silencing or knocking out the ESP1 gene in the plant.

[0012] Based on the above technical solution, the present invention has the following technical effects:

[0013] The present invention provides an application of the ESP1 gene in regulating plant resistance to rice blast, and experiments confirm that mutant plants with silenced ESP1 gene are susceptible to rice blast, while mutant plants with overexpressed ESP1 gene are resistant to rice blast. The present invention is expected to provide a good theoretical basis for cultivating disease-resistant plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0015] Figure 1 It is the target site of the rice ESP1 gene of the present invention. Sequence_0 is the genome sequence, and sequence_1 is the CDS sequence. The red line is the sgRNA target sequence.

[0016] Figure 2 It is the position of the target sequence of the ESP1 gene in the gene structure in the transgenic rice of the present invention.

[0017] Figure 3 This is a peak diagram of the target sequence of the ESP1 gene mutation in the transgenic rice of the present invention. The first row is the wild-type rice sequence, and the second row is the transgenic rice ESP1 sequence.

[0018] Figure 4 To identify the phenotype of transgenic rice plants infected with rice blast. DETAILED DESCRIPTION

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0021] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0022] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0023] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0024] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0025] The embodiment of the present invention provides the use of ESP1 gene in regulating plant resistance to rice blast.

[0026] In some specific embodiments, the plant comprises rice.

[0027] In some specific embodiments, silencing or knocking out the ESP1 gene of a plant reduces the plant's resistance to rice blast; overexpressing the ESP1 gene of a plant increases the plant's resistance to rice blast.

[0028] The embodiments of the present invention also provide the use of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the ESP1 gene in regulating the resistance of a plant to rice blast.

[0029] The embodiments of the present invention also provide the use of a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium containing the ESP1 gene in cultivating new rice blast resistant plant varieties.

[0030] The embodiment of the present invention also provides the use of the protein encoded by the ESP1 gene in regulating the resistance of plants to rice blast.

[0031] The embodiment of the present invention also provides a method for regulating plant resistance to rice blast, which involves overexpressing, silencing or knocking out the ESP1 gene in the plant.

[0032] Example 1

[0033] Obtaining the target sequence of rice ESP1 gene

[0034] The rice ESP1 gene LOC_Os03g25960 sequence was searched and downloaded from the MSU database. The ESP1 gene 5'-NGG-3' PAM sequence was searched using the online CRISPRdirect website software http: / / crispr.mit.edu / , and optimized according to the target site, mismatch position, number of base mismatches, etc. Finally, (SEQ ID NO.1) "TTCAGTTACGTGATATGCTACGG" on its antisense strand was selected as the target sequence. Figure 1 and Figure 2 .

[0035] Example 2

[0036] Construction of rice gene editing vector

[0037] (1) sgRNA sense sequence: After reverse complementation of the target sequence, the 5' end sequence NGG was removed to obtain the sgRNA sequence (SEQ ID NO. 2) "TAGCATATCACGTAACTGAA".

[0038] (2) sgRNA anti-sense reverse complementary sequence: The sgRNA sequence was reversely complemented to obtain the reverse complementary sequence (SEQ ID NO.3) "TTCAGTTACGTGATATGCTA".

[0039] (3) According to the restriction site of the selected vector, three additional bases CAG were introduced at the 5' end of the sgRNA sequence to obtain the SEQ ID NO.4 (CAGTAGCATATCACGTAACTGAA) sequence; three additional bases CAA were introduced at the 5' end of the sgRNA reverse complementary sequence to obtain the SEQ ID NO.5 (AACTTCAGTTACGTGATATGCTA) sequence. The sequences were synthesized by Shanghai Bioengineering Technology Co., Ltd. and named UPOligo and LowOligo respectively.

[0040] (4) Preparation of Oligo Dimer:

[0041] The synthesized Oligo was diluted with water to 10 μM, and the reaction system of 18 μL Buffer Aneal, 1 μL UPOligo, and 1 μL LOW Oligo was mixed, heated at 95°C for 3 min, and then slowly decreased to 20°C at a rate of about 0.2°C / s.

[0042] (5) Insertion of oligo dimer into vector

[0043] saCas9 / gRNA Vector 1μL, oligo dimer 1μL, Solution 1μL, Solution 21μL, add ddH2O to 10μL, react at 16℃ for 2 hours.

[0044] (6) Transformation of Escherichia coli

[0045] Take 10 μL of the final product of the previous step and add it to the 50 μL DH5a competent cells that have just been thawed, flick to mix, place on ice for 30 minutes, heat shock at 42°C for 90 seconds, and place on ice for 2 minutes again, then add 500 μL of LB without resistance, shake in a constant temperature shaker at 37°C, 170 rpm, and resuscitate for 1 hour before coating the plate with kana resistance. The recombinant plasmid obtained by PCR detection, and the recombinant plasmid with the correct PCR test was sent to Shanghai Bioengineering Co., Ltd. for sequencing for sequence verification, and finally the recombinant vector was obtained.

[0046] Example 3

[0047] Transformation of Agrobacterium with recombinant vector

[0048] (1) Preparation of competent Agrobacterium

[0049] First, a single colony of Agrobacterium EHA105 was picked and inoculated into 5 ml YEB medium, cultured overnight at 28°C, inoculated into 50 ml YEB medium at a volume ratio of 1:100 for expansion culture, and then cultured at 28°C for about 6-7 hours until the OD 600=0.4-0.6. Then, place the bacterial solution on ice for 30 minutes; centrifuge at 5000 rpm, 4°C for 5 minutes, discard the supernatant, resuspend the bacterial cells in 10 ml 0.15 M NaCl; centrifuge at 5000 rpm, 4°C for 5 minutes, discard the supernatant, gently suspend the bacterial cells in 1 ml 20 mM CaCl2, 4°C, and dispense 200 μL into each tube.

[0050] (2) Transformation and identification of Agrobacterium

[0051] Add 10μL plasmid DNA to 200μL Agrobacterium competent cells, mix well, place in ice for 30min, freeze in liquid nitrogen for 5min, warm water bath at 37℃ for 5min, add 1ml YEB medium, shake and culture at 28℃ for 4h. Centrifuge at 10000rpm for 30s at room temperature, discard the supernatant, add 200μL YEB medium to resuspend the cells, evenly spread on YEB medium, and culture at 28℃ for 2 days; extract Agrobacterium plasmid DNA by alkaline lysis method, and re-transform the plasmid into Escherichia coli DH5α. After culturing overnight, pick a single colony for liquid culture, extract the plasmid and perform PCR identification.

[0052] Example 4

[0053] Agrobacterium transformation of rice

[0054] (1) Rice pretreatment

[0055] After the rice seeds were shelled, they were soaked in 70% ethanol for 1 min, sterilized in 50% bleach for 20 min, and then rinsed with sterile water for 4 times. The whole seeds were transferred to MD2 medium plates and cultured in a dark box at 26°C for 4 days. When yellow callus appeared on the hypocotyl, the roots and endosperm were removed, and the hypocotyl was transferred to a fresh NBD2 medium plate with the blunt side facing up and cultured in a dark box at 26°C for 7-10 days.

[0056] (2) Pick a single EHA105 Agrobacterium colony and culture it vigorously in 100 ml of YEB medium containing the corresponding resistance for about 16 hours at 200 rpm and 28°C until the OD 600 It is 0.6-0.8.

[0057] (3) Centrifuge at 3000 rpm for 10 minutes and resuspend the pellet in AAM-AS liquid medium to an OD of 600 It is 0.6-0.8.

[0058] (4) Soak 300 embryos with callus in the bacterial suspension for 20 minutes with shaking.

[0059] (5) Collect the embryos from the suspension and blot dry between two pieces of sterile filter paper.

[0060] (6) Place sterile filter paper on the surface of the NBD2-AS culture medium plate, place the embryos on the filter paper, and culture in a dark box at 26°C for 2 days.

[0061] (7) Remove the root of the embryo and place the embryo on a new plate of NBD2 medium containing cephalosporin and hygromycin, with the cut surface facing downward, and culture in a dark box at 26°C for 12 days.

[0062] (8) The cells were then transferred to fresh NBD2 medium containing cephalosporin and hygromycin and cultured in a dark box at 26°C for 13-15 days. During this time, new calli could be seen growing.

[0063] (9) Place the resistant calli on a plate containing Pre-MS predifferentiation medium and culture in a dark box at 26°C for 8 days.

[0064] (10) Place the callus on a sprouting medium (MS-H differentiation medium) plate and culture at 26°C with 12 h of light and 12 h of darkness. When green shoots appear, transfer them to fresh MS-H culture plates without adding hygromycin. New rootless seedlings will form within 10 days.

[0065] (11) The rootless seedlings were transferred to MSNH regeneration medium to induce root formation.

[0066] (12) After the roots have formed, the culture bottles are opened and 7 days later the seedlings are moved into the greenhouse.

[0067] Example 5

[0068] Identification and analysis of transgenic plants

[0069] (1) DNA extraction

[0070] Place the selected rice leaves in a 1.5ml centrifuge tube, add 400μL of CTAB extraction buffer, grind with a grinding rod, add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), mix vigorously, and centrifuge at 12000rpm for 10min. Take the supernatant to a new centrifuge tube, add 2 volumes of anhydrous ethanol and 0.1 volumes of 3M pH 5.2 sodium acetate, mix vigorously to make the DNA clump, and place in a -20℃ refrigerator for precipitation for 2 hours. Centrifuge at 12000rpm for 10min. Discard the supernatant, wash the precipitate once with 70% alcohol, let it stand at room temperature to dry, and add an appropriate amount of ultrapure water to dissolve.

[0071] (2) Identification of rice mutant plants

[0072] The extracted DNA was used as a template and primers ESP1-F1 (SEQ ID NO. 6): GTGCCTGTTGTTAACTATTGGAG; ESP1-R1 (SEQ ID NO. 7): TCGAGATGTCAATCAGCTGAAC were used to amplify the ESP1 fragment by PCR.

[0073] The 25 μL PCR system is: 2.5 μL PCR buffer (10*), 0.5 μL Taq enzyme, 2 μL cDNA template, 0.5 μL 10 mM dNTP, 1 μL 10 μM ESP1-F primer, 1 μL 10 μM ESP1-R′ primer, and make up to 25 μL with sterile water.

[0074] The reaction conditions were: 94°C, 5 min, 35 circles, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 60 s, and 10 min at 72°C.

[0075] The PCR products were sent to Shanghai Bioengineering Technology Co., Ltd. for sequencing and sequence analysis. Figure 3 osESP1-1 is a double-target mutation, with a base substitution at target 1 (from guanine to thymine) and a thymine deletion at target 2, while osESP1-2 has a thymine addition at target 2.

[0076] (3) Phenotypic identification of ESP1 rice mutants infected with rice blast

[0077] Preparation of spore suspension: drop 1-2 ml of sterile water containing 0.025% Tween-20 on the DCR culture medium; use a glass slide to scrape the hyphae and spores on the culture medium directly into a small beaker; use three layers of lens paper to filter the scraped culture medium, only the hyphae and spores are needed in the filtrate, and minimize the impurities; drop the filtrate on a hemocytometer, observe under a microscope, and add an appropriate amount of sterile water to prepare a spore suspension.

[0078] Rice blast stress treatment: Place mature seeds in a petri dish, sterilize with 2% NaClO, soak at 28°C for 48 hours, and then place in a hydroponic box. Place all seedlings in an incubator with a photoperiod of 14h day / 10h night and a temperature cycle of 28 / 24°C. When the rice grows to the three-leaf stage, use the prepared rice blast fungus spore suspension as a stress treatment, ensure that the spray is even, and spray until the liquid is about to drip from the leaves. The rice seedlings inoculated with fungi were cultured in a dark room at 25°C and 85% humidity for 24h, and then cultured in a dark room at 26 / 24°C for 14h, with a photoperiod of 10h at 85% humidity. Young rice leaves were collected at 12h, 24h, 36h and 48h, and 3 biological replicates were collected for each treatment. Frozen in liquid nitrogen and stored at -80°C for later use.

[0079] Phenotypic identification: Four mutant plants of osESP1-1 and osESP1-2 and the wild type WT of Nipponbare were used as test materials and inoculated with rice blast fungus by spraying. The results showed that in addition to the slower growth trend of the mutants, the osESP1-1 and osESP1-2 mutant plants were susceptible to the disease, and the area of ​​lesions on the leaves was significantly different from that of the wild type. In addition to the lesions, the leaves also turned yellow ( Figure 4 ).

[0080] The present invention also constructs an overexpression vector of the ESP1 gene. The phenotypic identification results show that overexpression of the ESP1 gene in rice plants exhibits enhanced resistance to rice blast, and the lesion area on the leaves is significantly different from that of the wild type.

[0081] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Application of ESP1 gene in regulating plant resistance to rice blast.

2. The use according to claim 1, characterized in that: The plants include rice.

3. The use according to claim 1 or 2, characterized in that: Silencing or knocking out the ESP1 gene of a plant reduces the plant's resistance to rice blast; overexpressing the ESP1 gene of a plant increases the plant's resistance to rice blast.

4. Use of a recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing the ESP1 gene in regulating plant resistance to rice blast.

5. Use of recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the ESP1 gene in breeding new plant varieties resistant to rice blast.

6. Application of the protein encoded by the ESP1 gene in regulating plant resistance to rice blast.

7. A method for regulating plant resistance to rice blast, characterized in that: Overexpression, silencing or knockout of the ESP1 gene in plants.

Images