Genetic transformation method suitable for poa pratensis

Abstract

The invention discloses a genetic transformation method suitable for poa pratensis, and belongs to the technical field of biology. In order to solve the problem that an efficient and stable poa pratensis genetic transformation system is lacked in the prior art, the invention provides a genetic transformation method suitable for poa pratensis, the genetic transformation method directly takes a stem as an infected object, the infected stem can directly differentiate a regenerated seedling, the test period of genetic transformation is shortened, and the cost is reduced. The differentiation rate of the regenerated seedlings is improved. According to the invention, a genetic transformation method with high bacteriostasis rate, differentiation rate and positive transformation rate is obtained through differentiation, bacteriostasis and resistance screening of components with specific mass concentration and limitation of the infection time of agrobacterium and the week age of aseptic seedlings. The kentucky bluegrass genetic transformation method provided by the invention has the characteristics of high efficiency and stable transformation, and can be applied to genetic transformation of kentucky bluegrass to obtain a new variety of high-quality kentucky bluegrass and improve characters.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a genetic transformation method suitable for Kentucky bluegrass. Background Art

[0002] Kentucky bluegrass Poa pratensis L.) is a cool-season lawn grass with beautiful plant posture and strong cold resistance and trampling resistance. It is often used in lawn construction in northern urban landscaping. However, Kentucky bluegrass is easily affected by drought, salt and other adverse conditions, which affect its growth and ornamental value. The above traits can be improved to a certain extent by means of gene transformation. Genetic transformation technology can edit key genes, accurately improve variety traits, and cultivate new varieties with high quality, high yield and multiple resistance. However, there are relatively few studies on the genetic transformation system of Kentucky bluegrass in the existing technology, and the research mainly focuses on the regeneration induction of explants.

[0003] Therefore, those skilled in the art can develop an efficient and stable genetic transformation system suitable for Kentucky bluegrass. Summary of the invention

[0004] The present invention aims to solve the problem of lack of efficient and stable genetic transformation system of Kentucky bluegrass in the prior art and provides a genetic transformation method suitable for Kentucky bluegrass.

[0005] One of the purposes of the present invention is to provide a genetic transformation method applicable to Kentucky bluegrass, the genetic transformation method comprising the following steps: S1: Aseptically treating the seeds of Kentucky bluegrass to obtain sterile materials, placing the sterile materials in a differentiation medium for differentiation induction culture, and obtaining sterile seedlings after differentiation induction; S2: Take the stem segments of the sterile seedlings aged 4-10 weeks after differentiation induction in S1 as materials, inoculate them in the differentiation medium for pre-culture for 1 day, immerse the pre-cultured sterile seedling stem segments in the infection solution containing Agrobacterium for infection, transfer the infected sterile seedling stem segments to the differentiation medium for dark culture, and obtain stem segment receptors; S3: The stem segment receptors obtained in S2 are transferred to an antibacterial medium and cultured in the dark to obtain regenerated seedlings; S4: The regenerated seedlings obtained in S3 are transferred to a resistance screening medium for cultivation to obtain successfully genetically transformed Kentucky bluegrass seedlings.

[0006] In a preferred embodiment of the present invention, the aseptic treatment step in S1 is: remove the seed coat of the meadow grass seeds, soak them in a 75% ethanol solution for 3 minutes, rinse them with sterile water for 3-5 times, then add a 1% sodium hypochlorite solution and soak them for 5 minutes, and rinse them with sterile water for 5-6 times after soaking.

[0007] In a preferred embodiment of the present invention, the differentiation medium in S1 comprises the following components in mass concentration: MS medium 4.4~4.6 g / L, 2,4-D 0.1~0.3 mg / L, 6-BA 1.0~1.4 mg / L, IBA 0.1~0.3 mg / L, sucrose 30~32 g / L and agar 7.0~7.2 g / L, pH=6.0.

[0008] In a preferred embodiment of the present invention, the Agrobacterium in S2 is Agrobacterium tumefaciens or Agrobacterium rhizogenes.

[0009] In a preferred embodiment of the present invention, the Agrobacterium contains an overexpression vector capable of expressing the target gene.

[0010] In a preferred embodiment of the present invention, the infection solution in S2 comprises the following components in mass concentrations: 1 / 2 MS culture medium 2.2-2.4 g / L, sucrose 30-32 g / L; and the infection time is 8-10 min.

[0011] In a preferred embodiment of the present invention, the dark culture time in S2 is 2-3 days.

[0012] In a preferred embodiment of the present invention, the antibacterial medium in S3 comprises the following components in mass concentration: MS medium 4.4~4.6 g / L, 2,4-D 0.1~0.3 mg / L, 6-BA 1.0~1.4 mg / L, IBA 0.1~0.3 mg / L, Timentin 200~400 mg / L, sucrose 30~32 g / L and agar 7.0~7.2 g / L, pH=6.0.

[0013] In a preferred embodiment of the present invention, the resistance screening medium described in S4 comprises the following mass concentration components: MS medium 4.4~4.6 g / L, 2,4-D 0.1~0.3 mg / L, 6-BA 1.0~1.4 mg / L, IBA 0.1~0.3 mg / L, Timentin 200~400 mg / L, hygromycin 25~35 mg / L, sucrose 30~32 g / L and agar 7.0~7.2 g / L, pH=6.0.

[0014] In a preferred embodiment of the present invention, the culture conditions are: daytime temperature 25°C, nighttime temperature 15°C, relative humidity 60%, light intensity 600 μmol·m -2 ·s -1 The culture time of one day is 16 h of light culture and 8 h of dark culture.

[0015] Beneficial effects of the invention: The invention provides a genetic transformation method suitable for meadow fescue, wherein the genetic transformation method directly uses stem segments as the infection object, and the infected stem segments can directly differentiate into regenerated seedlings; the genetic transformation method of meadow fescue in the prior art uses callus tissue differentiated from seeds as the infection object, and then differentiates regenerated seedlings from the callus tissue; compared with the prior art, the genetic transformation method provided by the invention directly transforms from sterile seedlings to plants, thereby reducing the process from sterile seedlings to callus and then to plants; the test period of the genetic transformation method provided by the invention is 2-3 months, which significantly shortens the test period of genetic transformation and improves the differentiation rate of regenerated seedlings.

[0016] The present invention uses a differentiation medium and an antibacterial medium with specific mass concentration components, and limits the infection time of Agrobacterium and the age of sterile seedlings, thereby obtaining a genetic transformation method suitable for meadow bluegrass with high antibacterial rate and differentiation rate. At the same time, the positive transformation rate of the genetic transformation method of meadow bluegrass of the present invention is improved by using a resistance screening medium with specific mass concentration components, which provides support for accurately improving the characteristics of meadow bluegrass varieties and cultivating high-quality, high-yield, and multi-resistant new meadow bluegrass varieties. Therefore, the genetic transformation method of meadow bluegrass provided by the present invention has the characteristics of efficient and stable transformation, and can be applied to the genetic transformation of meadow bluegrass to obtain high-quality new meadow bluegrass varieties and improved characteristics. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The diagram is a schematic diagram of differentiation of the stem segments of five varieties of Kentucky bluegrass, namely, Miracle, Kentucky, Beautiful, Jenny, and Le Tu, after infection in the antibacterial medium at 0d, 7d, 14d, and 21d. Figure 2 Schematic diagram of culturing regenerated seedlings of Kentucky bluegrass in Example 1; A is a schematic diagram of differentiation of regenerated seedlings of Kentucky bluegrass subjected to antibacterial culture for 0 days, 10 days, and 20 days, respectively; and B is a schematic diagram of transferring the regenerated seedlings after antibacterial culture to a resistance screening medium for culture for 0 days and 20 days, respectively; Figure 3 The figure is a DNA detection result of the transgenic positive Kentucky bluegrass seedlings after genetic transformation in Example 1; wherein M represents DL 2000 DNA Marker (bp), lanes 1 to 2 are CK control groups, and lanes 3 to 10 are target gene amplification results. DETAILED DESCRIPTION

[0018] Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It should be particularly noted that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of the present invention to implement and apply the technology of the present invention.

[0019] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific embodiments and the accompanying drawings of the specification. The test methods used in the following examples are conventional methods unless otherwise specified, and the materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained by those skilled in the art through commercial channels.

[0020] Example 1: A genetic transformation method applicable to Kentucky bluegrass S1: Remove the seed coat of Kentucky bluegrass "Miracle" seeds, soak them in 75% ethanol solution for 3 min, rinse them with sterile water for 3-5 times, then add 1% sodium hypochlorite solution and soak them for 5 min. After soaking, rinse them with sterile water for 5-6 times to obtain sterile materials; place the above sterile materials in differentiation medium for differentiation induction culture. The culture conditions are: day / night temperature is 25℃ / 15℃ respectively, relative humidity is 60%, light / dark culture time is 14 h / 10 h respectively, and light intensity is 600 μmol·m -2 ·s -1 , obtain sterile seedlings after differentiation induction; The differentiation medium comprises the following mass concentration components: MS medium 4.4 g / L, 2,4-D 0.2 mg / L, 6-BA 1.0 mg / L, IBA 0.2 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, and autoclaved at 121°C for 20 min; S2: Take the 1.5 cm stem segment at the base of the 10-week-old sterile seedlings after differentiation induction in S1 as the material, inoculate it in the differentiation medium for pre-culture for 1 day, soak the sterile seedling stem segment with good growth after pre-culture in the infection solution containing positive Agrobacterium tumefaciens colonies for 8 minutes, take out the infected sterile seedling stem segment, wipe the surface of the bacterial solution with sterile filter paper, transfer it to the differentiation medium for dark culture for 2 days, and obtain the stem segment receptor; The preparation method of Agrobacterium is as follows: thawing Agrobacterium GV3101 competent cells on ice, then adding 3 μg of plasmid DNA, stirring the bottom of the tube by hand to mix, standing on ice for 5 min, freezing in liquid nitrogen for 5 min, water bathing at 37°C for 5 min, and ice bathing for 5 min in sequence; then adding 700 μL of LB medium without antibiotics, shaking and culturing at 28°C and 200 rpm for 2-3 hours; centrifuging at 6000 rpm for 1 min; taking 100 μL of the above supernatant and gently blowing to resuspend the bacterial block, applying the dissolved bacterial body on an LB plate containing 20 mg / L kanamycin and rifampicin, culturing upside down at 28°C, and after growing a monoclonal strain, using PCR to identify the resistance gene, and saving the positive Agrobacterium tumefaciens colony; The preparation method of the infection solution containing positive Agrobacterium tumefaciens colonies is as follows: culturing the positive Agrobacterium tumefaciens colonies in 20 ml of liquid LB culture medium for 16 h, centrifuging at 4000 rpm for 10 min, removing the supernatant, adding 20 ml of infection solution sterilized at high temperature, wherein the infection solution includes the following mass concentration components: 1 / 2 MS culture medium 2.4 g / L, sucrose 30 g / L, and the 1 / 2MS culture medium is purchased from Hangzhou Mobaite Biotechnology Co., Ltd.; fully mixing, placing on a shaker at 200 rpm for activation for 1 h, and obtaining the infection solution containing positive Agrobacterium tumefaciens colonies; S3: The stem segment receptors obtained in S2 are transferred to an antibacterial medium for dark culture to obtain regenerated seedlings, such as Figure 1 As shown; the antibacterial medium comprises the following mass concentration components: MS medium 4.4 g / L, 2,4-D 0.2 mg / L, 6-BA1.0 mg / L, IBA 0.2 mg / L, Timentin 400 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, and autoclaved at 121°C for 20 min; S4: The regenerated seedlings after 21 days of antibacterial culture in S3 are transferred to a resistance screening medium for culture to obtain successfully genetically transformed Kentucky bluegrass seedlings, and then cultured in a resistance screening medium to obtain successfully genetically transformed Kentucky bluegrass seedlings, such as Figure 2 As shown; The resistance screening medium comprises the following mass concentration components: MS medium 4.4 g / L, 2,4-D 0.2 mg / L, 6-BA 1.0 mg / L, IBA 0.2 mg / L, Timentin 400 mg / L, hygromycin 30 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, and high pressure sterilization at 121°C for 20 min.

[0021] In this example, the total DNA of the successfully transformed Kentucky bluegrass seedlings was used as a template, and hpt557-F (nucleotide sequence is shown in SEQ ID NO.1: ACACTACATGGCGTGATTTCAT) and hpt557-R (nucleotide sequence is shown in SEQ ID NO.2: TCCACTATCGGCGAGTACTTCT) were used as primers to perform PCR detection. The results are shown in FIG. Figure 3 As shown, the Kentucky bluegrass seedlings obtained by the above genetic transformation method successfully obtained a target fragment of 557 bp, indicating that the genetic transformation method provided by the present invention can successfully transform the overexpression vector expressing the target gene into the Kentucky bluegrass seedlings.

[0022] Embodiment 2: The difference between this embodiment and embodiment 1 is that in S2, a 1.5 cm stem segment at the base of a 4-week-old sterile seedling after differentiation induction is used as material; the remaining steps are the same as in embodiment 1.

[0023] Comparative Example 1: The difference between this comparative example and Example 1 is that the meadow grass seeds described in S1 are Kentucky bluegrass seeds; the remaining steps are the same as those in Example 1.

[0024] Comparative Example 2: The difference between this comparative example and Example 1 is that the Kentucky bluegrass seeds described in S1 are beautiful; the remaining steps are the same as Example 2.

[0025] Comparative Example 3: The difference between this comparative example and Example 1 is that the Kentucky bluegrass seeds in S1 are Jenny; the remaining steps are the same as in Example 1.

[0026] Comparative Example 4: The difference between this comparative example and Example 1 is that the Kentucky bluegrass seeds described in S1 are Le Tu; the remaining steps are the same as those in Example 1.

[0027] Comparative Example 5: The difference between this comparative example and Example 1 is that the differentiation medium in S1 contains the following components in mass concentration: MS medium 4.4 g / L, 2,4-D 0.4 mg / L, 6-BA 2.0 mg / L, IBA 0.4 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, and high-pressure sterilization at 121°C for 20 min; the remaining steps are the same as in Example 1.

[0028] Comparative Example 6: The difference between this comparative example and Example 1 is that the differentiation medium in S1 contains the following components in mass concentration: MS medium 4.4 g / L, 2,4-D 0.2 mg / L, 6-BA 2.0 mg / L, IBA 0.2 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, and high-pressure sterilization at 121°C for 20 min; the remaining steps are the same as in Example 1.

[0029] Comparative Example 7: The difference between this comparative example and Example 1 is that the differentiation medium in S1 contains the following components in mass concentration: MS medium 4.4 g / L, 2,4-D 0.2 mg / L, 6-BA 2.0 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, and high-pressure sterilization at 121°C for 20 min; the remaining steps are the same as in Example 1.

[0030] Comparative Example 8: The difference between this comparative example and Example 1 is that the antibacterial medium in S3 contains the following components in mass concentration: MS medium 4.4 g / L, 2,4-D 0.4 mg / L, 6-BA 2.0 mg / L, IBA 0.4 mg / L, Timentin 400 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, and high-pressure sterilization at 121°C for 20 min; the remaining steps are the same as in Example 1.

[0031] Comparative Example 9: The difference between this comparative example and Example 1 is that the infection treatment time in S2 is 12 min; the remaining steps are the same as in Example 1.

[0032] Comparative Example 10: The difference between this comparative example and comparative example 9 is that the antibacterial medium described in S3 contains the following mass concentration components: MS medium 4.4 g / L, 2,4-D 0.4 mg / L, 6-BA 2.0 mg / L, IBA 0.4 mg / L, Timentin 400 mg / L, sucrose 30 g / L and agar 7.2 g / L, pH=6.0, and high-pressure sterilization at 121°C for 20 min; the remaining steps are the same as those in comparative example 9.

[0033] Effect experiment: (1) Effects of different varieties of Kentucky bluegrass seeds on genetic transformation In Example 1 of the present invention and Comparative Examples 1-4, five varieties of Kentucky bluegrass, namely, "Miracle, Kentucky, Beautiful, Jenny, and Le Tu", were used for genetic transformation. The stem segment receptors obtained in S2 in Example 1 and Comparative Examples 1-4 were transferred to an antibacterial culture medium, and the differentiation conditions at 0 d, 7 d, 14 d, and 21 d were observed and statistically analyzed.

[0034] Differentiation rate = (number of differentiated regenerated seedlings / number of inoculated seedlings) × 100% The results are as follows Figure 1 As shown, when the "Miracle" variety of Kentucky bluegrass was cultured in antibacterial medium for 21 days, its stem segment receptor differentiation rate was the fastest and the differentiation condition was the best.

[0035] The results are shown in Table 1. There are significant differences in the differentiation effects of different varieties of Kentucky bluegrass seeds. When the "Miracle" variety of Kentucky bluegrass seeds are used as raw materials to prepare sterile seedlings, the differentiation rate is the highest and the effect is the best.

[0036] Table 1

[0037] (2) Effects of sterile seedlings of different ages on genetic transformation In Example 1 and Example 2 of the present invention, sterile seedling stem segments of different seedling ages were used as materials, and the transformation of Kentucky bluegrass seedlings was carried out by the genetic transformation method provided by the present invention, and the differentiation rate of the above genetic transformation results was statistically analyzed.

[0038] Differentiation rate = (number of differentiated regenerated seedlings / number of inoculated seedlings) × 100% The results are shown in Table 2. When 10-week-old sterile seedling stem segments were used as materials, the Kentucky bluegrass seedlings obtained by the genetic transformation method provided by the present invention increased the differentiation rate by 4.72% compared to when 4-week-old sterile seedling stem segments were used as materials. It can be seen that the genetic transformation effect of 10-week-old sterile seedling stem segments as materials is better.

[0039] Table 2

[0040] (3) Effects of differentiation medium with different composition ratios on genetic transformation of Kentucky bluegrass In Example 1 of the present invention and Comparative Examples 5-7, differentiation medium with different composition ratios was used to induce Kentucky bluegrass seedlings through the genetic transformation method provided by the present invention, and the differentiation rate of the genetic transformation results was statistically analyzed.

[0041] Differentiation rate = (number of differentiated regenerated seedlings / number of inoculated seedlings) × 100% The results are shown in Table 3. Compared with the genetic transformation method provided by the present invention, Comparative Examples 5-7 respectively increase the 2.4-D content in the differentiation medium to 0.4 mg / L, the 6-BA content to 2.0 mg / L, and the IBA content to 0.4 mg / L, and do not add IBA to the differentiation medium; the genetic transformation results show that the differentiation rate is reduced by 2.78%-16.67%, respectively. It can be seen that the genetic transformation effect performed using the differentiation medium provided by the present invention is the best, and its differentiation rate can reach 80.56%.

[0042] Table 3

[0043] (4) Effects of different infection times on genetic transformation of Kentucky bluegrass In Example 1 of the present invention and Comparative Example 9, different infection times were set and the genetic transformation method provided by the present invention was used to induce Kentucky bluegrass seedlings, and the differentiation rate and inhibition rate of the genetic transformation results were statistically analyzed.

[0044] Differentiation rate = (number of differentiated regenerated seedlings / number of inoculated seedlings) × 100% Inhibition rate = (number of seedlings successfully inhibited / number of infected seedlings) × 100% The results are shown in Table 4. When the infection time was 8 min and 12 min, respectively, the genetic transformation results showed that as the infection time increased, the differentiation rate of Kentucky bluegrass seedlings was significantly reduced, but the inhibition rate of Kentucky bluegrass seedlings was less affected.

[0045] Table 4

[0046] (5) Effects of different antibacterial culture media and different infection times on genetic transformation of Kentucky bluegrass The effects of the antibacterial culture media with different composition ratios in Example 1 and Comparative Example 8 of the present invention, the different infection times in Example 1 and Comparative Example 9, and the antibacterial culture media with different composition ratios and the different infection times in Example 1 and Comparative Example 10 on the genetic transformation effect of Kentucky bluegrass were investigated. The genetic transformation method provided by the present invention was used to induce Kentucky bluegrass seedlings, and the differentiation rate and inhibition rate of the above genetic transformation results were statistically analyzed.

[0047] Differentiation rate = (number of differentiated regenerated seedlings / number of inoculated seedlings) × 100% Inhibition rate = (number of seedlings successfully inhibited / number of infected seedlings) × 100% The results are shown in Table 5. Compared with the infection time of 8 min in Example 1, in Comparative Example 8, the 2.4-D content in the antibacterial medium was increased to 0.4 mg / L, the 6-BA content was increased to 2.0 mg / L, and the IBA content was increased to 0.4 mg / L; the genetic transformation results showed that compared with Example 1, the genetic transformation method using the antibacterial medium adopted in Comparative Example 8 reduced the differentiation rate of meadow bluegrass seedlings by 16.68% and the inhibition rate by 4.3%.

[0048] Compared with Example 1 when the infection time was 8 min, in Comparative Example 9 when the infection time was 12 min, the genetic transformation method used reduced the differentiation rate of Kentucky bluegrass seedlings by 13.89% and reduced the inhibition rate by 1.32%.

[0049] Compared with Example 1, the common genetic transformation effect of the antibacterial culture medium with different composition ratios and different infection times in Comparative Example 10 showed that the genetic transformation method adopted in Comparative Example 10 reduced the differentiation rate of meadow Kentucky seedlings by 41.64% and the inhibition rate by 12.64%; it can be seen that the antibacterial culture medium and infection time provided by the present invention can maximize the differentiation rate and inhibition rate of meadow Kentucky seedlings, and the above-mentioned antibacterial culture medium and infection time act synergistically with each other.

[0050] Table 5

[0051] The contents not described in detail in the specification of the present invention are well-known technologies for those skilled in the art. Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be based on the definition of the claims.

Claims

1. A genetic transformation method suitable for Kentucky bluegrass, characterized in that: The genetic transformation method comprises the following steps: S1: Aseptically treating the seeds of Kentucky bluegrass to obtain sterile materials, placing the sterile materials in a differentiation medium for differentiation induction culture, and obtaining sterile seedlings after differentiation induction; S2: Take the stem segments of the sterile seedlings aged 4-10 weeks after differentiation induction in S1 as materials, inoculate them in the differentiation medium for pre-culture for 1 day, immerse the pre-cultured sterile seedling stem segments in the infection solution containing Agrobacterium for infection, transfer the infected sterile seedling stem segments to the differentiation medium for dark culture, and obtain stem segment receptors; S3: The stem segment receptors obtained in S2 are transferred to an antibacterial medium and cultured in the dark to obtain regenerated seedlings; S4: The regenerated seedlings obtained in S3 are transferred to a resistance screening medium for cultivation to obtain successfully genetically transformed Kentucky bluegrass seedlings.

2. The genetic transformation method according to claim 1, characterized in that The aseptic treatment steps described in S1 are: remove the seed coat of Kentucky bluegrass seeds, soak them in 75% ethanol solution for 3 minutes, rinse them with sterile water for 3-5 times, then add 1% sodium hypochlorite solution and soak them for 5 minutes, and rinse them with sterile water for 5-6 times after soaking.

3. The genetic transformation method according to claim 1, characterized in that The differentiation medium described in S1 includes the following mass concentration components: MS medium 4.4~4.6 g / L, 2,4-D 0.1~0.3 mg / L, 6-BA 1.0~1.4 mg / L, IBA 0.1~0.3 mg / L, sucrose 30~32 g / L and agar 7.0~7.2 g / L, pH=6.

0.

4. The genetic transformation method according to claim 1, characterized in that The Agrobacterium in S2 is Agrobacterium tumefaciens or Agrobacterium rhizogenes.

5. The genetic transformation method according to claim 4, characterized in that The Agrobacterium contains an overexpression vector capable of expressing the target gene.

6. The genetic transformation method according to claim 1, characterized in that The infection solution in S2 includes the following mass concentration components: 1 / 2 MS culture medium 2.2~2.4 g / L, sucrose 30~32 g / L; the infection time is 8-10 min.

7. The genetic transformation method according to claim 1, characterized in that The dark culture time described in S2 is 2-3 days.

8. The genetic transformation method according to claim 1, characterized in that The antibacterial medium described in S3 includes the following mass concentration components: MS medium 4.4~4.6 g / L, 2,4-D 0.1~0.3 mg / L, 6-BA 1.0~1.4 mg / L, IBA 0.1~0.3 mg / L, Timentin 200~400 mg / L, sucrose 30~32 g / L and agar 7.0~7.2 g / L, pH=6.

0.

9. The genetic transformation method according to claim 1, characterized in that The resistance screening medium described in S4 includes the following mass concentration components: MS medium 4.4~4.6 g / L, 2,4-D 0.1~0.3 mg / L, 6-BA 1.0~1.4 mg / L, IBA0.1~0.3 mg / L, Timentin 200~400 mg / L, hygromycin 25~35 mg / L, sucrose 30~32 g / L and agar 7.0~7.2 g / L, pH=6.

0.

10. The genetic transformation method according to claim 1, characterized in that The culture conditions were: daytime temperature 25°C, nighttime temperature 15°C, relative humidity 60%, and light intensity 600 μmol·m -2 ·s -1 The culture time of one day is 16 h of light culture and 8 h of dark culture.

Images