Application of SPILR protein in improving resistance of plant to pseudomonas syringae and method

Abstract

The invention discloses application of SPILR protein in improving resistance of plants to pseudomonas syringae and a method, and belongs to the technical field of agricultural science. The method specifically comprises the following steps: inducing arabidopsis thaliana leaves to express SPILR protein by utilizing pseudomonas syringae, and constructing an expression vector pCambia1300-SPILR containing a nucleotide sequence of the SPILR protein; and transforming the expression vector into agrobacterium tumefaciens GV3101 competent cells for culturing, and impregnating plant leaves to obtain the anti-pseudomonas syringae plant. Therefore, the gene engineering technology can be utilized to cultivate resistant varieties.

Description

Technical Field

[0001] The invention relates to an application and method of SPILR protein in improving plant resistance to Pseudomonas syringae, and belongs to the field of agricultural science and technology. Background Art

[0002] Organisms need to make physiological adjustments and adapt to changes in the environment, which is particularly important for plants that grow in a fixed manner and lack adaptive immune mechanisms. Bacteria are common invasive diseases of plants. The defense response of plants to pathogens is a complex biological process involving various changes at the biochemical, molecular (i.e. transcriptional) and physiological levels. The known plant immune system is divided into two levels: ① pattern-triggered immunity (PTI) and ② effector-triggered immunity (ETI), which is generally specific to pathogens or pathogenic factors.

[0003] The apoplast refers to the extracellular space composed of cell wall matrix (containing nanofibrils), apoplast fluid and extracellular vesicles. It is an ecological niche dynamically established by the struggle between host and pathogen. Some responsive proteins, secondary metabolites and non-coding RNA need to be transported to the outside of the body through certain carriers for information communication and lead to changes in the gene expression and physiological level of the invader. In recent years, extracellular vesicles (EVs) have been recognized as important mediators of intercellular and cross-kingdom communication. Proteomic analysis of EVs shows that they are rich in proteins related to biotic and abiotic stress responses. Compared with 11% of the total protein in the plant body, which is used to respond to external stimuli, such proteins account for 26% of the EVs proteome, indicating that the secretion of defense molecules is an important mechanism for the host immune response. Nanofibrils in the apoplast are difficult to completely distinguish from extracellular vesicles in ultracentrifugation sedimentation, and both are important components of plant immune response. However, how the proteins of nanofibrils in the apoplast perform antibacterial functions has not been studied in depth. Pseudomonas syringae infects almost all economically important crop species, making it one of the most common plant pathogens and ranking first among plant bacterial diseases. Summary of the invention

[0004] In order to solve the above-mentioned defects and shortcomings in the prior art, the present invention provides an application and method of SPILR protein in improving the resistance of plants to Pseudomonas syringae. Pseudomonas syringae is used to induce Arabidopsis leaves to express SPILR protein, which can effectively improve the resistance of plants to Pseudomonas syringae.

[0005] To solve the above technical problems: The first purpose of the present invention is to provide an application of a SPILR protein in improving the resistance of plants to Pseudomonas syringae. When Pseudomonas syringae is used to infect Arabidopsis leaves, a series of proteins are screened out from the apoplast extracted from the leaves, wherein the SPILR protein has resistance to Pseudomonas syringae. The naming of the SPILR protein is based on the LRR protein that inhibits the Pseudomonas syringae FlgI protein (taking the initials Suppressing the P. syringae FlgI protein as a leucine-rich repeat (LRR) protein), and the amino acid sequence of the SPILR protein is shown in SEQ ID NO.1.

[0006] Furthermore, the editing nucleotide sequence of the SPILR protein is shown in SEQ ID NO.2.

[0007] The second object of the present invention is to provide an expression vector containing the above-mentioned SPILR protein.

[0008] The third object of the present invention is to provide a cell expressing the above expression vector.

[0009] At the same time, the present application also provides a use of the above expression vector or the above cell in improving the plant's antibody against Pseudomonas syringae.

[0010] The fourth object of the present invention is to provide a method for improving plant resistance to Pseudomonas syringae, the specific process is as follows: Step 1, inducing Arabidopsis leaves to express SPILR protein: injecting Pseudomonas syringae into Arabidopsis leaves, extracting the solid part of the Arabidopsis leaf apoplast (including extracellular vesicles and nanofibrils), separating and extracting SPILR protein, the amino acid sequence of SPILR protein is shown in SEQ ID NO. 1; according to the SPILR protein spectrum detection result, the nucleotide sequence of the edited SPILR protein is analyzed as shown in SEQ ID NO. 2; Step 2, constructing an expression vector pCambia1300-SPIL containing the nucleotide sequence of the SPILR protein; Step 3, transforming the expression vector obtained in step 2 into Agrobacterium tumefaciens GV3101 competent cells for culture; Step 4: Infect plant leaves with the competent cells of Agrobacterium tumefaciens GV3101 transformed in step 3 to obtain plants resistant to Pseudomonas syringae.

[0011] The beneficial technical effects achieved by the present invention are as follows: the present invention discloses an application and method of SPILR protein in improving plant resistance to Pseudomonas syringae, specifically comprising using Pseudomonas syringae to induce Arabidopsis leaves to express SPILR protein, constructing an expression vector pCambia1300-SPILR containing the nucleotide sequence of SPILR protein; transforming the expression vector into Agrobacterium tumefaciens GV3101 competent cells for culture, infecting plant flower buds, and obtaining plants resistant to Pseudomonas syringae after screening. Therefore, resistant varieties can be cultivated using genetic engineering technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 A map of the expression vector pCambia1300-SPILR-GFP of the present invention; Figure 2 Electron microscopic image of the SPILR-positive Arabidopsis plant of the present invention; Figure 3 The Arabidopsis protein extract analysis band diagram of the present invention, wherein 3A is a band diagram of total protein lysate analysis by immunoblotting, and 3B and 3C are bands detected by Western blot in apoplast; Figure 4 Phenotypic analysis of Arabidopsis leaves infected by Pseudomonas syringae of the present invention; Figure 5 Statistical analysis of the damage area of ​​Arabidopsis leaves infected by Pseudomonas syringae of the present invention; Figure 6 Electron microscopic image of Arabidopsis thaliana infected by Pseudomonas syringae of the present invention; Figure 7 The picture of the SPILR protein gene of the present invention expressed in tobacco leaves, wherein TET8-mCherry is a fluorescent picture of the localization marker protein in EVs, GFP is a fluorescent picture, and Merge is a picture after the fluorescence of the marker protein and the target protein are merged; Figure 8 A picture showing the tolerance of tobacco plants transiently expressing the SPILR protein of the present invention to Pseudomonas syringae. DETAILED DESCRIPTION

[0013] The present invention will be further described below in conjunction with specific examples. The following examples are only used to more clearly illustrate the technical solutions of the present invention, and are not intended to limit the scope of protection of the present invention.

[0014] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0015] Example 1 Expression of SPILR protein in Arabidopsis 1. Treatment of Arabidopsis leaves with Pseudomonas syringae: Pseudomonas syringae was cultured overnight in LB medium containing rifampicin (25ug / ml) until the optical density OD600 = 0.004 (5×10 5 CFU / ml). Pseudomonas syringae was then resuspended in an injection buffer containing 10 mM MgCL2 and 0.01% Silwet-77. The Pseudomonas syringae suspension was injected into the bottom of Arabidopsis leaves using a 1 mL syringe, and the leaf phenotype was observed after 48 h.

[0016] 2. Extraction of Arabidopsis apoplasts: Take normal Arabidopsis leaves, infiltrate the leaves with VIB solution (20 mM MES, 2 mM CaCl2, 0.1 M NaCl, pH 6.0), then fix them on the outer wall of the syringe and centrifuge them at 4°C and 900g for 20 minutes. Take the supernatant and centrifuge it at 10,000g for 30 minutes, filter the supernatant with a 40μm filter, and centrifuge the filtrate at 100,000g for 60 minutes (Thermofisher Sorvall WX100+). The precipitate contains SPILR protein, which is then confirmed by mass spectrometry. LC-MS / MS mass spectrometry was detected by Novogene, and the instrument was TripleTOF® 5600.

[0017] The amino acid sequence of the SPILR protein is shown in SEQ ID NO. 1: MQMDWSKTSTLTSQLSSNLFPTTNSSLLSINTTQFTTMNSSFTLFIFTFVIFLQCLNPTGAATCHPDDEAGLLAFKAGITRDPSGILSSWKKGTACCSWNGVTCLTTDRVSALSVAGQADVAGSFLSGTLSPSLAKLKHLDGIYFTDLKNITGSFPQFLFQLPNLKYVYIENNRLSGTLPANIGALSQLEAFSLEGNRFTGPIPSSISNLTLLTQLKLGNNLLTGTIPLGVANLKLMSYLNLGGNRLTGTIPDIFKSMPELRSLTLSRNGFSGNLPPSIASLAPILRFLELGHNKLSGTIPNFLSNFKALDTLDLSKNRFSGVIPKSFANLTKIFNLDLSHNLLTDPFPVLNVKGIESLDLSYNQFHLNTIPKWVTSSPIIFSLKLAKCGIKMSLDDWKPAQTFYYDFIDLSENEITGSPARFLNQTEYLVEFKAAGNKLRFDMGKLTFAKTLTTLDISRNLVFGKVPAMVAGLKTLNVSHNHLCGKLPVTKFPASAFVGNDCLCGSPLSPCKA。

[0018] The cDNA base sequence of the SPILR protein is shown in SEQ ID NO. 2:

[0019] 3. Construction of expression vector: First, RNA from Arabidopsis leaves was extracted using the TRizol (Invitrogen: 15596026CN) method, and then reverse transcribed into cDNA using SMART MMLV Reverse Transcriptase (Clontech: 639522). The cDNA bases were PCR amplified to obtain the PCR amplification product of the SPILR protein. The amplification process was performed using the method in the instruction manual of KOD One™PCR Master Mix (TOYOBO: KMM-101NV). The base sequence of the upstream primer is shown in SEQID NO.3, and the downstream primer is shown in SEQ ID NO.4. The PCR amplification product was introduced into the plasmid pCambia1300 between the KpnI and SalI restriction sites using the ClonExpress Ultra One Stepcloning Kit V2 (Vazyme) kit according to the operating steps in the instruction manual to obtain the expression vector pCambia1300-SPILR-GFP for the SPILR protein. The map is shown in Figure 1 As shown. Among them, the plasmid pCambia1300 contains the green fluorescent protein GFP gene. Then the expression vector is sequenced, and the expression vector with correct sequencing is selected and transformed into Agrobacterium tumefaciens GV3101 competent cells.

[0020] SEQ ID NO.3: ggagaggacagggtaccatgaactcttcctttactctctt; SEQ ID NO.4: ccatggtactagtgtcgacagctttacaaggagaaagaggag.

[0021] 4. Screening positive plants: Select the bacterial solution of Agrobacterium tumefaciens GV3101 that correctly expresses the above expression vector for expansion culture, and use the flower dipping method to transform the bacterial solution into Arabidopsis plants. Flower dipping method: During the bud stage of Arabidopsis, cut off the excess siliques; inoculate Agrobacterium in YEB medium (gentamicin 20 μg / mL, kanamycin 100 μg / mL), and culture to OD600 value of 1.6-2.0; centrifuge at room temperature and 6000rpm for 10 min to collect the bacteria; suspend the Agrobacterium bacteria density in transformation solution (5% sucrose, 0.05% Silwet L-77) to an OD600 density of about 0.8-1.0; soak the Arabidopsis buds in 25ml transformation solution for 5 minutes, take out and keep in the dark overnight, wash with clean water after 24 hours, and culture under normal light until seed formation.

[0022] The positive plants were screened by hygromycin. The specific process was as follows: the collected Arabidopsis T0 seeds were sprinkled on the screening medium (1 / 2MS, 1% sucrose, 0.8% Agar, 25mg / L hygromycin). After 10-14 days, the plants that could take root were positive plants. The positive plants were transferred to the culture soil for culture. The leaves were picked and the GFP fluorescence was observed under a laser confocal microscope. The scale was 50μm. The results are shown in Figure 2. Figure 2 As shown: SPILR can also be seen in the leaves of Arabidopsis positive plants to be localized in the apoplast (between cells). Total protein and apoplast protein were extracted from the leaves of Arabidopsis positive plants, and the total protein of the leaves was treated in the presence (+) and absence (-) of the glycosidase PNGaseF. Coomassie staining of the large subunit of Rubisco showed the protein internal control, and then the total protein lysate was analyzed by immunoblotting. The results are shown in Figure 3 As shown in Figure 3A. From the figure, it can be seen that there are two bands near 100KDa and 70KDa, which can be confirmed as SPILR protein. Western blot detection was then used to detect whether the extracted protein was on the surface of EVs: the vesicles were treated with sodium dodecyl sulfate (with (+SDS) or without (-SDS)) to assess membrane integrity, and then treated with PNGase F to remove N-glycans. The results are shown in Figure 3 In order to distinguish whether the protein exists in vesicles or nanofibrils, trypsin was used in the presence of non-ionic detergent (with (+Triton) or without (-Triton)) and cellulase (with (+CM) or without (-CM)). The results are shown in Figure 3 As shown in 3C in Figure 1, it can be seen that SPILR exists in the apoplast and is an N-glycosylated protein. The sugar chains exist inside the vesicles in the apoplast. The protein is also partially wrapped in the vesicles and partially exists in the nanofibrils.

[0023] Example 2 Detection of resistance to Pseudomonas syringae after SPILR protein expression in Arabidopsis Leaf injury phenotype and statistics: Pseudomonas syringae DC3000 was cultured in LB medium containing rifampicin (25ug / ml) overnight until the optical density OD600 = 0.004 (5×10 5 CFU / ml). Pseudomonas syringae was then resuspended in an injection buffer containing 10 mM MgCl2 and 0.01% Silwet-77 by mass volume. The Pseudomonas syringae suspension was injected into the back of 5-week-old Arabidopsis leaves using a 1 mL syringe, and the leaf phenotype was observed 48 hours later. The relative ratio of the damaged area / leaf area was statistically compared, and the color of plant tissue active oxygen detection was detected using the DAB method kit (Solabo: G4815). The results are shown in Figure 4 and Figure 5As shown: The yellowing and injury area of ​​leaves expressing SPILR were reduced, and the ROS response was weakened, indicating that the expression of the SPILR gene enhanced the resistance to Pseudomonas syringae.

[0024] Transmission electron microscopy of P. syringae morphology: Leaves were harvested 36 h after inoculation with P. syringae DC3000. Leaves were then minced in a solution of 10 mM MgCl2 using sterile scissors. The homogenate was filtered through a 40 µm pore size membrane filter to remove plant debris. The filtrate was centrifuged at 2500 g for 5 min at 4 °C to obtain bacteria. The bacterial pellet was then resuspended in phosphate buffered saline (PBS) to a final concentration suitable for further processing. The resuspended bacterial cells were fixed by mixing with an equal volume of 2.5% glutaraldehyde in 0.1 M sodium bicarbonate buffer (pH 7.2). The mixture was incubated at 4 °C for 2 h. After fixation, the samples were fixed in 1% osmium tetroxide at 4 °C for 1 h, dehydrated through a graded ethanol series, and embedded in epoxy resin. Ultrathin sections were cut using an ultramicrotome, mounted on copper grids, and stained with uranyl acetate and lead citrate. The sections were then examined using a transmission electron microscope. Electron microscopy was performed by Servicebio. The results are as follows Figure 6 As shown: Pseudomonas syringae was obtained from Arabidopsis WT and SPILR-expressing leaves treated with bacteria for 36 hours. Transmission electron microscopy analysis showed that SPILR caused bacterial morphology rupture and flagella shedding, so the expression of SPILR can effectively inhibit bacteria.

[0025] Example 3 Detection of resistance of protein SPILR to Pseudomonas syringae by transient expression in tobacco Tobacco leaf transient expression antibacterial experiment: 5-6 weeks old young non-flowering tobacco plants. Agrobacterium (GV3101) carrying pCambia1300-GFP-SPILR plasmid was cultured in YEB culture medium overnight to OD600: 1.5, centrifuged and suspended and diluted in injection solution (50ml: D-glucose 250mg, 500mM MES 5ml, 20mM Na3PO4 12H2O 5ml, 1M acetosyringone 5ul), OD600: 0.2. Use a 1ml syringe to remove the needle tip and inject it into the back of the tobacco leaf. After 48h, observe GFP fluorescence under a laser confocal microscope, the scale is 50μm; the results are shown in the figure. Figure 7As shown in the figure: Through the fluorescence intensity and expression location, it can be found that the gene of SPILR protein is expressed in the apoplast of tobacco leaves, and co-localized with the EVs marker protein TET8-mCherry. Pseudomonas syringae was resuspended in an injection buffer containing 10mM MgCl2 and 0.01% Silwet-77. OD600 = 0.004 (5×105 CFU / ml) was applied to the front of the leaves. The non-bacterial treatment group used a suspension instead of applying. Photos were taken after 48 hours of treatment. The results are shown in the figure. Figure 8 As shown, Con is no treatment, Ps is treatment with Pseudomonas syringae DC3000, and SPILR is transient expression of SPILR. As can be seen from the figure, tobacco leaves with transient expression of the transformed SPILR gene treated with Pseudomonas syringae showed a "water-infiltrated" phenotype, while the expression of SPILR significantly reduced the damage induced by the pathogen, did not show an "infiltrated" phenotype, and only slightly yellowed.

[0026] The present invention has been disclosed above with preferred embodiments, but they are not intended to limit the present invention. Any technical solutions obtained by adopting equivalent replacement or equivalent transformation solutions fall within the protection scope of the present invention.

Claims

1. Application of the SPILR protein whose amino acid sequence is shown in SEQ ID NO. 1 in improving the resistance of plants to Pseudomonas syringae.

2. The use according to claim 1, characterized in that: The editing nucleotide sequence of the SPILR protein is shown in SEQ ID NO.

2.

3. An expression vector containing the SPILR protein according to claim 1 or 2.

4. A cell expressing the expression vector according to claim 3.

5. Use of the expression vector according to claim 3 or the cell according to claim 4 in improving Arabidopsis thaliana antibodies against Pseudomonas syringae.

6. A method for improving plant resistance to Pseudomonas syringae, characterized in that: The SPILR protein was induced to express in Arabidopsis leaves, and the amino acid sequence of the SPILR protein was shown in SEQ ID NO.

1.

7. The method for improving plant resistance to Pseudomonas syringae according to claim 6, characterized in that: Pseudomonas syringae induces the expression of SPILR protein in Arabidopsis leaves.

8. The method for improving plant resistance to Pseudomonas syringae according to claim 7, characterized in that: The specific process is as follows: Step 1, inducing Arabidopsis leaves to express SPILR protein: injecting Pseudomonas syringae into Arabidopsis leaves, extracting Arabidopsis leaf apoplasts, separating and extracting SPILR protein, and analyzing the nucleotide sequence of the edited SPILR protein according to the SPILR protein spectrum detection result as shown in SEQ ID NO.2; Step 2, constructing an expression vector pCambia1300-SPILR containing the nucleotide sequence of the SPILR protein; Step 3, transforming the expression vector obtained in step 2 into Agrobacterium tumefaciens GV3101 competent cells for culture; Step 4: Infect the plant flower buds with the Agrobacterium tumefaciens GV3101 competent cells transformed in step 3 to obtain plants resistant to Pseudomonas syringae.

Images