SNP (Single Nucleotide Polymorphism) site of ABO blood group variant, A subtype variant blood group identification kit and method

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) site of an ABO blood group variant, and an A subtype variant blood group identification kit and method, and relates to the technical field of biology. The SNP sites of the ABO blood group variant comprise the 155th c.155Ggt from an initiation codon of an ABO gene coding region, and the 155th c.155Ggt from the initiation codon of the ABO gene coding region; mutation of T. A substance for detecting the SNP site of the ABO blood group variant can be applied to preparation of an A-subtype variant blood group identification method and product so as to be effectively applied to rapid detection of patients and blood donors, the A-subtype variant blood group of an individual can be defined, and possible blood transfusion reaction can be prevented in time.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a SNP site of an ABO blood type variant, an A subtype variant blood type identification kit and a method. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] The ABO blood type system is of great significance in fields such as transfusion medicine. ABO blood types can usually be divided into A, B, O, and AB phenotypes, but at the same time, there are a high proportion and a wide variety of ABO subtypes (variants) in the population. Due to the weakened expression of subtype antigens, it may be difficult to accurately identify blood types, which makes it very easy to transfuse incompatible blood, which can cause serious immune hemolytic transfusion reactions and neonatal hemolytic disease. Immune hemolytic transfusion reactions are divided into acute and delayed types. Infusions of incompatible ABO blood types are prone to acute immune hemolytic transfusion reactions, which often occur during the transfusion process or within 24 hours after the end of the transfusion, endangering the patient's life and health. Therefore, accurate identification of these variant antigens is of great significance, which is conducive to formulating appropriate transfusion strategies and improving transfusion safety.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The purpose of the present invention is to determine the proband of A subtype variant blood type. ABO The SNP sites on the gene are marked, and corresponding products are developed for the SNP sites to clarify the ABO blood type genotypes of other individuals to be tested, thereby improving the safety of blood transfusion.

[0006] In order to solve the above technical problems, the present invention particularly adopts the following technical solutions: In a first aspect, a method for detecting a SNP site in the preparation of a subtype A variant blood type identification product is provided, wherein the SNP site is a SNP site of an ABO blood type variant, comprising ABO The mutation is c.155G>T at position 155 from the start codon in the gene coding region.

[0007] In a second aspect, a kit for identifying subtype A variant blood types is provided, the kit comprising a substance for detecting the SNP site described in the first aspect.

[0008] In a third aspect, a method for identifying A subtype variant blood type is provided, the method comprising obtaining a sample to be tested ABO The base type at position 155 from the start codon of the gene coding region, if the SNP site described in the first aspect exists, is determined to be a subtype A variant blood type.

[0009] In a fourth aspect, provided is a substance for detecting the SNP site described in the first aspect, or use of the kit described in the second aspect in preparing an immune hemolytic transfusion reaction identification product.

[0010] Compared with the prior art, the present invention has the following beneficial effects: The present invention has discovered a new SNP site of the ABO blood type system, and a mutation of the SNP site leads to the generation of A subtype variant. The SNP site is a pathogenic SNP site found in a proband with A subtype variant blood type, and it has been confirmed that the mutation causes the red blood cell A antigen to be weaker than the normal A-type human red blood cell A antigen, which can easily lead to difficulties in blood type identification. Once incompatible blood is transfused, it is likely to cause acute hemolytic transfusion reactions. In order to achieve timely detection and prevention, the present invention provides the use of a substance for detecting the SNP site in the preparation of an A subtype variant blood type identification product, as well as a kit and method for A subtype variant blood type identification, in order to effectively apply it to the rapid detection of clinical patients and blood donors, which helps to clarify the individual A subtype variant blood type and prevent possible transfusion reactions in time. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0012] Picture 1 This is the direct sequencing image of the amplified product of the proband's blood sample in Example 1; Picture 2 The sequence diagram of the amplified product of the proband's blood sample in Example 1 after being cloned into the pCR™4-TOPO® TA vector; Picture 3 The blood sample of the proband in Example 3 ABO Electrophoresis diagram of PCR-SSP detection of gene 155 mutation. DETAILED DESCRIPTION

[0013] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0014] It should be noted that: In this document, unless otherwise specified, all implementation methods and preferred implementation methods mentioned in this document can be combined with each other to form a new technical solution; all technical features and preferred features mentioned in this document can be combined with each other to form a new technical solution.

[0015] As used herein, unless otherwise stated, "optionally", "optional", "optional" or "optional" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs or does not occur.

[0016] Herein, the terms "comprise" or "comprising" are intended to include stated elements, integers or steps, but not to exclude any other elements, integers or steps.

[0017] As used herein, "and / or" is used to indicate that one or both of the stated situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0018] Unless otherwise specified, the professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any method or material similar or equivalent to the described content may also be applied to the present invention.

[0019] The present invention discovered a pathogenic SNP site in a subtype A variant, and the SNP site is ABO The mutation of c.155G>T at position 155 from the start codon of the gene coding region is as follows: ABO The third exon of the gene A allele. In this article, the SNP site is the wild type with gene ID NG_006669.2. ABO Gene is reference. Wild type ABO The nucleotide sequence of the third exon of the gene and its flanking parts is shown in SEQ ID No.7. The SNP site is located at position 174 (also ABO The 155th position from the start codon of the gene coding region, such as the underlined base in SEQ ID No.7), this SNP site is the mutation of base G to T. In the proband, it was confirmed that the mutation of this gene caused the A type to mutate, which in turn caused the red blood cell A antigen to be weaker than the normal A type human red blood cell A antigen, which easily led to difficulties in blood typing. Once incompatible blood was transfused, it was likely to cause an acute hemolytic transfusion reaction.

[0020] SEQ ID No.7: CTTCACCGGGAACTCTTGTGCTCACGCTGCTGGCCGCACCATGCACTTTTTGGAGGAAGGGACCAACAGGCAGTCTTCGTTCTGTGTCCTGAGTCTTGGCACACTTCCTTTCTGCAGTTACGGGGTCCTAAGCCCCAGAAGTCTAATGCCAGGAAGCCTGGAACGGGGGTTCT G GTGAGTGCAGGGAAGAGCAGGTGGAGCATCCATGCTGGCCGGGGTGCTGGCTGTGGGCGGGGGTCCCACTCTGGGAACTCCCCCTCCCCTTCCTGGGCCCGCTCTCTATGCTCTGCCCAGTGTAGACATGCTCAACTCTGTGGCCTTGAAGGGTCACCTGGATACCTCTG Based on the above findings, in the first aspect, a method for preparing a subtype A variant blood type identification product is provided, wherein the SNP site is a SNP site of an ABO blood type variant, and comprises ABO The mutation of c.155G>T at position 155 from the start codon of the gene coding region. In this article, the A subtype variant includes the variation of the A antigen in the A blood type, and also includes the variation of the A antigen in the AB blood type.

[0021] In an optional embodiment, the substance for detecting SNP sites includes one or more of a reagent for nucleic acid amplification, a reagent for detecting nucleic acid amplification products, a reagent for constructing a sequencing library, and a reagent for sequencing. More specifically, the substance for detecting SNP sites includes, but is not limited to, primers, enzymes for nucleic acid amplification reactions, fluorescent markers, buffer reagents, dNTPs, salts, etc. Depending on the specific detection means, those skilled in the art can select the above-mentioned reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, reagents for constructing a sequencing library, and reagents for sequencing according to general and more specific teaching materials, references, process manuals, product descriptions, and standard documents, etc., and the present invention does not limit this.

[0022] In an optional embodiment, the reagent for nucleic acid amplification includes a first reagent, and the first reagent includes a reagent for amplification ABO Amplification primers and sequencing primers for the fragment within the third exon of the gene and the third exon flanking sequence. Those skilled in the art can obtain amplification primers and sequencing primers covering the above-mentioned target fragments according to the general rules and methods of primer design in the art. The amplification primers and the sequencing primers can be the same or different.

[0023] In an optional embodiment, in the first reagent, the amplification primers are selected from a primer pair whose nucleotide sequences of the forward primer and the reverse primer are shown as SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0024] In an optional embodiment, in the first reagent, the sequencing primer is selected from a primer pair whose nucleotide sequences of the forward primer and the reverse primer are shown as SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0025] In an optional embodiment, the reagent for nucleic acid amplification includes a second reagent, and the second reagent includes a c.155G>T mutation amplification primer pair.

[0026] In an optional embodiment, the c.155G>T mutation amplification primer pair includes a c.155G>T mutation amplification primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are shown as SEQ ID No. 3 and SEQ ID No. 4, respectively.

[0027] In an optional embodiment, the reagent for nucleic acid amplification also includes a primer pair for amplifying an internal reference.

[0028] In an optional embodiment, the reagent for nucleic acid amplification further includes an internal reference gene primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are shown as SEQ ID No. 5 and SEQ ID No. 6, respectively.

[0029] In an optional embodiment, the second reagent includes an internal reference gene primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are respectively shown as SEQ ID No. 5 and SEQ ID No. 6.

[0030] In a second aspect, a kit for identifying subtype A variant blood type is provided, the kit comprising a substance for detecting the SNP site described in the first aspect, i.e., detecting ABO A substance with a mutation of c.155G>T at position 155 from the start codon of the gene coding region.

[0031] In an optional embodiment, the kit includes the substance for detecting SNP sites described in the first aspect.

[0032] In an optional embodiment, the kit includes one or more of a reagent for nucleic acid amplification, a reagent for detecting a nucleic acid amplification product, a reagent for constructing a sequencing library, and a reagent for sequencing. More specifically, the substances for detecting SNP sites include, but are not limited to, primers, enzymes for nucleic acid amplification reactions, fluorescent markers, buffer reagents, dNTPs, salts, etc. Depending on the specific detection means, those skilled in the art can select the above-mentioned reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, reagents for constructing a sequencing library, and reagents for sequencing according to general and more specific teaching materials, references, process manuals, product descriptions, and standard documents, etc., and the present invention does not limit this.

[0033] In an optional embodiment, the kit includes a first reagent, the first reagent includes a ABO Amplification primers and sequencing primers for the fragments within the 3rd exon of the gene and the 3rd exon flanking sequence.

[0034] In an optional embodiment, in the first reagent, the amplification primers are selected from a primer pair whose nucleotide sequences of the forward primer and the reverse primer are shown as SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0035] In an optional embodiment, in the first reagent, the sequencing primer is selected from a primer pair whose nucleotide sequences of the forward primer and the reverse primer are shown as SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0036] In an optional embodiment, the kit includes a second reagent, which includes a c.155G>T mutation amplification primer pair. A mutation amplification primer pair (Mutation-Specific Primer Pair) refers to a primer pair designed to amplify a DNA fragment containing a specific mutation site. These primer pairs are generally used in PCR-SSP (Sequence Specific Primer) technology to detect gene mutations by specifically identifying mutation sites.

[0037] In an optional embodiment, the c.155G>T mutation amplification primer pair includes a c.155G>T mutation amplification primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are shown as SEQ ID No. 3 and SEQ ID No. 4, respectively.

[0038] In an optional embodiment, the kit further comprises a primer pair for amplifying an internal reference.

[0039] In an optional embodiment, the kit further comprises an internal reference gene primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are respectively as shown in SEQ ID No. 5 and SEQ ID No. 6, and the target gene of the primer pair is glucose-6-phosphate dehydrogenase (G6PD).

[0040] In an optional embodiment, the second reagent includes a c.155G>T mutation amplification primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively; and an internal reference gene primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively.

[0041] In a third aspect, a method for identifying A subtype variant blood type is provided, the method comprising obtaining a sample to be tested ABO If the base type at position 155 from the start codon of the gene coding region contains the SNP site described in the first aspect, the sample to be tested is determined to be of subtype A variant blood type. It should be noted that the method for identifying subtype A variant blood type is not for diagnosis and treatment purposes.

[0042] In an optional embodiment, the ABO Gene ABO Gene A allele.

[0043] In an optional embodiment, the method comprises using the first reagent in the first aspect to amplify the sample to be tested. ABO The gene fragment including the 3rd exon of the gene and the 3rd exon flanking sequence is then detected for the SNP site in the amplified product. Further optionally, the method comprises amplifying the sample to be tested using a primer pair whose nucleotide sequences of the forward primer and the reverse primer are respectively as shown in SEQ ID No. 1 and SEQ ID No. 2, and then sequencing the amplified product using a primer pair whose nucleotide sequences of the forward primer and the reverse primer are respectively as shown in SEQ ID No. 1 and SEQ ID No. 2.

[0044] In an optional embodiment, the method includes using the PCR-SSP method and the second reagent described in the first aspect to amplify the c.155G>T mutation site of the sample to be tested, and determining whether the blood sample to be tested is subtype A based on the corresponding amplification product results obtained, and if the amplification product is present, the sample to be tested is determined to be a subtype A variant blood type. Further optionally, PCR-SSP amplification is performed using a c.155G>T mutation amplification primer pair whose nucleotide sequences for the forward primer and the reverse primer are respectively as shown in SEQ ID No. 3 and SEQ ID No. 4. Further optionally, an internal reference is amplified using a primer pair whose nucleotide sequences for the forward amplification primer and the reverse primer are respectively as shown in SEQ ID No. 5 and SEQ ID No. 6.

[0045] In a fourth aspect, provided is a substance for detecting the SNP site described in the first aspect, or use of the kit described in the second aspect in preparing an immune hemolytic transfusion reaction identification product.

[0046] The present invention is further described below by means of specific examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0047] Example 1 In this example, a pathogenic SNP site is found in an A subtype variant. In this example, a gene test is performed on a proband with an ABO blood type A subtype variant to confirm the gene mutation site. In this example, a PCR-SBT genotyping method is used, and the specific steps are as follows: (1) Prepare human genomic DNA for use as a template for subsequent PCR amplification.

[0048] Based on the informed consent of the proband, 200 µl of whole blood was collected for extraction of genomic DNA according to the instructions of Pre-Filled CartridgeReagent Kit (Cat. No.: 101@S4100-22157, RBC Bioscience), and the concentration and purity of the genomic DNA were determined by a spectrophotometer.

[0049] (2) Detection of the proband using the PCR-SBT method.

[0050] Synthesis includes ABO The amplification primers including the third exon of the gene and its flanking sequences, the specific primer sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, and the amplification primers are diluted to 10 μmol / L with pure water.

[0051] SEQ ID No.1: 5'-CTTCACCGGGAACTCTTGTG-3'; SEQ ID No. 2: 5'-CCAGAGGTATCCAGGTGACC-3'.

[0052] Prepare LA Taq enzyme (Cat. No.: AM61864A, TaKaRa), RNase-free H2O, and the PCR amplification template prepared in step (1), and prepare the PCR reaction system according to Table 1.

[0053] Table 1 Amplification reaction system

[0054] The amplification conditions were as follows: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 1 min, 30 cycles; 72°C extension for 10 min, and amplification product incubation at 4°C. After the PCR amplification was completed, 2 µl of the PCR product was subjected to agarose gel electrophoresis to determine the specificity of the amplified fragment.

[0055] The amplified product was digested with 1 μl shrimp alkaline phosphatase (Cat. No. 55953500, Roche) and 2 μl exonuclease I (Cat. No. AL90785A, TaKaRa) at 37°C for 30 min, and the enzyme was inactivated at 80°C for 15 min.

[0056] The purified PCR product was diluted with 10 µl of pure water and mixed. The two oligonucleotide sequencing primers (sequences shown in SEQ ID No. 1 and SEQ ID No. 2) were diluted to a concentration of 3.2 μmol / L with pure water and sequenced using the BigDye terminator v3.1 sequencing kit (Cat. No. 4336699, ABI). The two sequencing primers were used for sequencing. ABO blood type was found in the proband. ABO A GT heterozygous mutation occurred at the 155th base from the start codon in the coding region of exon 3 of the gene. Picture 1 As shown. After multiple sequencing results, it was shown that the mutation site was not caused by amplification or sequencing errors. Thus, a SNP site marker that can be used for A subtype variant blood type detection was obtained.

[0057] (3) Yes ABO Haplotype sequencing of exon 3 of the gene was performed to determine the mutation site of the proband's A subtype variant gene.

[0058] The PCR amplification reaction system and procedure are the same as (2).

[0059] After amplification, 1 µl of PCR product was cloned into pCR™4-TOPO® TA vector using TOPO TA cloning kit (Cat. No. 2581734, invitrogen). Multiple colonies were selected for haplotype sequencing. The haplotype sequencing primers were the same as the amplification primers to determine the haplotype sequence of the proband ( Picture 2 ), which can be seen in the proband ABO A mutation occurred at base 155 in the gene coding region (c.155G>T).

[0060] The results showed that the mutation was a newly discovered mutation and did not exist in the single nucleotide polymorphism database. The allele formed by the new mutation has not yet been included in the International Society of Blood Transfusion (ISBT) blood group gene mutation database ((ISBT 001) ABOblood group alleles v1.1 171023), indicating that the mutation is very rare and the ABO allele composed of this mutation is a new allele. ABO The 155th position of the gene coding region from the start codon changes from G>T, resulting in the 52nd amino acid changing from cysteine ​​to phenylalanine (p.Cys52Phe). This amino acid change causes the loss or reduction of the A antigen epitope in AB and A type individuals, resulting in weakened expression of the A antigen, thus forming an A subtype variant. In addition, the mutation screening of this site was performed in 200 peripheral blood genomic DNA samples of non-A subtype blood types, and no mutation was found.

[0061] Through the above analysis, it is proved that ABO The SNP sites of the gene are used to detect whether the individual's ABO blood type gene has mutated, thereby determining whether the individual is an ABO variant, whether there is a potential risk of transfusion hemolytic reaction, and to screen the corresponding matching donors to find matching blood for the patient.

[0062] Example 2 The proband ABO The c.155G>T mutation starting from the start codon of the gene causes an amino acid change, resulting in the absence or reduction of the A antigen epitope and thus weakened expression. The resulting A subtype variant can be verified by analyzing the serological results of A, B, AB, A1, and H antigens on the surface of its red blood cells and the expression of A and B antibodies in the serum.

[0063] (1) First, separate the red blood cells and serum of the proband's sample by centrifugation. Then take 200 μl of packed red blood cells and wash them three times with 0.9% saline. Finally, prepare a 2-5% red blood cell suspension for use.

[0064] (2) Positive ABO blood typing (saline method): Take 5 clean small test tubes marked with anti-A, anti-B, anti-AB, anti-A1 and anti-H, add 1 drop each of anti-A, anti-B, anti-AB, anti-A1 and anti-H blood typing reagents (anti-A clone number: 9113D10, SRBC-B3; anti-B clone number: 9621A8, SRBC-C1; anti-AB clone number: 9113D10, 152D12; anti-A1 is a lectin, batch number: 20240322; anti-H clone number: H5B12; Shanghai Blood Biotechnology Co., Ltd.), and then add 1 drop of the proband's 2%~5% red blood cell suspension, mix well, and centrifuge at 1000g for 15 seconds. Gently shake the test tube to make the red blood cells at the bottom of the tube float up, and observe with the naked eye for agglutination (hemolysis); if there is no agglutination, pour the reaction on a glass slide and examine it under a low-power microscope. The results showed that the proband's red blood cells had a reaction intensity of ± with the anti-A blood type reagent (no agglutination observed with the naked eye, weak agglutination under a microscope); a reaction intensity of 4+ with anti-B and anti-AB blood type reagents (all cells were completely agglutinated); a reaction intensity of - with the anti-A1 blood type reagent (no agglutination); and a reaction intensity of 3+ with the anti-H blood type reagent (most cells were agglutinated, with some free cells).

[0065] (3) ABO blood type reverse typing (saline method): Take three clean small test tubes and mark them as Ac, Bc and Oc respectively, add 1 drop of the proband's serum to each, and then add 1 drop of 3% reverse typing red blood cell suspension of A, B and O types (product batch number of A, B and O reverse typing red blood cell suspension: 20240915), mix well and centrifuge at 1000g for 15 seconds. Gently shake the test tube to make the red blood cells at the bottom of the tube float up, and observe with the naked eye for agglutination (hemolysis); if there is no agglutination, pour the reaction on a glass slide and examine it with a low-power microscope. The results show that there is no agglutination.

[0066] Therefore, the serological results determined that the ABO red blood cell type of the proband was A subtype variant.

[0067] Example 3 This example uses the SNP site obtained in Example 1 to perform PCR-SSP detection to verify the feasibility of using the c.155 site as a marker for A subtype variant blood type identification, specifically including the following steps: (1) Prepare human genomic DNA as a template for PCR amplification in subsequent steps.

[0068] Based on the informed consent of the proband, 200 µl of whole blood was collected for extraction of genomic DNA according to the instructions of Pre-Filled CartridgeReagent Kit (Cat. No.: 101@S4100-22157, RBC Bioscience), and the concentration and purity of the genomic DNA were determined by a spectrophotometer.

[0069] (2) Synthesize 2 pieces ABO The specific amplification primers corresponding to the SNP site of the gene and two internal reference amplification primers, the specific primer sequences are shown in Table 2, and the amplification primers are diluted to 10 μmol / L with pure water.

[0070] Table 2 Primer sequences used for PCR-SSP detection

[0071] (3) PCR-SSP amplification to detect the c.155G>T mutation site of the ABO gene in this type of proband Prepare Multiplex PCR Assay Kit Ver. 2 reagents (Cat. No.: RR062A, TaKaRa), RNase-free H2O, and the PCR amplification template prepared in step (1), and prepare the PCR reaction system according to Table 3.

[0072] Table 3 PCR-SSP amplification system

[0073] After the above PCR reaction system is mixed, amplification is performed on the PCR instrument (ABI9700) of ABI Company of the United States according to the following procedures: pre-denaturation at 94℃ for 1min, DNA double strands are fully unwound; denaturation at 94℃ for 30s, annealing at 67℃ for 30s, amplification primers are bound to the template, extension at 72℃ for 30s, extending the desired amplified fragment, reaction for 30 cycles; 72℃ for 10min, amplified fragment is fully extended. Then cool to 4℃.

[0074] After PCR amplification, 2 μl of PCR product was taken for agarose gel electrophoresis to qualitatively determine whether the target amplified fragment existed, that is, whether the sample had the c.155G>T mutation. Picture 3 The blood test sample of this embodiment is ABO Electropherogram of gene 155 mutation detection. Picture 3 Lane 1 is a DNA marker (PROBIO, P68366), lanes 2 and 3 are the results of PCR-SSP detection of the wild-type 155 nucleotide site, all of which are negative; lane 4 is the result of PCR-SSP detection of the mutant 155 nucleotide site, and the amplification result is positive. G6PD gene was used as an internal reference for all samples.

[0075] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a substance for detecting SNP sites in the preparation of an A subtype variant blood type identification product, wherein the SNP sites are SNP sites of ABO blood type variants, including ABO The mutation is c.155G>T at position 155 from the start codon in the gene coding region.

2. The use according to claim 1, characterized in that: The SNP site is a nucleotide sequence such as SEQ ID NO.7, where the 174th position in the sequence mutates from G to T.

3. A kit for identifying subtype A variant blood types, characterized in that: The kit comprises a substance for detecting the SNP site described in claim 1 or 2.

4. The kit according to claim 3, characterized in that The substance for detecting SNP sites includes one or more of a reagent for nucleic acid amplification, a reagent for detecting nucleic acid amplification products, a reagent for constructing a sequencing library, and a reagent for sequencing.

5. The kit according to claim 4, characterized in that The reagents for nucleic acid amplification include a first reagent and / or a second reagent; The first reagent includes a reagent for amplification ABO Amplification primers and sequencing primers for the fragments within the third exon of the gene and the flanking sequence of the third exon; The second reagent includes a c.155G>T mutation amplification primer pair.

6. The kit according to claim 5, characterized in that In the first reagent, the amplification primer and the sequencing primer are independently selected from a primer pair whose nucleotide sequences of the forward primer and the reverse primer are respectively shown as SEQ ID No. 1 and SEQ ID No. 2; and / or, The c.155G>T mutation amplification primer pair includes a c.155G>T mutation amplification primer pair whose nucleotide sequences of the forward primer and the reverse primer are shown as SEQ ID No. 3 and SEQ ID No. 4, respectively.

7. The kit according to claim 4, characterized in that The reagent for nucleic acid amplification also includes an internal reference gene primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are shown as SEQ ID No. 5 and SEQ ID No. 6 respectively.

8. A method for identifying subtype A variant blood type, characterized in that: Including obtaining samples to be tested ABO The base type at the 155th position from the start codon of the gene coding region, if the SNP site described in claim 1 or 2 exists, then the sample to be tested is determined to be of A subtype variant blood type.

9. The method according to claim 8, characterized in that A method comprising amplifying a sample to be tested using the first reagent described in any one of claims 5 to 7 ABO The gene fragment including the 3rd exon of the gene and the flanking sequence of the 3rd exon, and then the SNP site in the amplified product is detected; Or, comprising using the PCR-SSP method and the second reagent described in any one of claims 5 to 7 to amplify the c.155G>T mutation site of the sample to be tested, and if an amplification product is present, the sample to be tested is determined to be of subtype A variant blood type.

10. Use of a substance for detecting the SNP site described in claim 1 or 2, or a kit described in any one of claims 3 to 7 in the preparation of an immune hemolytic transfusion reaction identification product.

Images