Application of genetic markers associated with chicken body size traits in genetic breeding

Abstract

This application belongs to the field of biotechnology and discloses the application of genetic markers associated with chicken body size traits in genetic breeding. The molecular markers are SNP1 and SNP3 sites of the Hes5B gene; the SNP1 site is g.1408791T>C, and the SNP3 site is g.1409422T>C. This application analyzes three SNP sites in the Hes5B gene and determines the relationship between SNP1 and SNP3 and chicken body size traits, as well as the relationship between different sites, genotypes and haplotype combinations at different sites, and the size and shape of roosters and hens. This provides guidance for genetic breeding related to chicken body size traits. The invention also provides primers and a kit for implementing this application.

Description

Technical Field

[0001] The present application relates to the biological field, and specifically to the application of genetic markers associated with body size traits of chickens in genetic breeding. Background Art

[0002] In the prior art, relevant literature on genetic markers associated with chicken body size traits can be found in the following records:

[0003] Publication No. CN116949190A, the subject of the patent application is a SNP molecular marker, detection primer, kit and breeding method related to chicken growth, body size and carcass traits. It discloses a SNP site rs53587188 in intron 1 of the chicken FGF2 gene, which has an A>G mutation, as a molecular marker in the patent application;

[0004] Publication number CN115198022A is a patent application for an IGF2BP1 gene molecular marker related to chicken body size traits, its application and breeding method, which discloses the correlation between deletion mutations in the chicken IGF2BP1 gene promoter region and 23 chicken body size traits.

[0005] As we all know, in organisms, a SNP site mutation occurs almost every 300 bp. Therefore, for birds, their genome is huge and there are many SNP sites.

[0006] In the prior art, there are not many literatures on the research of SNP sites related to the body size and shape of chickens, indicating that research in this direction has just started.

[0007] The present applicant conducted relevant research on the changes in the body size and shape of chickens and discovered some new phenomena, which led to the filing of this case. Summary of the Invention

[0008] The purpose of the present invention is to provide an application of a genetic marker associated with the body size trait of chickens in genetic breeding. The application of the present invention analyzes three SNP sites of the Hes5B gene and determines the relationship between the SNP1 site and the SNP3 site and the body size trait of chickens, as well as the relationship between different sites, the genotypes and haplotype combinations of different sites and the size and shape of roosters and hens, providing guidance for genetic breeding related to the body size traits of chickens.

[0009] At the same time, the invention also proposes primers and a kit for realizing the application.

[0010] To achieve the above objectives, the present application discloses an application of a genetic marker associated with the body size trait of chickens in genetic breeding, wherein the molecular markers are the SNP1 site and the SNP3 site of the Hes5B gene; the SNP1 site is the g.1408791T>C site, and the SNP3 site is the g.1409422T>C site.

[0011] Preferably, the chicken is the Zhangjiajie White Feather Black-bone Chicken. Produced in Wulingyuan District, Zhangjiajie City, Hunan Province, the Zhangjiajie White Feather Black-bone Chicken is a local dual-purpose meat and egg breed. This chicken, a newly discovered breed during the third national genetic resource survey in 2021, is distinguished by its long shank and relatively stable genetics. The new breed designation of the Zhangjiajie White Feather Black-bone Chicken can be found in Announcement No. 846 of the Ministry of Agriculture and Rural Affairs of the People's Republic of China.

[0012] The Hes gene family is essential for influencing the proliferation and differentiation of progenitor / stem cells and maintaining intestinal development and homeostasis. It also negatively regulates the development of various secretory cells. This study selected the Hes 5B gene as a candidate gene for the chicken trait of tall shank length. Sequencing technology was used to identify polymorphic loci and to conduct association analysis with several chicken body size traits. The aim was to identify molecular markers associated with the "tall legs" trait. This would provide basic data and technical support for the selection and breeding of chickens with distinctive traits, as well as for the conservation, development, and genetic improvement of the genetic resources of Hunan's local poultry breeds.

[0013] In the above application, the body size trait is one or more combinations of body oblique length, keel length and tibia length.

[0014] In the above application, the SNP1 locus is associated with the shin length and shin length index of roosters, and the SNP1 locus is associated with the keel length of hens;

[0015] The SNP3 locus is associated with the shank length index of roosters, and the SNP3 locus is associated with the body oblique length and shank length of hens.

[0016] In the above application, the AA genotype of the SNP1 site is correlated with tibia length and tibia length index; the AG genotype of the SNP1 site is correlated with keel length;

[0017] The AG genotype of the SNP3 site is associated with the shank length index of hens; and the GG genotype of the SNP3 site is associated with the shank length index of roosters.

[0018] In the above application, the rooster's haplotype combination H1H2 is related to the rooster's shin length and shin length index; the hen's haplotype combination H1H4 is related to the hen's body oblique length, and the hen's haplotype combination H2H4 is related to the hen's shin length index;

[0019] The haplotype combination H1H2 is a combination of haplotype H1 and haplotype H2; the haplotype combination H1H4 is a combination of haplotype H1 and haplotype H4; the haplotype combination H2H4 is a combination of haplotype H2 and haplotype H4;

[0020] The nucleotide combination of SNP1 and SNP3 of haplotype H1 is AA; the nucleotide combination of SNP1 and SNP3 of haplotype H2 is AG; the nucleotide combination of SNP1 and SNP3 of haplotype H4 is GG.

[0021] At the same time, the present invention also discloses primers for amplifying Hes5B gene-related molecular markers, the primers are used to achieve any of the above applications, the primers include a first primer pair for amplifying a first nucleotide sequence containing a SNP1 site and a second primer pair for amplifying a second nucleotide sequence containing a SNP3 site;

[0022] The nucleotide sequences of the upstream primer and the downstream primer of the first primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2;

[0023] The nucleotide sequences of the upstream primer and the downstream primer of the second primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4;

[0024] The first nucleotide sequence is shown in SEQ ID NO.5;

[0025] The second nucleotide sequence is shown as SEQ ID NO.6.

[0026] Finally, the present invention also discloses a kit containing the primers described above.

[0027] The beneficial effects of this application are:

[0028] 1. This experiment combines genome resequencing technology with growth performance data to deeply explore candidate genes that may affect rooster tibia length and analyze their mechanism of action in the regulation of chicken growth and development and the skeletal system.

[0029] 2. The present invention analyzes three SNP sites of the Hes5B gene and determines the relationship between SNP1 and SNP3 sites and the body size traits of chickens, as well as the relationship between different sites, genotypes and haplotype combinations of different sites and the size and shape of roosters and hens, providing guidance for genetic breeding related to the body size traits of chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1A This is a comparison of the shank lengths of different sexes of Zhangjiajie white-feathered black-bone chickens;

[0031] Figure 1BThis is a comparison chart of the difference in shin length to weight ratio between different sexes of Zhangjiajie white-feathered black-bone chicken;

[0032] Figure 1C This is a comparison chart of the shin length of different sexes in the high and low shin length groups of Zhangjiajie white-feathered black-bone chicken;

[0033] Figure 1D This is the agarose gel electrophoresis diagram of DNA from individual poultry blood samples;

[0034] Figure 1E This is the autosomal SNP density map of Zhangjiajie white-feathered black-bone chicken population;

[0035] Figure 1F This is a statistical chart of the number of SNP variations in Zhangjiajie white-feathered black-bone chicken;

[0036] Figure 1G This is the statistical graph of the SNP heterozygous ratio of Zhangjiajie white-feathered black chicken;

[0037] Figure 1H This is the principal component analysis result diagram;

[0038] Figure 1I This is a population structure analysis diagram of Zhangjiajie White Feather Black-bone Chicken;

[0039] Figure 1J This is the NJ tree diagram of Zhangjiajie White-feathered Black-bone Chicken;

[0040] Figure 2A Schematic diagram of the selection area for high and low shank length groups of Zhangjiajie white-feathered black-bone chicken;

[0041] Figure 2B This is the Venn diagram of the selected genes of Zhangjiajie White Feather Black-bone Chicken;

[0042] Figure 2C This is the GO annotation map of candidate differentially expressed genes in Zhangjiajie white-feathered black-bone chicken;

[0043] Figure 2D This is a schematic diagram of the TOP20 representative KEGG pathways of Zhangjiajie white-feathered chicken;

[0044] Figure 3A Figure 1 is the result of PCR amplification of Hes5B gene;

[0045] Figure 3B Linkage disequilibrium analysis of SNP1 and SNP3 loci of Hes5B gene;

[0046] Figure 3C This is a comparison chart of Sanger sequencing of SNP1, SNP2, and SNP3 sites;

[0047] Figure 3DThis is the association analysis diagram between SNP1, SNP2, SNP3 loci and body size traits of Zhangjiajie white-feathered black-bone chicken; DETAILED DESCRIPTION

[0048] The present invention will be described clearly and completely below in conjunction with the examples of the present invention. In the description of the present invention, it should be noted that, in the examples, where specific conditions are not specified, conventional conditions or conditions recommended by the manufacturer were used. Reagents or instruments used where the manufacturer is not specified are conventional products that can be purchased commercially.

[0049] Part I Materials and Methods

[0050] 1.1 Sample Information

[0051] Samples for both experiments were provided by the Wulingyuan District Animal Husbandry and Aquatic Products Affairs Center. Tibia length, body oblique length, and keel length were measured using vernier calipers from 251 300-day-old Zhangjiajie white-feathered black-bone chickens (117 males and 134 females). Blood (5 mL) was collected from the subwing vein and placed in an EDTA-anticoagulant tube, mixed, and transferred to a cryovial. DNA was extracted using the phenol-chloroform method, and DNA concentration and quality were determined using a nucleic acid quantitative analyzer and 1.5% agarose gel electrophoresis.

[0052] 1.2 Quality Control and Variant Detection of Resequencing Data

[0053] Whole-genome resequencing was commissioned to Guangzhou Kidio Biotechnology Co., Ltd. Qualified genomic DNA was randomly fragmented into small fragments ranging from 300-400 bp using a Covaris fragmentor. The DNA fragments were then subjected to end-repair, 3'-end poly A tailing, sequencing adapter ligation, fragment screening, and PCR amplification to complete library preparation. Finally, the constructed library underwent 10× whole-genome resequencing using an Illumina HiSeq.

[0054] Clean reads were aligned to the chicken genome (GCF_016699485.2) using Burrows-Wheeler Aligner (v0.7.17) software. Alignment results were sorted using samtools software, and coverage statistics were performed using bedtools software. Genome Analysis Toolkit (GATK) software was used to identify and call all single nucleotide polymorphisms (SNPs) and insertions / deletions (INDELs) in the entire genome of each individual sample. The detected variants were filtered using VariantFiltration with a filtering parameter of -Window0.05. 4. -filter "QD<4.0||FS>60.0||MQ<40.0", -G_filter "GQ<20", means that sites with a variation quality (Quality) / coverage depth (Depth) ratio less than 4.0, a value converted from the Fisher test P-value greater than 60, a read alignment quality value root mean square less than 40, and a genotype quality less than 20 will be filtered out. Finally, high-quality SNPs are obtained for annotation analysis using ANNOVAR software.

[0055] 1.3 Population structure and linkage disequilibrium analysis

[0056] Using gcta software, principal component analysis (PCA) analysis was performed based on the SNP markers obtained after screening to obtain the variance explanation rate of each principal component and the score matrix of the sample in each principal component, and the resulting data were presented using scatter plots to explore population structure and genetic differences. Population structure analysis was performed using Admixture and pophelper. Among them, Admixture inferred the population structure, and pophelper plotted the genetic composition of each sample in each subpopulation into a bar graph. Then, based on all SNP information of the two sets of data, MEGA-X software was used to construct a phylogenetic tree using the neighbor-joining method (NJ), where the bootstrap value of the phylogenetic tree was obtained after up to 1000 calculations.

[0057] 1.4 Select signal analysis

[0058] For the filtered SNP dataset, PopGenome software was used to calculate the genetic differentiation index (Fst) and nucleotide diversity (πratio) of the high and low groups using a sliding window of physical length, with a window of 100 kb and a step size of 10 kb, to identify severely differentiated regions. For Fst, the Fst value was normalized to the normally distributed ZFst value according to the formula: "ZFst per window = (Fst per window - average Fst of all windows) / standard deviation of Fst of all windows". For the π value, group H was used as the experimental group and group L as the control group, and the ratio was calculated according to the "log2(πratio(πL / πH)" method. The distribution between the two groups can be intuitively seen using a Manhattan plot. The top 5% values ​​of the ZFst and πratio methods were used as thresholds, and the windows were selected as the selected regions. Functional enrichment analysis of differentially expressed genes in the candidate regions was performed using GO enrichment classification and KEGG pathways.

[0059] 1.5 PCR amplification and DNA sequencing of candidate gene polymorphic sites

[0060] Based on previous resequencing analysis, we investigated differences in tibia length between different populations within the same population and screened candidate genes and variants associated with tibia length for PCR amplification and DNA sequencing. Primers were designed using Primer 5.0 software based on gene sequence information provided by the NCBI website. The total PCR reaction volume (25 μl) consisted of 12.5 μl of 2× Taq PCR Mix, 1 μl of each upstream and downstream primer (10 μM), 1 μl of DNA template (500 ng / μl), and 9.5 μl of double-distilled water. The reaction procedure was as follows: 95°C for 5 min, 95°C for 30 s, TM for 30 s, 72°C for 1 min 20 s, 34 cycles, and 72°C for 5 min. PCR products were detected by 1.5% agarose gel electrophoresis. All primers and sequencing were performed by Beijing Qingke Biotechnology Co., Ltd. Finally, sequencing peaks were analyzed using SnapGene software.

[0061] 1.6 Data Analysis

[0062] All data were statistically analyzed using SPSS 27.0. One-way ANOVA and t-test were used for analysis of variance and significance, respectively. All data are expressed as "mean ± standard error." P < 0.05 indicates a significant difference, P < 0.01 indicates an extremely significant difference, and P > 0.05 indicates an insignificant difference.

[0063] SHEsis online software was used to perform genotyping, linkage disequilibrium, and haplotype analysis on SNP loci. When the haplotype frequency was less than 0.03, it was considered that the haplotype did not exist. The Hardy-Weinberg expected value was determined by the χ2 test, and the population polymorphism information content (PIC) was calculated.

[0064] Part II Results and Analysis

[0065] 2.1 Analysis of the difference in shank length between high and low-lying white-feathered chickens in Zhangjiajie

[0066] After measuring the shin length of 30 roosters and 30 hens, the six with the longest shin lengths were selected from each sex as the high shin group (HT), and the six with the shortest shin lengths were selected as the low shin group (LT) for significant difference analysis. The results showed that the shin lengths of both roosters and hens in the HT group were significantly longer than those in the LT group, and the difference reached an extremely significant level (P<0.001) ( Figure 1A The shin length to weight ratio can be used as an indicator to evaluate growth rate and body shape development. The shin length to weight ratio of roosters was significantly different (P<0.05), while the difference in hens was not significant (P>0.05) ( Figure 1B The results highlighted significant differences in the shank length index between males. It is worth noting that within the HT group, the minimum shank length of males was significantly greater than the maximum shank length of females, and the difference also reached a highly significant level (P<0.001). Figure 1C This indicates that shin length in males is significantly longer than that in females not only across groups but also within the same group. Comprehensive analysis leads to the following conclusion: In Zhangjiajie white-feathered black-bone chickens, shin length in males is significantly longer than that in females, suggesting that this difference in shin length may have a genetic basis.

[0067] Figure 1A This is a comparison of the shank lengths of different sexes of Zhangjiajie white-feathered black-bone chickens;

[0068] Figure 1B This is a comparison chart of the difference in shin length to weight ratio between different sexes of Zhangjiajie white-feathered black-bone chicken;

[0069] Figure 1C This is a comparison chart of the shin length of different sexes in the high and low shin length groups of Zhangjiajie white-feathered black-bone chicken.

[0070] 2.2 Data quality control and variation detection

[0071] To ensure that the extracted DNA samples meet the requirements of subsequent library construction, this example uses 1.5% agarose gel electrophoresis to detect the purity and integrity of the DNA samples. Figure 1D As can be seen, the DNA bands are clear and have no tailing, and the OD260 / 280 values ​​of each sample are between 1.8 and 2.0. This indicates that the DNA samples have not been degraded and meet the requirements for sequencing library construction.

[0072] After filtering the WGS data, the average data volume for each individual was 14.22Gb (clean base), the average alignment rate to the chicken reference genome was 98.59%, the average Q20 was 98.19%, the average Q30 was 94.79%, the GC content was between 42.97% and 44.94%, the Q20 and Q30 ratios were relatively high, and the GC content results had no obvious bias. The average coverage depth of the genome was 11.49%, and the average 1X coverage was 97.83% (Table 1-1, Table 1-2).

[0073] After filtering the quality control data of Zhangjiajie white-feathered black-bone chicken population, a total of 12,467,759 high-quality SNPs were identified. Among the 41 autosomes, SNPs were mostly distributed on chromosomes 1, 2, 3, and Z. The distribution of SNPs on chromosomes can be seen in Figure 2. Figure 1E .

[0074] Figure 1D This is the agarose gel electrophoresis diagram of DNA from individual poultry blood samples;

[0075] Figure 1E This is the autosomal SNP density map of Zhangjiajie white-feathered black-bone chicken population;

[0076] Table 1-1 Sequencing data quality statistics

[0077]

[0078]

[0079] Table 1-2 Genome alignment results and sequencing depth statistics

[0080]

[0081] 2.2 Analysis of the population structure of high and low shank length of Zhangjiajie white-feathered black-bone chickens

[0082] 2.2.1 SNP detection results of Zhangjiajie white-feathered black-bone chickens with high and low shank length groups

[0083] The number of SNPs and heterozygosity rates detected in the whole genome of the HT and LT groups of roosters were statistically analyzed. The number of SNPs in each individual was as follows: Figure 1F As shown in Figure 2, an average of 5,620,173 SNPs were detected in the HT group, with the number of individual SNPs ranging from 5,428,694 to 5,761,518. An average of 5,627,736 SNPs were detected in the LT group, with the number of individual SNPs ranging from 5,486,561 to 5,745,243. The average number of SNPs detected in the LT group was slightly higher than that in the HT group. The SNP heterozygosity rate is the ratio of the number of heterozygous SNPs to the size of the genome. The SNP heterozygosity rate of each individual is shown in Figure 2. Figure 1GAs shown in the figure, the average SNP heterozygosity rate in both the HT and LT groups was 0.62%. The above data indicate that both the HT and LT groups of roosters have high genetic variability and stability at the genomic level, as reflected by similar numbers of SNPs and consistent heterozygosity rates.

[0084] 2.2.2 Analysis of the population structure of high and low shank length of Zhangjiajie white-feathered black-bone chickens

[0085] To investigate the genetic relationships between different tibia length groups within a population of Zhangjiajie white-feathered black-bone chickens, we analyzed the autosomal variation of 12,467,759 high-quality single-nucleotide polymorphisms (SNPs) for population genetic diversity analysis. PCA analysis revealed that PC1 (explaining 10.71% of the total variation) and PC2 (explaining 10.2% of the total variation) could reflect the genetic relationships between the different tibia length groups. At the PC1 and PC2 levels, the different tibia length groups showed clear separation, but the two groups did not form completely independent populations ( Figure 1H The results of population structure analysis showed that when K = 2 (assuming the number of ancestral populations is 2), Zhangjiajie White Feather Black-bone Chicken could not be divided into two completely independent populations ( Figure 1I The NJ phylogenetic tree results showed that the HT group and the LT group could be clearly distinguished, but the individuals L-2-a and L-4-a in the LT group had a closer genetic relationship with the individuals in the H group ( Figure 1J ).

[0086] The above results showed that there was a certain degree of genetic differentiation between the HT and LT groups (i.e., different tibia length groups) of Zhangjiajie white-feathered black-bone chickens, but the degree of differentiation was low, and some individuals shared a similar genetic background.

[0087] Figure 1F This is a statistical chart of the number of SNP variations in Zhangjiajie white-feathered black-bone chicken;

[0088] Figure 1G This is the statistical graph of the SNP heterozygous ratio of Zhangjiajie white-feathered black chicken;

[0089] Figure 1H This is the principal component analysis result of Zhangjiajie white-feathered black-bone chicken;

[0090] Figure 1I This is a population structure analysis diagram of Zhangjiajie White Feather Black-bone Chicken;

[0091] Figure 1J This is the NJ tree diagram of Zhangjiajie White-feathered Black-bone Chicken.

[0092] 2.3 Genome-wide selective scanning and enrichment analysis

[0093] Using the sliding window technique, the Fst value and πratio of each window were calculated, and the top 5% of the highest-scoring windows (Fst>0.06, Log2(πratio)>1.2) were selected as candidate regions affected by selection. Combining the results of the two selective sweeps, we annotated 931 selected regions in the genome, of which the most abundant were on chromosome Z, reaching 222, followed by chromosome 1 (128) and chromosome 2 (125). ( Figure 2A Compared with the L group, the H group, as a domesticated population that was cleared by selection, identified 1825 genes using the Fst method and 1690 genes using the πratio method. The intersection of the two methods identified 415 key genes ( Figure 2B ).

[0094] To further explore the key genes affecting tibia length, we performed GO enrichment analysis on the candidate differentially expressed genes ( Figure 2C The results showed that there were 109 regions with significant differences. GO terms categorized as biological processes primarily involved ion transmembrane transport, chromosome organization, protein synthesis and modification, cell adhesion and migration, signal transduction, and multicellular development. These processes are closely related to molecular functions such as metabolism, ion balance, potential regulation, cell proliferation and transport, and growth and development regulation. Involved genes included FGF10, Hes5, TGFBR2, SMAD2, CTNNA2, Homer1, ATP5F1A, PLCH2, SLC15A4, PANK4, HSD17B4, Pex10, Skp2, CDH13, ADGR12, and NIPBL (Table 2-1).

[0095] KEGG enrichment analysis revealed that a total of 51 pathways were enriched, and the regions with significant differences were mainly enriched in glyoxylate and dicarboxylic acid metabolism, glycine, serine and threonine metabolism pathways, Noth signaling pathway, ECM-receptor interaction pathways, FOXO signaling pathway, TH17 cell differentiation and energy metabolism, etc. ( Figure 2D , Table 2-1).

[0096] Given the relatively small sample size of this study, the Hes5 gene will be subsequently selected for verification in the Zhangjiajie white-feathered black-bone chicken population to clarify the correlation between the polymorphism of the candidate gene and the high or low shank length phenotype, and provide corresponding reference for the selection and breeding of high-shank individuals in actual production.

[0097] Figure 2A Schematic diagram of the selection area for high and low shank length groups of Zhangjiajie white-feathered black-bone chicken;

[0098] Figure 2B This is the Venn diagram of the selected genes of Zhangjiajie White Feather Black-bone Chicken;

[0099] Figure 2C This is the GO annotation map of candidate differentially expressed genes in Zhangjiajie white-feathered black-bone chicken;

[0100] Figure 2D Schematic diagram of the TOP20 representative KEGG pathways of Zhangjiajie white-feathered chicken.

[0101] Table 2-1 Items and genes related to the regulation of tibia length by selected genes (P<0.05)

[0102]

[0103]

[0104] 2.4 SNPs analysis of candidate gene fragments

[0105] Based on previous resequencing analysis, the Hes 5B gene was selected as a candidate gene affecting the shank length trait of white-feathered black-bone chickens. Based on the Hes 5B gene sequence information provided by the NCBI website, specific primers were designed for the mutation site in its exon and PCR amplification was performed (Table 3-1). PCR amplification was performed using Zhangjiajie white-feathered black-bone chicken genomic DNA as a template. The results showed that the amplified fragment was consistent with the target fragment in size and had good specificity, allowing direct sequencing ( Figure 3A ).

[0106] SnapGene software was used to align the PCR product sequencing results with the gene reference sequence. Figure 3C The following single nucleotide polymorphisms (SNPs) are present in the genomic sequence of the Hes5B gene: at position 1408791, SNP1 represents a thymine (T) to cytosine (C) substitution; at position 1409392, SNP2 represents a thymine (T) to adenine (A) substitution; and at position 1409422, SNP3 represents a thymine (T) to cytosine (C) substitution.

[0107] Table 3-1 PCR amplification primer information for Hes 5 gene mutation sites in Zhangjiajie white-feathered black-bone chicken

[0108]

[0109] The target sequence amplified by primers SEQ ID NO.1 and SEQ ID NO.2 is:

[0110] agagggctattctcggtgtttgcaagaagctttccatttcctctctcttcacaaagtccgaactgaaactcagaccaaactccta

[0111] agtcacttccagaagagccaatcagctgctccagaggtttccttttctcccagcaagcccactaccctgaagcaagcatcac

[0112] caaaagacactggtactctctggaggccctggtagtcagggaagctctcacttagtgaacctttgccttttagagtccagaggaagaatctgactgcatctgatagtccagctctga(SEQ ID NO.5);

[0113] The target sequences amplified by primers SEQ ID NO.3 and SEQ ID NO.4 are:

[0114] tctgctattgtgctgcctatctctctgattggccatagagtgtgggaaactccgccaagctacagacccacagactctcagga

[0115] aggctgcacagtataaatacagggccgaggcagcttccagcaacacatttctcctggacttccactccgagacagtccttcc

[0116] cctctttggacagatggctcccagcattgttttcatggagcccgacaacctgctgacaccaaaggagaaaaacaaagtaagt

[0117] ccagacacagtaaggcagcttggagccatgctctcagctgttctcatagcagtttccaaaagctgagaaactggtccacgttgcttaggagcagtgtgaaatggcagagagga(SEQ ID NO.6);

[0118] The target sequences amplified by primers SEQ ID NO.7 and SEQ ID NO.8 are:

[0119] tgctattgtgctgcctatctctctgattggccatagagtgtgggaaactccgccaagctacagacccacagactctcaggaa

[0120] ggctgcacagtataaatacagggccgaggcagcttccagcaacacatttctcctggacttccactccgagacagtccttccc

[0121] ctctttggacagatggctcccagcattgttttcatggagcccgacaacctgctgacaccaaaggagaaaaacaaagtaagtc

[0122] cagacacagtaaggcagcttggagccatgctctcagctgttctcatagcagtttccaaaagctgagaaactggtccacgttgcttaggagcagtgtgaaatggcagagaggatctaatagtgagtctctttccctttgctttttacag (SEQ ID NO. 9);

[0123] Figure 3A This is the PCR amplification result diagram of the Hes5B gene, where wells 1-3, wells 4-6, and wells 7-9 are PCR amplification product 1, PCR amplification product 2, and PCR amplification product 3 of the Hes5B gene, respectively;

[0124] Figure 3C for Figure 3B This is a comparison chart of Sanger sequencing of SNP1, SNP2, and SNP3 sites.

[0125] 2.5 Population genetic parameter analysis of Hes5 gene in Zhangjiajie white-feathered black-bone chicken

[0126] The sequencing results of the three SNPs mutation sites of the Hes5B gene in 188 Zhangjiajie white-feathered black-bone chickens were statistically analyzed, and the genotypes, genotype frequencies and population genetic parameters were analyzed (Table 4-1). The chi-square fitness test showed that the genotype frequencies and allele frequencies of the Hes5B gene polymorphism sites in the rooster population were in Hardy-Weinberg equilibrium (P>0.05).

[0127] For the SNP1, SNP2 and SNP3 loci of the Hes5B gene, the dominant genotypes are AG, AA and AG, with occurrence frequencies of 51.20%, 92.9% and 58.30% (male); 46.20%, 74.00% and 53.80% (female), respectively. The polymorphic information contents of the SNP1 and SNP3 loci are 0.348 and 0.356 (male); 0.361 and 0.374 (female), respectively, both showing moderate polymorphism (0.25 < PIC < 0.5); the polymorphic information content of the SNP2 locus is only 0.087 (male); 0.211 (female), showing low polymorphism (PIC < 0.25).

[0128] Table 4-1 Analysis of population genetic parameters of Hes5 gene polymorphism in Zhangjiajie White - feather乌鸡

[0129]

[0130]

[0131] 2.6 Effects of SNP loci of Hes5 gene on some body size traits of Zhangjiajie White - feather乌鸡

[0132] The three body size traits of 188 Zhangjiajie White - feather乌鸡 were respectively analyzed for association with the genotypes of the SNP loci of the Hes5B gene. As Figure 3C shown, the SNP1 locus of the Hes5B gene showed significant correlations with the shank length and shank length index of cocks, and the keel length of hens (P < 0.05). Specifically, at the SNP1 locus, individuals with the AA genotype had significantly higher shank length and shank length index than those with the AG genotype (P < 0.05), while in terms of keel length, the average value of individuals with the AG genotype was significantly higher than that of the GG genotype (P < 0.05). On the contrary, no significant correlations were observed between the SNP2 locus and the body slant length, shank length, keel length and shank length index of cocks and hens (P > 0.05). For the SNP3 locus, this locus showed significant correlations with the shank length index of cocks and the body slant length and shank length of hens (P < 0.05). In hens, the AG genotype was significantly higher than the GG genotype in body slant length and shank length (P < 0.05), while in cocks, the shank length index of the AG genotype was significantly lower than that of the GG genotype.

[0133] Figure 3D Figure for the association analysis of SNP1, SNP2, SNP3 loci with the body size traits of Zhangjiajie White - feather乌鸡 ]>

[0134] 2.7 Linkage disequilibrium and haplotype association analysis of Hes5 gene

[0135] Linkage disequilibrium analysis and haplotype analysis were respectively carried out on the SNP1 and SNP3 loci of the Hes5B gene by using the SHEsis software. As Figure 3B As shown, there is a strong linkage disequilibrium between the two loci in the Hes5B gene (D′=0.80, r 2 ′<0.449), and a total of 4 haplotypes (AA, AG, GA, GG) were detected, named H1, H2, H3, and H4 respectively. The frequency of haplotype H4 in roosters was 0.255, and in hens it was 0.387 (P<0.05) (Table 5-1).

[0136] The results showed that the D' between SNP1 and SNP3 of Hes5B gene was close to 1, indicating that there was a strong complete linkage disequilibrium between the two sites, that is, they almost always appeared in a specific combination in the population. 2 The values ​​are relatively low, indicating that there is some degree of linkage disequilibrium between the two loci, but the association is limited in its effectiveness in predicting the status of the other locus.

[0137] Figure 3B Linkage disequilibrium analysis of SNP1 and SNP3 loci of Hes5B gene;

[0138] Table 5-1 Hes5B gene haplotype analysis

[0139]

[0140] Effects of 2.8Hes5 gene SNP haplotype combinations on some body size traits of Zhangjiajie white-feathered black-bone chicken

[0141] In order to evaluate the multiple interactions between SNP sites, the haplotype combinations generated by H1 to H4 of the Hes5B gene were analyzed, and a total of multiple haplotype combinations were screened out. Among them, the number of haplotype combination samples was less than 3, and no association analysis was performed, as shown in Table 6-1 and Table 6-2.

[0142] In the Hes5B gene, the H1H2 haplotype combination of roosters had a higher shank length and shank length index than the H1H4 and H3H3 combinations (P<0.05). The body oblique length of the H1H4 haplotype combination of hens was significantly higher than that of the H2H4 haplotype combination (P<0.01), while the shank length index of the H2H4 haplotype combination was significantly higher than that of the other three haplotype combinations (P<0.01).

[0143] In the Zhangjiajie white-feathered black-bone chicken population, the H1H2 haplotype of the Hes5B gene (P<0.05) was extremely significantly or significantly correlated with the tibia length trait.

[0144] Table 6-1 Association analysis between Hes5B gene haplotype combinations and some body size traits of roosters

[0145]

[0146] Table 6-2 Association analysis between Hes5B gene haplotype combinations and some body size traits of hens

[0147]

[0148]

[0149] In summary, through the above experimental analysis we can see that:

[0150] 1. SNP1 is associated with shin length and shin length index in males, and SNP1 is associated with keel length in females;

[0151] The SNP3 locus is associated with the shank length index of roosters, and the SNP3 locus is associated with the body length and shank length of hens.

[0152] 2. The AA genotype at SNP1 is associated with tibia length and tibia length index; the AG genotype at SNP1 is associated with keel length;

[0153] The AG genotype of SNP3 was associated with the shank length index of hens; the GG genotype of SNP3 was associated with the shank length index of roosters.

[0154] 3. The haplotype combination H1H2 of roosters is correlated with shank length and shank length index of roosters; the haplotype combination H1H4 of hens is correlated with body slant length of hens, and the haplotype combination H2H4 of hens is correlated with shank length index of hens.

[0155] The above results determined the relationship between SNP1 and SNP3 loci and the body size traits of Zhangjiajie White-feathered Black-bone Chicken, as well as the relationship between different loci, genotypes and haplotype combinations at different loci and the size and shape of roosters and hens, providing guidance for the genetic breeding related to the body size traits of Zhangjiajie White-feathered Black-bone Chicken.

Claims

1. Application of a genotyping reagent for molecular markers associated with the body size trait of Zhangjiajie white-feathered black-bone chicken in genetic breeding for body size traits, characterized in that: The molecular markers are SNP1 and SNP3 of the Hes5B gene; the reference genome is GCF_016699485.2; the SNP1 site is g.1408791 T>C, and the SNP3 site is g.1409422T>C. The SNP1 site is associated with the shank length and shank length index of roosters. Individuals with the AA genotype have higher shank length and shank length index than those with the AG genotype. The SNP1 locus is associated with the keel length of hens, and the keel length of individuals with the AG genotype is longer than that of the GG genotype; The SNP3 site is associated with the shank length index of roosters, and the shank length index of the AG genotype is lower than that of the GG genotype; the SNP3 site is associated with the body oblique length and shank length of hens, and the AG genotype is higher than the GG genotype in body oblique length and shank length.

2. Application of a genotyping reagent for molecular markers associated with the body size trait of Zhangjiajie white-feathered black-bone chicken in genetic breeding for body size traits, characterized in that: The molecular markers are the SNP1 site and the SNP3 site of the Hes5B gene; the SNP1 site is the g.1408791 T>C site, the SNP3 site is the g.1409422 T>C site, and the reference genome is GCF_016699485.2; the haplotype combination H1H2 of the rooster has a higher shin length and shin length index; the haplotype combination H1H4 of the hen has a higher body oblique length, and the haplotype combination H2H4 of the hen has a higher shin length index; The haplotype combination H1H2 is a combination of haplotype H1 and haplotype H2; the haplotype combination H1H4 is a combination of haplotype H1 and haplotype H4; the haplotype combination H2H4 is a combination of haplotype H2 and haplotype H4; The nucleotide combination of SNP1 and SNP3 of haplotype H1 is AA; the nucleotide combination of SNP1 and SNP3 of haplotype H2 is AG; the nucleotide combination of SNP1 and SNP3 of haplotype H4 is GG.

Images