Primer probe composition, kit and application of primer probe composition and kit in identification of rhinogobio ventralis species or detection of rhinogobio ventralis population abundance

Abstract

The invention provides a primer probe composition, a kit and application of the primer probe composition to identification of rhinogobio ventralis species or detection of rhinogobio ventralis population abundance. The primer probe composition disclosed by the invention is simple to use, accurate in result and high in repeatability; the method has high accuracy and can avoid errors caused by gene diversity in a population; the kit has high sensitivity, and the detected minimum DNA concentration can reach 1 * 10 < 3 > copies / mu L; the method also has good interspecific specificity, can effectively distinguish rhinogobio ventralis and other fishes, and even can distinguish rhinogobio ventralis and related species, such as rhinogobio ventralis and rhinogobio cylindrica. Under the background of continuous decline of rhinogobio ventralis population resources, accurate monitoring of rare species can be realized, and data support is provided for resource management protection of rhinogobio ventralis.

Description

Technical Field

[0001] The invention relates to biotechnology, in particular to a primer-probe composition, a kit and applications thereof in identifying long-finned goby species or detecting the abundance of long-finned goby populations. Background Art

[0002] Rhinogobio ventralis belongs to the genus Rhinogobio, subfamily Gobioninea, family Cyprinidae, order Cypriniformes. It is a small, benthic economic fish and a drifting egg-laying fish unique to the upper reaches of the Yangtze River. Due to the impact of human activities such as overfishing, environmental pollution, and water-related projects, Rhinogobio ventralis is facing difficulties such as a sharp decline in resources, difficulty in completing its life history, and habitat fragmentation. Therefore, it is necessary to conduct resource detection on the population of Rhinogobio ventralis. Traditional resource monitoring of Rhinogobio ventralis populations mainly uses the catch survey method, that is, fishing and collecting with various nets. This is not only time-consuming and labor-intensive, costly, and has a low capture rate, but may also harm the target species and destroy the ecosystem of the survey point. At the same time, resource monitoring results in recent years show that the proportion of early resources and catches of long-finned goby in the Jinsha River and Yangtze River basins has dropped significantly, further reducing the efficiency of resource monitoring using traditional fishing methods. In addition, the implementation of the "ten-year fishing ban" policy in the Yangtze River has made direct monitoring and assessment of long-finned goby populations increasingly difficult. Therefore, it is imperative to develop new harmless monitoring technologies.

[0003] Environmental DNA (eDNA) technology refers to a research method that directly extracts DNA fragments from environmental samples such as water, soil, and sediment, and then uses fluorescent quantitative PCR (quantitative PCR, qPCR) and sequencing to qualitatively or quantitatively identify the target product, thereby determining the distribution and functional characteristics of the target organism in the environment. Compared with traditional methods, it does not require a large amount of fishing operations, is non-invasive to fish bodies, and is more sensitive. In field surveys, it can reduce the impact of surveys and research on individuals and their habitats. At present, the establishment of an environmental DNA detection and analysis system for long-fin goby and the realization of simple, rapid, accurate, and objective abundance detection of long-fin goby populations in target water bodies are issues that need to be urgently addressed in the current monitoring of long-fin goby resources. Summary of the invention

[0004] The present invention provides a primer-probe combination and a kit, which have the beneficial effects of high accuracy, high sensitivity and good specificity.

[0005] The present invention provides an application of the primer-probe combination or the kit in identifying the species of Rhinophora longitans or detecting the abundance of the Rhinophora longitans population.

[0006] The present invention also provides a method for detecting the abundance of the long-finned goby population, which can quickly and accurately detect the abundance of the long-finned goby population, is easy to operate, and will not harm the fish in the water or destroy the habitat of the monitoring point.

[0007] The present invention provides a primer-probe composition, which comprises a primer pair and a probe; the primer pair comprises a first primer and a second primer, the nucleotide sequence of the first primer is shown in SEQ ID NO:1, and the nucleotide sequence of the second primer is shown in SEQ ID NO:2; the nucleotide sequence of the probe is shown in SEQ ID NO:3.

[0008] The primer-probe composition as described above, wherein the 5' end of the nucleotide sequence of the probe is labeled with a fluorescent group, and the 3' end of the nucleotide sequence of the probe is labeled with a quenching group;

[0009] Preferably, the fluorescent group is VIC, and the quenching group is MGB.

[0010] The present invention provides a kit, which comprises the above-mentioned primer-probe combination.

[0011] The present invention provides an application of the primer-probe combination or the kit in identifying species of Rhinophora longitans.

[0012] The present invention provides an application of the primer-probe combination or the kit in detecting the abundance of the long-finned goby population.

[0013] The present invention provides a method for detecting the abundance of a population of long-finned goby, which comprises the following steps:

[0014] Collect water samples from monitoring points, extract DNA from the water samples, and obtain water sample DNA;

[0015] Using the water sample DNA as a template, using the above primer-probe combination or the above kit to perform qPCR amplification to obtain a Ct value;

[0016] According to the Ct value, the water sample is determined to be a positive sample or a negative sample;

[0017] According to the Ct value and the standard curve equation, the target DNA copy number was calculated to determine the population abundance of Rhinoceros longifinus in the positive samples.

[0018] The method as described above, wherein the standard curve equation is as shown in Formula 1:

[0019] Formula 1

[0020] Among them, Q is the number of target DNA copies in the water sample DNA, the unit is copies / μL

[0021] In the above method, determining whether the water sample is a positive sample or a negative sample according to the Ct value further includes:

[0022] When the Ct value is ≤30, the water sample is determined to be a positive sample;

[0023] When the Ct value is greater than 30 or not detected, the water sample is determined to be a negative sample.

[0024] The method as described above, wherein the minimum number of target DNA copies is 1×10 3 copies / μL.

[0025] The method as described above, wherein, in qPCR amplification, the qPCR reaction system includes 2 μL of DNA template, 0.2 μL of a first primer with a concentration of 10 pmol / μL, 0.2 μL of a second primer with a concentration of 10 pmol / μL, 0.1 μL of a probe with a concentration of 10 μM, 5 μL of 2X AceQ qPCR Probe Master Mix, 0.2 μL of ROX and 2.3 μL of ddH2O; and / or,

[0026] In qPCR amplification, the qPCR reaction program included pre-denaturation at 95°C for 5 min; denaturation at 95°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 45 cycles; and finally extension at 72°C for 3 min.

[0027] The present invention provides a primer-probe combination, which has the following beneficial effects:

[0028] (1) It can be used to identify species of long-finned goby;

[0029] (2) It can be used to detect the abundance of long-finned goby populations;

[0030] (3) Simple operation, accurate results and high repeatability;

[0031] (4) It has high accuracy and can avoid errors caused by genetic diversity within the population;

[0032] (5) It has high sensitivity, and the minimum DNA concentration it can detect can reach 1×10 3 copies / μL;

[0033] (6) It has good interspecies specificity and can effectively distinguish the long-fin goby from other fish, and can even distinguish the long-fin goby from closely related species, such as the goby and the cylindrical goby;

[0034] (7) Against the background of the continuous decline of the population resources of the long-finned goby, accurate monitoring of rare species can be achieved, providing data support for the resource management and protection of the long-finned goby. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the qPCR amplification curve in Example 3;

[0036] Figure 2 It is the standard curve diagram in Example 4;

[0037] Figure 3 This is the qPCR amplification curve in Example 5. DETAILED DESCRIPTION

[0038] In order to enable those skilled in the art to better understand the scheme of the present invention, the present invention is further described in detail below. The specific implementation methods listed below are only for describing the principles and features of the present invention. The examples are only used to explain the present invention and are not intended to limit the scope of the present invention. Based on the embodiments of the present invention, all other implementation methods obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention.

[0039] The first aspect of the present invention provides a primer-probe composition, comprising a primer pair and a probe; the primer pair comprises a first primer and a second primer, the nucleotide sequence of the first primer is shown in SEQ ID NO:1, and the nucleotide sequence of the second primer is shown in SEQ ID NO:2; the nucleotide sequence of the probe is shown in SEQ ID NO:3.

[0040] In the present invention, the first primer is an upstream primer, and the second primer is a downstream primer.

[0041] The primer-probe combination of the present invention is designed based on the COI sequence of the long-finned goby and the qPCR principle. Among them, the COI sequence is a protein-coding gene of the mitochondrial genome, and its full name is cytochrome coxidase subunit I. The COI sequence is an important marker for biological molecular systematics research and population genetic differentiation. Its evolutionary speed is suitable and has great conservation, and it is suitable as a DNA barcode for animal taxonomy and ecology. DNA barcode refers to a recognized, relatively short DNA sequence in the genome, which can be used for species identification and is an effective supplement to traditional morphological identification methods. Since the DNA sequences of different species are composed of four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), arranged in different orders, different species can be distinguished by analyzing the DNA barcode.

[0042] qPCR technology is a technology developed from PCR technology. By labeling fluorescent dyes or fluorescent probes on PCR products, the intensity of the fluorescent signal is monitored throughout the PCR process, thereby calculating the initial concentration of the template nucleic acid. During the qPCR process, the first primer and the second primer in the primer-probe combination of the present invention are used to amplify the target DNA fragment, and the probe is used to monitor the DNA synthesis in the qPCR reaction in real time and quantitatively detect the target DNA fragment in the sample.

[0043] The primer-probe combination provided by the present invention is easy to use, has accurate results and high repeatability; it has high accuracy and can avoid errors caused by genetic diversity within the population; it has high sensitivity and the minimum DNA concentration it can detect can reach 1×10 3 copies / μL; it also has good interspecies specificity, and can effectively distinguish the long-fin goby from other fish, and can even distinguish the long-fin goby from closely related species, such as goby and cylinder goby. In the context of the continuous decline of the long-fin goby population resources, the primer-probe combination provided by the present invention can achieve accurate monitoring of rare species and provide data support for the resource management and protection of the long-fin goby.

[0044] In the above technical solution, the 5' end of the nucleotide sequence of the probe is labeled with a fluorescent group, and the 3' end of the nucleotide sequence of the probe is labeled with a quenching group; preferably, the fluorescent group is VIC and the quenching group is MGB. That is, the structure of the probe is as follows: 5'-[VIC]TCTCCTACTATTAGCCTCTTC[MGB]-3'.

[0045] Among them, VIC is phosphoramidite, a fluorescent dye that emits in the green-yellow part of the visible spectrum; MGB is a minor groove binder, a dihydrocyclopyrrole tripeptide that can selectively bind to the minor groove of DNA molecules, increase the melting temperature of the probe, provide better sequence identification ability and flexibility, reduce the fluorescence background, improve the signal-to-noise ratio, and have higher hydrolysis performance. Hydrolysis fully promotes the release of fluorescence signals. Therefore, when the probe is in an intact state, the fluorescence signal emitted by the fluorescent group is absorbed and quenched by the quenching group, and the fluorescence signal cannot be detected; only when the probe is hydrolyzed and the fluorescent group is far away from the quenching group, can the fluorescence signal be detected.

[0046] In the qPCR reaction, during the high-temperature denaturation stage, the template chain melts to form a single strand; during the low-temperature renaturation stage, the probe preferentially binds to the single strand, and then the first primer and the second primer bind to the single strand; during the temperature extension stage, starting from the first primer or the second primer, the Taq enzyme synthesizes a new complementary strand along the 5'-3' direction, that is, synthesizes a complete double-stranded DNA again. At this time, the Taq enzyme exerts 5'-3' exonuclease activity after encountering the probe in the extension stage, cleaves the probe, separates the fluorescent group and the quenching group, and thus prompts the fluorescence monitoring system to receive the fluorescent signal, that is, for each DNA chain amplified, a fluorescent molecule is formed, achieving complete synchronization between the accumulation of the fluorescent signal and the formation of the PCR product.

[0047] The second aspect of the present invention provides a kit, comprising the primer-probe combination described above. Since the kit comprises the primer-probe combination provided by the first aspect of the present invention, the kit also has the advantages of high accuracy, high sensitivity and good specificity.

[0048] In the above technical solution, the kit also includes at least one of a DNA extraction reagent and a qPCR amplification reagent, wherein the DNA extraction reagent can be a universal water body DNA extraction reagent.

[0049] The third aspect of the present invention provides a use of the primer-probe combination or the kit in identifying species of Rhinophora longitans.

[0050] In one embodiment of the present invention, genomic DNA is extracted from the fin rays of Rhinophora longifinensis and 20 other closely related fishes of Rhinophora longifinensis or fishes endemic to the middle and upper reaches of the Yangtze River to obtain a DNA sample; the DNA sample is amplified by qPCR using the above-mentioned primer-probe combination to obtain a Ct value; when the Ct value is ≤30, the result is determined to be positive, that is, the DNA sample is a positive sample and is derived from Rhinophora longifinensis; when the Ct value is >30, the result is determined to be negative, that is, the DNA sample is a negative sample and is not derived from Rhinophora longifinensis.

[0051] Therefore, using the primer-probe combination or kit provided by the present invention, qPCR amplification is performed on the DNA sample derived from the tissue sample of the fish to be detected to obtain the Ct value. When the Ct value is ≤30, the DNA sample is derived from the long-fin goby, and the fish to be detected is identified as the long-fin goby; when the Ct value is greater than 30, the DNA sample is not derived from the long-fin goby, and the fish to be detected is identified as not the long-fin goby.

[0052] A fourth aspect of the present invention provides a use of the primer-probe combination or the kit in detecting the abundance of the long-finned goby population.

[0053] The primer-probe combination or kit of the present invention can be used to detect the population abundance of long-finned goby. By extracting DNA from water samples at the monitoring point and performing qPCR on the water sample DNA, the Ct value can be obtained, and then the presence of long-finned goby in the water sample at the monitoring point can be determined based on whether the Ct value is ≤30, and then the target DNA copy number is calculated based on the standard curve equation, and the abundance of the long-finned goby population at the monitoring point can be judged by the target DNA copy number. Among them, the abundance of the long-finned goby population refers to the biomass of long-finned goby within a certain area or volume.

[0054] A fifth aspect of the present invention provides a method for detecting the abundance of a long-finned goby population, comprising the following steps:

[0055] Collect water samples from monitoring points, extract DNA from the water samples, and obtain water sample DNA;

[0056] Using the water sample DNA as a template, using the above primer-probe combination or the above kit to perform qPCR amplification to obtain a Ct value;

[0057] According to the Ct value, the water sample is determined to be a positive sample or a negative sample;

[0058] According to the Ct value and the standard curve equation, the target DNA copy number was calculated to determine the population abundance of Rhinoceros longifinus in the positive samples.

[0059] The present invention determines the population abundance of the long-finned goby at the monitoring point by collecting water samples at the monitoring point, which will not harm the fish in the water body or destroy the habitat of the monitoring point, and has little impact on the ecosystem of the monitoring point. Compared with the catch survey method, the present invention does not require the use of ships and nets for large-scale fishing operations, which saves time and labor, is economical and efficient, and is easy to operate.

[0060] In detail, the present invention first collects water samples from monitoring points, extracts DNA from the water samples, and obtains water sample DNA. The present invention does not limit how to extract DNA from water samples, and it can be achieved by conventional technical means in the field, such as using a universal water DNA extraction reagent.

[0061] Subsequently, the present invention uses the water sample DNA as a template and the above-mentioned primer-probe combination or the above-mentioned kit to perform qPCR amplification to obtain a Ct value.

[0062] Specifically, in qPCR amplification, the qPCR reaction system included 2 μL of DNA template, 0.2 μL of the first primer with a concentration of 10 pmol / μL, 0.2 μL of the second primer with a concentration of 10 pmol / μL, 0.1 μL of the probe with a concentration of 10 μM, 5 μL of 2X AceQ qPCR Probe Master Mix, 0.2 μL of ROX and 2.3 μL of ddH2O; in qPCR amplification, the qPCR reaction procedure included pre-denaturation at 95°C for 5 min; denaturation at 95°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for a total of 45 cycles; and finally extension at 72°C for 3 min.

[0063] Among them, the Ct value refers to the threshold cycle number, that is, the number of cycles experienced when the fluorescent signal in each reaction tube reaches the set threshold. There is a linear relationship between the Ct value and the logarithm of the starting copy number of the template. The higher the starting copy number of the template, the smaller the Ct value; the lower the starting copy number of the template, the larger the Ct value.

[0064] Then, according to the Ct value, it can be determined whether the water sample is a positive sample or a negative sample.

[0065] Specifically, when the Ct value is ≤30, the water sample is determined to be a positive sample;

[0066] When the Ct value is greater than 30 or not detected, the water sample is determined to be a negative sample.

[0067] Among them, a positive sample refers to the presence of long-finned goby in the water sample; a negative sample refers to the absence of long-finned goby in the water sample.

[0068] Finally, according to the Ct value and the standard curve equation, the target DNA copy number was calculated to determine the population abundance of R. longifensis in the positive samples.

[0069] In one embodiment of the present invention, the standard plasmid containing the target DNA is diluted to 1×10 9 Then, 10 μL was taken and added to 90 μL of sterile water, and then diluted 10 times in sequence to obtain 1×10 8 copies / μL (No. 1), 1×10 7 copies / μL (No. 2), 1×10 6 copies / μL (No. 3), 1×10 5 copies / μL (No. 4), 1×10 4 copies / μL (No. 5), 1×10 3 copies / μL (No. 6), 1×10 2copies / μL (No. 7), a total of 7 concentration gradients. The above plasmids were amplified by qPCR using the primer-probe combination, and the corresponding Ct values ​​were 14.04, 16.25, 19.76, 23.03, 25.83, 29.92, and 33.09. A standard curve can be fitted based on the target DNA copy number and corresponding Ct value of the 7 standard plasmids.

[0070] Specifically, the standard curve equation is shown in Formula 1:

[0071] Formula 1

[0072] Among them, Q is the number of target DNA copies in the water sample DNA, and the unit is copies / μL.

[0073] It can be understood that the higher the target DNA copy number corresponding to the water sample at the monitoring point, the higher the population abundance; the lower the target DNA copy number corresponding to the water sample at the monitoring point, the lower the population abundance.

[0074] In addition, the minimum target DNA copy number was verified to be 1×10 3 copies / μL, that is, the detection limit of the present invention is 1×10 3 copies / μL. The detection limit refers to the minimum amount of the analyte that can be detected in the sample, which can be used as a basis for qualitative identification and can reflect sensitivity. The results show that the primer-probe combination or kit of the present invention has high sensitivity, and the method for detecting the abundance of the long-finned goby population provided by the present invention has high sensitivity.

[0075] The technical solution of the present application will be further explained below in conjunction with specific examples. The experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer. The reagents used are commercially available or available from public channels unless otherwise specified.

[0076] Example 1: Design of primer-probe composition

[0077] According to the cytochrome oxidase I (COI) sequence of the long-finned goby, a primer-probe composition including a primer pair and a probe was designed, as shown in Table 1. The primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2. The nucleotide sequence of the probe is shown in SEQ ID NO: 3, the 5' end of the nucleotide sequence of the probe is labeled with a phosphoramidite (VIC) fluorescent group, and the 3' end of the nucleotide sequence of the probe is labeled with a minor groove binder (Minor Groove Binder, MGB) as a quenching group, that is, the structure of the probe is as follows: 5'-[VIC]TCTCCTACTATTAGCCTCTTC[MGB]-3'.

[0078] Table 1

[0079]

[0080] Example 2: Verifying the accuracy of primer pairs

[0081] Eight long-finned goby were obtained from the Wudongde Experimental Station of the Chinese Acipenser Research Institute of China Three Gorges Corporation and their fin rays were taken. The genomic DNA of the long-finned goby was extracted from the fin rays using a DNA extraction kit to obtain a DNA sample. The DNA sample was PCR amplified using the upstream primer and downstream primer in Example 1 to obtain a PCR amplification product. Among them, the PCR reaction system was 30 μL in total, including 1 μL of DNA sample, 1 μL of upstream primer with a concentration of 10 pmol / μL, 1 μL of downstream primer with a concentration of 10 pmol / μL, 15 μL of 2×Taq Mix and 12 μL of ddH2O. The PCR amplification program included 95°C pre-denaturation for 30 s; 95°C denaturation for 10 s, 60°C annealing for 30 s, 72°C extension for 30 s, for a total of 35 cycles; finally 72°C extension for 5 min, and stored at 4°C. Take 2 μL of the PCR amplification product, add 2 μL of 6× Loading Buffer, mix and perform agarose gel electrophoresis, set the voltage to 120 V, the time to 20 minutes, and the agarose gel concentration to 1%. Place the agarose gel after electrophoresis in a gel imaging analyzer for photographing and analysis, and it can be found that the upstream primer and the downstream primer in Example 1 can accurately amplify the 8-tailed longfin goby.

[0082] Example 3: Verification of the sensitivity of the primer-probe combination

[0083] The target DNA band was cut from the agarose gel after the photo analysis in Example 2 and recovered and purified to obtain the purified DNA fragment. The purified DNA fragment was connected to the pMD18-T vector plasmid vector, transformed into competent cells, and then cultured on an ampicillin plate overnight. After a monoclonal colony was formed on the plate, the positive monoclonal colony was identified and sequenced, and then the plasmid was extracted from the colony with the correct sequence, and the purity and concentration of the plasmid were determined. The standard plasmid was diluted to 1×10 9 Then, 10 μL was taken and added to 90 μL of sterile water, and then diluted 10 times in sequence to obtain 1×10 8 copies / μL (No. 1), 1×10 7 copies / μL (No. 2), 1×10 6 copies / μL (No. 3), 1×10 5 copies / μL (No. 4), 1×10 4 copies / μL (No. 5), 1×10 3 copies / μL (No. 6), 1×10 2 copies / μL (No. 7), a total of 7 concentration gradients.

[0084] Each plasmid sample of the above concentration gradient is guaranteed to be repeated 3 times, and the primer probe combination in Example 1 is used to perform qPCR detection limit test on the plasmid sample to obtain the qPCR amplification curve. Among them, the qPCR reaction system is 10 μL, including 2 μL of plasmid sample, 0.2 μL of upstream primer with a concentration of 10 pmol / μL, 0.2 μL of downstream primer with a concentration of 10 pmol / μL, 0.1 μL of probe with a concentration of 10 μM, 5 μL of 2X AceQ qPCR Probe Master Mix, 0.2 μL of ROX and 2.3 μL of ddH2O. The qPCR reaction program includes 95°C pre-denaturation for 5 min; 95°C denaturation for 10 s, 60°C renaturation for 30 s, 72°C extension for 30 s, a total of 45 cycles; finally 72°C extension for 3 min, and storage at 4°C.

[0085] qPCR amplification curve Figure 1 As shown in the figure, from right to left are plasmid samples No. 1-7, and the corresponding Ct values ​​are: 14.04, 16.25, 19.76, 23.03, 25.83, 29.92, 33.09. When the concentration of the plasmid sample is 1×10 2When the Ct value was 33.09, that is, the Ct value was greater than 30, it was impossible to determine whether the plasmid sample was a positive sample. Therefore, the detection limit DNA concentration of the primer-probe combination of Example 1 was 1×10 3 copies / μL, with high sensitivity.

[0086] Example 4: Verification of the repeatability of the primer-probe combination

[0087] A standard curve was fitted based on the concentrations of the seven gradient dilutions in Example 3 and the corresponding Ct values. Figure 2 , the equation of the standard curve is shown in Equation 1:

[0088] Formula 1

[0089] Where Q is the DNA copy number of the long-finned goby in the DNA sample, in copies / μL. The goodness of fit of the standard equation (R 2 ) was 0.997, showing a good linear regression; the slope k of the curve was -3.249, and the efficiency of qPCR was 103.14%, indicating that the repeatability of qPCR amplification was good.

[0090] Example 5: Verification of the specificity of the primer-probe combination

[0091] The long-finned goby is mainly distributed in the Jinsha River, the main stream and main tributaries of the middle and upper reaches of the Yangtze River. In the above-mentioned areas, there are also closely related species of the genus Goby, mainly Goby and Goby cylindrical. In addition, other fish species unique to the upper reaches of the Yangtze River and economic fish are also distributed in the above-mentioned areas. Based on the distribution characteristics of the long-finned goby, the fin rays of the long-finned goby and 20 other species of fish species unique to the middle and upper reaches of the Yangtze River and economic fish were obtained from the catch in the Yibin River section of the upper reaches of the Yangtze River in August 2023, and genomic DNA was extracted from the fin rays using a DNA extraction kit to obtain a DNA sample. The primer-probe combination in Example 1 was used to perform qPCR amplification on the DNA sample and the blank control (sterile water). The qPCR reaction system and qPCR reaction procedure were the same as in Example 3. The Ct value obtained was removed by removing invalid values ​​and the average value was taken for judgment to obtain the processed Ct value. When the Ct value after treatment does not exceed 30, the result is judged to be positive, that is, the DNA sample is a positive sample and is derived from the long-finned goby; when the Ct value after treatment is greater than 30, the result is judged to be negative, that is, the DNA sample is a negative sample and is not derived from the long-finned goby; the above standard curve equation is used to calculate the DNA concentration of the long-finned goby in the positive sample.

[0092] qPCR amplification curve Figure 3The test results are shown in Table 2. The Ct value of the long-finned goby sample is 22.63, which is less than 30, and the result is positive. The concentration of the DNA sample is 1.43×10 5 copies / μL. The Ct values ​​of the samples of Chinese sand loach, white-shelled fish, Yangtze sturgeon, red bream, and cylindrical goby were 35.746, 38.277, 39.641, 31.11, and 35.831, respectively, all greater than 30, and the judgment results were negative. No amplified fluorescence signals were detected in the samples of Pelteobagrus vachelli, Heterocarpus sutsuga, Rock carp, Copper fish, Chinese spiny barb, Lip bream, Silver carp, Carp, Round-mouthed copper fish, Murray fish, Goby, Catfish, Carp, Snake goby, Ziling goby, and blank control samples, showing negative results. The experimental results show that the primer-probe combination in Example 1 has good interspecies specificity, which can not only distinguish the long-fin goby and other endemic fish and economic fish in the middle and upper reaches of the Yangtze River, but also distinguish the long-fin goby and its closely related species, such as goby and cylindrical goby.

[0093] Table 2

[0094]

[0095] In summary, the present invention provides a primer-probe combination that is easy to use, has accurate results, and is highly repeatable; it has high accuracy and can avoid errors caused by genetic diversity within a population; it has high sensitivity, and the minimum DNA concentration it can detect can reach 1×10 3 copies / μL; it also has good interspecies specificity, can effectively distinguish the long-fin goby and other fish, and can even distinguish the long-fin goby and closely related species, such as goby and cylindrical goby. The primer-probe combination of the present invention can not only identify the long-fin goby, but also be used to detect the population abundance of the long-fin goby. By extracting DNA from the water sample at the monitoring point and performing qPCR on the water sample DNA, the Ct value can be obtained, and then the presence of the long-fin goby in the water sample at the monitoring point is determined according to whether the Ct value is ≤30, and then the target DNA copy number is calculated according to the standard curve equation, and the abundance of the long-fin goby population at the monitoring point is judged by the target DNA copy number. The above method will not harm the fish in the water body or destroy the habitat of the monitoring point, and has little impact on the ecosystem of the monitoring point. Compared with the catch survey method, the present invention does not require the use of ships and nets for large-scale fishing operations, which saves time and labor, is economical and efficient, and is simple to operate. Under the background of the continuous decline of the population resources of the long-finned goby, the present invention can realize the accurate monitoring of rare species and provide data support for the resource management and protection of the long-finned goby.

[0096] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that the technical solutions described in the above embodiments can still be modified, or some or all of the technical features can be replaced by equivalents. However, these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer-probe composition, characterized in that: It comprises a primer pair and a probe; the primer pair comprises a first primer and a second primer, the nucleotide sequence of the first primer is shown as SEQ ID NO:1, and the nucleotide sequence of the second primer is shown as SEQ ID NO:2; the nucleotide sequence of the probe is shown as SEQ ID NO:

3.

2. The primer-probe combination according to claim 1, characterized in that The 5' end of the nucleotide sequence of the probe is labeled with a fluorescent group, and the 3' end of the nucleotide sequence of the probe is labeled with a quenching group; Preferably, the fluorescent group is VIC, and the quenching group is MGB.

3. A kit, characterized in that The invention comprises the primer-probe combination as claimed in claim 1.

4. Use of the primer-probe combination according to claim 1 or 2 or the kit according to claim 3 in identifying species of Rhinophora longitans.

5. Use of the primer-probe combination according to claim 1 or 2 or the kit according to claim 3 in detecting the abundance of the long-finned goby population.

6. A method for detecting the abundance of a population of long-finned goby, characterized in that: The steps include: Collecting water samples from monitoring points, extracting DNA from the water samples, and obtaining water sample DNA; Using the water sample DNA as a template, performing qPCR amplification using the primer-probe combination of claim 1 or 2 or the kit of claim 3 to obtain a Ct value; According to the Ct value, determining whether the water sample is a positive sample or a negative sample; According to the Ct value and the standard curve equation, the target DNA copy number is calculated to determine the population abundance of the long-finned goby in the positive sample.

7. The method according to claim 6, characterized in that The standard curve equation is shown in Formula 1: Formula 1 Among them, Q is the number of target DNA copies in the water sample DNA, and the unit is copies / μL.

8. The method according to claim 6 or 7, characterized in that: According to the Ct value, determining whether the water sample is a positive sample or a negative sample further includes: When the Ct value is ≤30, the water sample is determined to be a positive sample; When the Ct value is greater than 30 or is not detected, the water sample is determined to be a negative sample.

9. The method according to any one of claims 6 to 8, characterized in that: The minimum target DNA copy number is 1×10 3 copies / μL.

10. The method according to any one of claims 6 to 9, characterized in that: In the qPCR amplification, the qPCR reaction system includes 2 μL of DNA template, 0.2 μL of a first primer with a concentration of 10 pmol / μL, 0.2 μL of a second primer with a concentration of 10 pmol / μL, 0.1 μL of a probe with a concentration of 10 μM, 5 μL of 2X AceQ qPCR Probe Master Mix, 0.2 μL of ROX and 2.3 μL of ddH2O; and / or, In the qPCR amplification, the qPCR reaction procedure includes 95°C pre-denaturation for 5 min; 95°C denaturation for 10 s, 60°C annealing for 30 s, 72°C extension for 30 s, for a total of 45 cycles; and finally 72°C extension for 3 min.

Images