Haploid molecular marker related to meat quality of Songhai black pigs, detection method and application of haplotype molecular marker

Abstract

The invention provides a haplotype molecular marker related to the meat quality of Songhai black pigs, a detection method and application of the haplotype molecular marker, and belongs to the technical field of molecular markers. The molecular marker is located at the 54th basic group and the 369th basic group of a second exon of the Songhua black pig FSD2 gene and has G / A and T / C polymorphism (G54A and T369C), the two sites are completely linked, and the molecular marker has three haplotypes of GGTT, GATC and AACC. Individuals of the GGTT haplotype have excellent meat color and high intramuscular fat content. The molecular marker developed by the invention provides a corresponding theoretical basis for improving the meat quality of local pigs, protecting the germplasm resources of the Songhua black pigs and developing and utilizing the Songhua black pigs, and has important significance for improving the meat quality of the Songhua black pigs.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a haplotype molecular marker associated with the quality of Songlei black pork meat, a detection method and an application thereof. Background Art

[0002] Songlei Black Pig is a new northern lean meat black maternal breed with independent intellectual property rights bred by Jilin Academy of Agricultural Sciences through a three-way hybrid breeding method using the Northeast Min Pig, Landrace Pig (Landrace Pig) native to Northeast my country, Denmark and the Duroc Pig of the United States as breeding materials. It has the characteristics of high fertility, good meat quality, strong adaptability and obvious hybrid advantages. It is an excellent maternal pig in my country.

[0003] However, due to the slow growth rate, low market rate, low slaughter rate, low lean meat rate, and low feed conversion rate, local pig breeds in my country cannot adapt to the industrial development of the pig industry, nor can they meet the growing market demand for lean pork, resulting in a continuous shrinking of the population size. Pig breeding practices in the 20th century showed that excessive growth rate and excessive lean meat rate led to a decline in pork quality and a decrease in individual vitality. Therefore, the direction of modern pig breeding has shifted to focus on the cultivation of high-quality pigs, and tends to use local black pig breeds. In order to meet the market demand for high-quality and diversified pork quality, and to better protect and develop and utilize the famous and excellent local pig breed Songlei Black Pig in Jilin Province, it is necessary to carry out the breeding of high-quality black pig matching systems. The development of molecular markers related to the quality of Songlei Black Pig meat can provide a reference for the continuous selection and breeding of Songlei Black Pig and early selection in production.

[0004] Fibronectin type III and SPRY domaincontaining 2 (FSD2) is a member of the fibronectin type III / SPRY family, located on chromosome 7 of pigs. This family member mediates the interaction between cells and cell matrix and participates in various biological processes such as cell adhesion, growth, migration and differentiation. However, there is no report on the association between the polymorphic sites of this gene and the quality traits of Songlei black pork. Summary of the invention

[0005] In view of this, the present invention provides a haplotype molecular marker related to the meat quality of Songlei black pig, a detection method and application thereof, to provide a basis for the breeding of Songlei black pig.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides a haplotype molecular marker associated with the quality of Songlei black pig meat. The molecular marker comprises two SNP sites, which are respectively located at the 54th base and the 369th base of the second exon of the black pig FSD2 gene; there is a G / A polymorphism at the 54th base, and there is a T / C polymorphism at the 369th base, and the two sites are completely linked, with three haplotypes of GGTT, GATC and AACC.

[0008] The present invention also provides application of the haplotype molecular marker in Songlei black pig breeding.

[0009] The present invention also provides primers for detecting the haplotype molecular markers, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.2.

[0010] The present invention also provides a reagent or a kit containing the primer.

[0011] The present invention also provides a method for identifying the quality of Songlei black pork, comprising the following steps:

[0012] S1. Using the genomic DNA of the Songlei black pig to be tested as a template, PCR amplification was performed using the primers described in claim 3;

[0013] S2. Sequence the amplified product, detect the haplotype of the SNP site, and identify the meat quality of Songlei black pig.

[0014] Preferably, the reaction system for PCR amplification is: 0.5 μL of upstream and downstream primers, 0.5 μL of DNA template, 10 μL of 2×Premix buffer, and water is added to make up to 20 μL.

[0015] Preferably, the reaction procedure of the PCR amplification is: denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 40 s, and extension at 72°C for 5 min.

[0016] Preferably, the identification criteria for the quality of Songlei Black Pork meat are: the meat color of GGTT haplotype individuals is significantly better than that of AACC haplotype individuals 24 hours after slaughter, and the intramuscular fat content is extremely significantly higher than that of GATC and AACC haplotype individuals.

[0017] By adopting the above technical scheme, the present invention has the following beneficial effects: the molecular marker of the present invention is located at the 54th and 369th bases of the second exon of the Songlei black pig FSD2 gene, respectively having G / A and T / C polymorphisms (G54A and T369C), the two sites are completely linked, and have three haplotypes of GGTT, GATC and AACC. Individuals with the GGTT haplotype have excellent meat color and high intramuscular fat content. The molecular marker developed by the present invention provides a corresponding theoretical basis for improving the meat quality of local pigs, protecting the germplasm resources of Songlei black pigs and developing and utilizing them, and is of great significance to improving the meat quality of Songlei black pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The target fragment amplified by primer FSD2-F / R,

[0019] Figure 2 This is the genotype sequencing diagram when the haplotype of the 54th base of the second exon of the FSD2 gene is GG, AG, and CC.

[0020] Figure 3 This is the genotype sequencing diagram when the haplotype of the 369th base of the second exon of the FSD2 gene is CC, TT, and CT.

[0021] Figure 4 This is the genotype sequencing map of the 54th and 369th bases of the second exon of the FSD2 gene. DETAILED DESCRIPTION

[0022] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0023] Main reagents and instruments: The genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number: DP304; the PCR amplification kit was purchased from Kangwei Century Biotechnology Co., Ltd., catalog number: CW0690H.

[0024] The PCR instrument was Bio-rad MyCycler, the electrophoresis instrument was Beijing Liuyi DYCP-31DN agarose power gel laboratory horizontal vertical electrophoresis instrument, the ultra-micro-volume spectrophotometer was Thermo Fisher Ultra-micro-volume UV spectrophotometer NanoDrop One, and the gel imaging analyzer was Beijing Liuyi WD-9413 gel imaging analyzer.

[0025] Example 1

[0026] 137 Songlei black pigs weighing about 100 kg were selected from Jilin Xinghui Qipan Agricultural Technology Co., Ltd. for slaughter, and the longissimus dorsi muscle was collected. According to the national standard measurement specifications, the meat quality indicators such as thawing water loss rate, initial moisture, meat color, water holding capacity, pH value, intramuscular fat content, and shear force were measured.

[0027] At the same time, the genomic DNA of the above-mentioned Songlei black pig was extracted. The specific method was as follows: first, the tissue was cut into pieces with sterilized ophthalmic scissors, and then the total DNA was provided by the kit after homogenization. The concentration and purity of the DNA solution were determined according to the instructions, and it was stored at -20°C for subsequent PCR.

[0028] Primers were designed based on the sequence of the porcine FSD2 gene in Ensemble (Ensembl number: ENSSSCT00000002022.5), and the sequence was synthesized by Suzhou Genewise Biotechnology Co., Ltd. The sequence information is shown in Table 1.

[0029] Table 1 Primer information

[0030]

[0031] 60 sample DNAs were randomly selected, and 5 μL of each sample was selected to form a DNA pool sample. The pool sample was used as a template and PCR amplification was performed using the primers listed in Table 1. The reaction system was: 0.5 μL of upstream and downstream primers, 0.5 μL of DNA template, 10 μL of 2×Premixbuffer, and water was added to make up to 20 μL; the reaction procedure was: denaturation at 95°C for 5 min, then 95°C for 30 s, 60°C for 30 s, and 72°C for 40 s, 30 cycles, and extension at 72°C for another 5 min. The amplified fragment was electrophoresed with 1% agarose gel, stabilized at 100 V, and electrophoresed for 20 min. It showed a specific band with a fragment length of 800 bp. The PCR product with a single band was sequenced, and the Ensemble database sequence was compared with the sequenced nucleotide sequence using SeqMan in DNASTAR to screen for polymorphic sites. The SeqMan comparison results are shown in the following table. Figure 2 and Figure 3 As shown in the figure, the 54th and 369th bases of the second exon of the FSD2 gene have G / A and T / C polymorphisms (G54A and T369C), respectively, and there are three haplotypes: natural homozygous, heterozygous, and mutant homozygous. After sequence alignment, it was found that the two polymorphic sites were completely linked, that is, there were only three haplotypes: GGTT, AGCT, and AACC.

[0032] The nucleotide sequence amplified by the primer pair FSD2-F / R and the polymorphism information of the 54th base and the 369th base of the second exon of the FSD2 gene are shown in SEQ ID NO. 3. Lowercase letters represent intron regions, uppercase letters represent exon regions, underlined sequences are positions that bind to the primers, and sites with double signs are SNP sites.

[0033] SEQ ID NO.3:

[0034] aaattgtggatgagttgagccc aatctaataaccatctagtgcactgacctcagaaatggggttttctgttctagGACCCAGG

[0035] ATATCTATTAATAACTGTCCAAAAAGAAACCTTCCTGTGCAGAGGGGCTGCCCC .

[0037] GAGCATCCAGAGCCACGATGGAAGAGGAAGCAGGTGAGGCCCCGGGGCTGG

[0038] GCAGGCCCGCTGCTCCTAAGGATTTCCACTTTTATCACGTGGATTCTGTACGACT

[0039] CTGAAGACAGACTGCAGATCTTCCCGGAAGGAAACGCTCGGATGCGAAGAGA

[0040] GGTAGTCCAGGCTGAAATGACCAACGAACCAAGAGCAGCCGTGAAAGGGAA

[0041] GGCTCCGAGAGACCTTGAAGAAGAAGTGGATGAACTTGTCCATCTTTACGGAC

[0042] TTGAAGATGATCATGAATTAGGCGATGCATTCGTTGACGAAAGCATGCCCAGA .

[0044] ATAGAGGTTTCAGAGTATCCTCCTTATGGGATGACGGGGAGAGAAGCAGCCAG

[0045] GGAGCAGAGAGACTGGAGACTTAGCGGGGAGGAGGCTAATGCAGAGGACCT

[0046] GGGCTTGGGGGGCTGGGGCTCGGCGGACCAGTGCCAGGACTTGCGGGAAGCC

[0047] TATAGGTATACCCATGGCCGTGCCAGTGAGGAGTATGAATGCTACGTCATCCCA

[0048] GAGGAGGAAGACGAGGATGAAGCTGCGGATGTCTTCTGTGTCACCTGCAAAA

[0049] CACCAGTCAGAGCTTTGGAGGTTTCTGATGAACACAAGGAACATGAGGTAACCCACTCCATAAAGC A CTGGAAAGCGCCAAGgtaa.

[0050] Then, primer pair FSD2-F / R was used to perform PCR amplification of the polymorphic fragments in 137 samples. The amplification system and amplification procedure were the same as above. After amplification, the PCR products were sequenced. The gene and genotype frequencies of the two SNP loci of the FSD2 gene in the 137 Songlei black pigs tested are shown in Table 2.

[0051] Table 2 Haplotype frequency and gene frequency analysis

[0052]

[0053] Note: df = 2, χ 2 (0.05) = 5.99, χ 2 (0.01) = 9.21

[0054] The population genetics indicators were statistically analyzed using Excel, and the results are shown in Table 3.

[0055] Table 3 Genetic diversity of haplotypes

[0056]

[0057] The results of population diversity analysis in Table 3 showed that the homozygosity of haplotypes was high and moderately polymorphic (0.25<PIC<0.5).

[0058] The association analysis between SNP loci and reproductive trait indicators was performed using SPSS, and the results are shown in Table 4.

[0059] Table 4 Correlation between haplotype and meat quality

[0060]

[0061]

[0062] Note: No letters or the same letters in the same column indicate no significant difference; lowercase letters indicate significant difference (P<0.05); uppercase letters indicate extremely significant difference (P<0.01)

[0063] Indicators for evaluating pork quality include meat color, water holding capacity, muscle marbling, intramuscular fat content, pH value, muscle shear force, tenderness, flavor, etc. Among them, meat color is an important indicator for evaluating the appearance of meat quality, and is an apparent manifestation of muscle physiology, biochemistry, and microbiology. Meat color includes brightness L value, redness a value, and yellowness b value; the higher the L value, the paler the meat color and the worse the quality; the larger the a value, the higher the content of oxymyoglobin in the muscle and the brighter the meat color; a high b value indicates that the meat color is yellowish. In general, the smaller the L value and b value, and the larger the a value, the better the color of the pork, and the more popular it is with consumers.

[0064] The distribution and deposition of adipose tissue are key factors affecting pork quality, while intramuscular fat content and marbling are important performance indicators that reflect muscle fat deposition. Appropriate intramuscular fat content can effectively improve the tenderness, marbling, juiciness, taste and flavor of pork. If the intramuscular fat content is too low, the muscle tenderness, taste and flavor will be poor, while if the intramuscular fat content is too high, the lean meat rate will be seriously reduced, affecting market acceptance. Studies have shown that the ideal intramuscular fat content of meat-type pigs is 3.0% to 4.5%, 2.0% to 2.9% is a more ideal value, and those below 1.5% are difficult to adapt to current market demand.

[0065] Table 4 shows that haplotype type is related to brightness and intramuscular fat content 24 hours after slaughter. The muscle brightness (L value) of GGTT haplotype individuals is significantly lower than that of AACC haplotype individuals, and the intramuscular fat content is extremely significantly higher than that of GATC and AACC haplotype individuals. These results indicate that the SNP polymorphisms (G54A and T369C) at the 54th and 369th bases of the second exon of the FSD2 gene have an important influence on the meat color and intramuscular fat traits of Songlei black pigs 24 hours after slaughter. These two SNP sites can be used as a basis for identifying the quality of Songlei black pig meat. The selected GGTT haploid black pig individuals have excellent meat color and high intramuscular fat content, which can be used for early selection, thereby accelerating the breeding process of breeding pigs.

[0066] From the above examples, it can be seen that the present invention provides a haplotype molecular marker, detection method and application thereof related to the quality of Songlei black pig meat. The SNP polymorphism (G54A and T369C) at the 54th and 369th bases of the second exon of the FSD2 gene has an important influence on the intramuscular fat content and meat color of Songlei black pig meat, and can be used as a basis for identifying the quality of Songlei black pig meat.

[0067] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A haplotype molecular marker related to the quality of Songlei black pork, characterized in that: The molecular marker includes two SNP sites, which are respectively located at the 54th base and the 369th base of the second exon of the FSD2 gene of the Songlei black pig; there is a G / A polymorphism at the 54th base, and a T / C polymorphism at the 369th base. The two sites are completely linked and have three haplotypes of GGTT, GATC and AACC.

2. Application of the haplotype molecular marker described in claim 1 in Songlei black pig breeding.

3. A primer for detecting the haplotype molecular marker according to claim 1, characterized in that: The nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

2.

4. A reagent or kit containing the primer according to claim 3.

5. A method for identifying the quality of Songlei black pork, characterized in that: The following steps are involved: S1. Using the genomic DNA of the Songlei black pig to be tested as a template, PCR amplification was performed using the primers described in claim 3; S2. Sequence the amplified product, detect the haplotype of the SNP site, and identify the meat quality of Songlei black pig.

6. The method according to claim 5, characterized in that The reaction system of the PCR amplification is: 0.5 μL of upstream and downstream primers, 0.5 μL of DNA template, 10 μL of 2×Premix buffer, and water is added to make up to 20 μL.

7. The method according to claim 5, characterized in that The reaction procedure of the PCR amplification was: denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 40 s, and extension at 72°C for 5 min.

8. The method according to claim 5, characterized in that The identification criteria for the quality of Songlei Black Pork meat are as follows: the meat color of GGTT haplotype individuals is significantly better than that of AACC haplotype individuals 24 hours after slaughter, and the intramuscular fat content is extremely significantly higher than that of GATC and AACC haplotype individuals.

Images