Primer group for specific gene detection of vibrio parahaemolyticus, screening method and application

Abstract

The invention provides a primer group for specific gene detection of vibrio parahaemolyticus. The primer group comprises any one of gyrB and DAADH or a combination of at least two of gyrB and DAADH. The invention also provides a screening method of the primer group. The screening method comprises the following steps: (1) extracting genome DNA containing a target gene; (2) mixing the genome DNA with the primer group to obtain a reaction system; (3) carrying out fluorescent quantitative PCR amplification reaction on the reaction system; and (4) screening the primer group according to a reaction result. The invention also provides application of the primer group. The primer group with strong specificity, good repeatability and high sensitivity is screened through a fluorescent quantitative PCR technology, vibrio parahaemolyticus in a clinical specimen can be directly and rapidly detected, isolated bacterial culture is not needed, the clinical detection time is shortened, the detection efficiency is improved, the treatment waiting time of a patient is shortened, and the medical service quality is improved; in addition, the detection specificity, sensitivity and accuracy are also improved; belongs to the technical field of detection.

Description

Technical Field

[0001] The present invention relates to the field of detection technology, and in particular to a primer set, a screening method and an application thereof for detecting species-specific genes of Vibrio parahaemolyticus. Background Art

[0002] Vibrio parahaemolyticus is a facultative anaerobic, Gram-negative, polymorphic coccobacillus, halophilic bacterium. Its body is arc-shaped, filamentous or rod-shaped, without spores and capsules. It is widely distributed in seawater, plankton, seabed mud, and fish and shellfish. Since Vibrio parahaemolyticus has a high detection rate in seafood in my country and causes a large proportion of food poisoning, it is an important foodborne pathogen in my country. Foodborne diseases caused by Vibrio parahaemolyticus are clinically characterized by abdominal pain, diarrhea, vomiting and watery stools as the main symptoms. In a few cases, it induces sepsis. The main pathological changes are mild erosion of the jejunum and ileum, gastric mucositis, and congestion of the liver, lungs, and spleen.

[0003] At present, the detection methods of Vibrio parahaemolyticus are mainly divided into three types: traditional culture, immunological detection and molecular biological detection. Although the traditional culture detection method is mature and reliable, it is time-consuming, labor-intensive and cumbersome to operate. Although the immunological detection method is more sensitive and specific than the traditional detection method, it is still insufficient compared with the molecular biological detection method. The molecular biological detection method has high sensitivity, strong specificity and high efficiency, and can accurately identify Vibrio parahaemolyticus from samples such as food, feces and water samples.

[0004] Among molecular biological detection methods, polymerase chain reaction (PCR) detection technology is simple, fast and highly specific. It is widely used in the detection of pathogenic microorganisms and gene detection, especially in the joint detection of pathogens. PCR detection technology requires the use of amplification primers. Therefore, screening a primer set for species-specific gene detection of Vibrio parahaemolyticus with strong specificity and high sensitivity can quickly and sensitively detect Vibrio parahaemolyticus, which is of great significance for clinical detection. Summary of the invention

[0005] The purpose of the embodiments of the present invention is to provide a primer set, screening method and application for species-specific gene detection of Vibrio parahaemolyticus, so as to solve the technical problems of poor specificity, poor sensitivity and low detection efficiency in the prior art detection methods of Vibrio parahaemolyticus.

[0006] To achieve the above object, the technical solution adopted by the present invention is: to provide a primer set for detecting species-specific genes of Vibrio parahaemolyticus, including any one of gyrB and DAADH or a combination of at least two of them.

[0007] Preferably, the gyrB includes any one of gyrB-F1, gyrB-R1, gyrB-F2, gyrB-R2, gyrB-F3, gyrB-R3, or a combination of at least two of them; the DAADH includes any one of DAADH-F1, DAADH-R1, DAADH-F2, DAADH-R2, DAADH-F3, DAADH-R3, or a combination of at least two of them.

[0008] Preferably, the nucleotide sequence of gyrB-F1 is CCACAACATCATCATCAT;

[0009] The nucleotide sequence of gyrB-R1 is GTAGAAGAAGGTCAACAG;

[0010] The nucleotide sequence of gyrB-F2 is TCAGCCACCACTATACAA;

[0011] The nucleotide sequence of the gyrB-R2 is GTCCAATGCCAATGATACT;

[0012] The nucleotide sequence of gyrB-F3 is TGAGCTATCGTTCTTGAA;

[0013] The nucleotide sequence of the gyrB-R3 is ACCACCTTCATACATGAA.

[0014] Preferably, the nucleotide sequence of DAADH-F1 is AATTCAATACCGAAGTGAGTAAT;

[0015] The nucleotide sequence of the DAADH-R1 is TACCAGAAGCAACGACAA;

[0016] The nucleotide sequence of DAADH-F2 is TGTCGTTGCTTCTGGTAG;

[0017] The nucleotide sequence of the DAADH-R2 is TAGCGTCAGTGAATATCCTT;

[0018] The nucleotide sequence of DAADH-F3 is TCGCTATCAAATCAACAAA;

[0019] The nucleotide sequence of the DAADH-R3 is CGTCCTTGGTATTCAATC.

[0020] Preferably, the mass ratio of the primers in the primer set is 1:1.

[0021] The second aspect of the present invention provides a method for screening a primer set for detecting species-specific genes of Vibrio parahaemolyticus as described in any one of the above, comprising the following steps:

[0022] (1) Extract genomic DNA containing the target gene;

[0023] (2) mixing the genomic DNA with the primer set to obtain a reaction system;

[0024] (3) performing fluorescent quantitative PCR amplification reaction on the reaction system;

[0025] (4) Screening the primer set based on the reaction results.

[0026] Preferably, in step (1), the target gene is a species-specific gene, and the species-specific gene includes any one of gyrB and DAADH, or a combination of at least two of them.

[0027] Preferably, in step (2), the reaction system further comprises a nucleic acid amplification reagent, which comprises Taq DNA polymerase, dNTPs, Mg 2+ Reagents, buffers, and ddH2O.

[0028] Preferably, in step (2), the reaction system includes 10 μL Taq Master Mix (comprising Taq DNA polymerase, dNTPs, Mg 2+ Reagents and buffers), 2 μL primer set, 1.5 μL genomic DNA and 6.5 μL ddH2O.

[0029] Preferably, in step (3), the amplification program of the fluorescent quantitative PCR amplification reaction is 95°C-5 min, 95°C-15 s, 60°C-34 s, 35 cycles; 95°C-15 s, 60°C-1 min, 95°C-15 s, 60°C-15 s.

[0030] The third aspect of the present invention provides an application of a primer set for detecting species-specific genes of Vibrio parahaemolyticus as described in any one of the above items, and the clinical application of the primer set in detecting Vibrio parahaemolyticus.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] (1) The present invention provides a primer set and screening method for detecting species-specific genes of Vibrio parahaemolyticus. By using fluorescent quantitative PCR technology, through specificity, cross-reactivity, repeatability and sensitivity tests, a primer set with strong specificity, good repeatability and high sensitivity is screened out, thereby improving the specificity of PCR detection of Vibrio parahaemolyticus.

[0033] (2) The present invention also provides an application of a primer set for detecting species-specific genes of Vibrio parahaemolyticus. Vibrio parahaemolyticus in clinical specimens can be directly and rapidly detected through fluorescent quantitative PCR technology without the need for bacterial isolation and culture, thereby shortening clinical detection time, improving detection efficiency, shortening patients' waiting time for medical treatment, and improving the quality of medical services. In addition, the specificity and sensitivity of the detection are improved, specific detection of Vibrio parahaemolyticus is achieved, and the accuracy of clinical detection is improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0035] FIG1 is a PCR amplification curve of the specificity test of the primer set in Vibrio parahaemolyticus, wherein (a) is three sets of gyrB primer sets, and (b) is three sets of DAADH primer sets;

[0036] FIG2 is a PCR amplification curve of the cross-reactivity test of the primer sets in common clinical infectious pathogens and closely related bacteria, wherein (a) is three sets of gyrB primer sets, and (b) is three sets of DAADH primer sets;

[0037] FIG3 is a PCR amplification curve of the repeatability test of the primer set in Vibrio parahaemolyticus, wherein (a) is three sets of gyrB primer sets, and (b) is three sets of DAADH primer sets;

[0038] FIG4 is a PCR amplification curve of the sensitivity test of the primer sets in Vibrio parahaemolyticus, wherein (a) is three sets of gyrB primer sets, and (b) is three sets of DAADH primer sets. DETAILED DESCRIPTION

[0039] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0040] The present invention provides a primer set, screening method and application for detecting species-specific genes of Vibrio parahaemolyticus. The samples and reagents used are conventional commercially available products, as follows:

[0041] (1) Sample source

[0042] The strains of Vibrio parahaemolyticus and other Vibrio samples were donated by the College of Oceanography, Weihai Campus, Shandong University. The Vibrio parahaemolyticus specimens and clinical specimen strains used in cross-reactivity tests were from the Microbiology Department of the Central Laboratory of Weihai Municipal Hospital Affiliated to Shandong University. The primers in the primer set were synthesized by Kunshan Pronopuhe Biotechnology Co., Ltd.

[0043] (2) Source of reagents

[0044] Adopt Hieff PCR amplification experiments were performed using qPCR SYBR GreenMaster Mix amplification reagent, TIANLONG Gentier96RPCR amplifier from Xi'an Tianlong Technology Co., Ltd., and Thermofisher Scientific 7500PCR amplifier from Thermo Fisher Scientific, USA.

[0045] (3) Genomic DNA extraction method

[0046] According to the bacterial genomic DNA extraction kit of Tiangen Biochemical Technology Co., Ltd., bacterial genomic DNA was extracted according to the instructions and stored at -20°C for future use.

[0047] In order to verify the reliability of the effect of the present invention, the present invention is described below in conjunction with Examples 1 to 5.

[0048] (I) Primer sets for species-specific gene detection of Vibrio parahaemolyticus

[0049] Example 1 Design and synthesis of each primer in the primer set and composition of the primer set

[0050] According to the literature and NCBI database, the nucleotide sequences of the species-specific genes gyrB and DAADH of Vibrio parahaemolyticus strains were determined, and the primers were designed using Beacon Designer 8 software and handed over to Kunshan Pronopre Biotechnology Co., Ltd. for synthesis.

[0051] The nucleotide sequences of the primers in the primer set are shown in Table 1.

[0052] Table 1 Nucleotide sequences of each primer in the primer set

[0053] Primer name Nucleotide sequence serial number gyrB-F1 CCACAACATCATCATCAT SEQ NO:1 gyrB-R1 GTAGAAGAAGGTCAACAG SEQ NO:2 gyrB-F2 TCAGCCACCACTATACAA SEQ NO:3 gyrB-R2 GTCCAATGCCAATGATACT SEQ NO:4 gyrB-F3 TGAGCTATCGTTCTTGAA SEQ NO:5 gyrB-R3 ACCACCTTCATACATGAA SEQ NO:6 DAADH-F1 AATTCAATACCGAAGTGAGTAAT SEQ NO:7 DAADH-R1 TACCAGAAGCAACGACAA SEQ NO:8 DAADH-F2 TGTCGTTGCTTCTGGTAG SEQ NO:9 DAADH-R2 TAGCGTCAGTGAATATCCTT SEQ NO:10 DAADH-F3 TCGCTATCAAATCAACAAA SEQ NO:11 DAADH-R3 CGTCCTTGGTATTCAATC SEQ NO:12

[0054] The composition of each primer set is shown in Table 2.

[0055] Table 2 Ratio of each primer in the primer set

[0056] Serial number Primer set name composition Quality Ratio 1 gyrB-1 gyrB-F1 and gyrB-R1 1:1 2 gyrB-2 gyrB-F2 and gyrB-R2 1:1 3 gyrB-3 gyrB-F3 and gyrB-R3 1:1 4 DAADH-1 DAADH-F1 and DAADH-R1 1:1 5 DAADH-2 DAADH-F2 and DAADH-R2 1:1 6 DAADH-3 DAADH-F3 and DAADH-R3 1:1

[0057] (II) Screening method for primer sets for species-specific gene detection of Vibrio parahaemolyticus

[0058] Using the six primer sets of Example 1, screening tests of primer sets were performed, including specificity tests, cross-reactivity tests, repeatability tests, and sensitivity tests.

[0059] The method for screening a primer set for detecting species-specific genes of Vibrio parahaemolyticus specifically comprises the following steps:

[0060] (1) Using the bacterial genomic DNA extraction kit of Tiangen Biochemical Technology Co., Ltd., bacterial genomic DNA (including Vibrio parahaemolyticus, common clinical infectious pathogens, and Vibrio strains) was extracted according to the instructions and stored at -20°C;

[0061] (2) Dilute bacterial genomic DNA 100-fold and the primer set 10-fold;

[0062] (3) Add 10 μL Taq Master Mix (containing Taq DNA polymerase, dNTPs, Mg) to 20 μL reaction system. 2+ reagents and buffers), 2 μL primer set, 1.5 μL bacterial genomic DNA, and 6.5 μL ddH2O;

[0063] (4) PCR amplification experiments were performed using a PCR amplifier (TIANLONG Gentier96R and Thermofisher Scientific7500); the amplification program was 95°C-5 min, 95°C-15 s, 60°C-34 s, 35 cycles; 95°C-15 s, 60°C-1 min, 95°C-15 s, 60°C-15 s.

[0064] (5) Detect the amplified product by fluorescence quantitative method, perform data analysis, and screen the primer set based on the analysis results.

[0065] Example 2 Specificity test of primer set

[0066] The primers of each gene were added to 20 μL of PCR amplification system at a mass ratio of 1:1, and the amplification program was set according to the instructions of the kit, and PCR amplification tests were performed in 4 strains of Vibrio parahaemolyticus. The PCR amplification curve is shown in Figure 1.

[0067] As shown in Figure 1, the six primer sets of gyrB-1, gyrB-2, gyrB-3, DAADH-1, DAADH-2, and DAADH-3 were all effectively amplified in Vibrio parahaemolyticus.

[0068] Example 3 Cross-reactivity test of primer sets

[0069] Clinical strains were collected for cross-reactivity testing, including common clinical infectious pathogens such as Escherichia coli, Klebsiella pneumoniae, Staphylococcus aureus, and Pseudomonas aeruginosa, and Vibrio alginolyticus, Vibrio harveyi, Vibrio vulnificus, and Vibrio mimicus. The above clinical strains were added to the amplification system, and the amplification program was set according to the instructions of the kit to perform PCR amplification tests. The PCR amplification curve is shown in Figure 2.

[0070] As shown in Figure 2, the gyrB-3 primer set has no cross-reactivity with other strains and has the best specificity. The gyrB-2 primer set has less cross-reactivity with other strains than the gyrB-1 primer set. All three DAADH primer sets have cross-reactivity with other strains.

[0071] Example 4 Repeatability test of primer set

[0072] Each primer set was subjected to 20 repeated PCR amplification tests in Vibrio parahaemolyticus. The PCR amplification curve is shown in Figure 3. The CT values ​​of the six primer sets are shown in Table 3.

[0073] Table 3 Repeatability test results of 6 primer sets (CT values)

[0074]

[0075]

[0076] As shown in Figure 3 and Table 3, the coefficients of variation of the five primer sets of gyrB-1, gyrB-2 and DAADH-1, DAADH-2, and DAADH-3 were all less than 5%, and the repeatability was good. The coefficient of variation of the gyrB-3 primer set was greater than 5%, and the repeatability was poor.

[0077] Example 5 Sensitivity test of primer set

[0078] The bacterial genomic DNA was diluted 10 times, and PCR amplification test was performed in Vibrio parahaemolyticus for each primer set. The PCR amplification curve is shown in Figure 4. The CT values ​​of the six primer sets are shown in Table 4.

[0079] Table 4 Sensitivity test results of 6 primer sets (CT values)

[0080]

[0081] As shown in Figure 4 and Table 4, the sensitivity of the four primer sets of gyrB-1, gyrB-2, DAADH-2, and DAADH-3 was better. -7When the CT value was less than 30, the expression of species-specific genes could still be effectively detected, which was considered to be effective amplification. -7 When the CT value exceeds 30 when the DNA concentration is 10 -6 μg / μL, gyrB-3 showed specific amplification at a DNA concentration of 10 -5 μg / μL showed specific amplification.

[0082] It can be seen from the test results of Examples 2 to 5 that the four primer groups of gyrB-1, gyrB-2, DAADH-2, and DAADH-3 have the best sensitivity and repeatability in detecting species-specific genes of Vibrio parahaemolyticus. Although the sensitivity and repeatability of the gyrB-3 primer group are relatively poor, its specificity is the best and there is no cross-reactivity with other strains. The DAADH-2 primer group has better specificity than the DAADH-3 primer group and has less cross-reactivity with other strains. It can be seen that the gyrB-3 primer group and the DAADH-2 primer group are primer groups with strong specificity, good repeatability, and high sensitivity. They are more suitable as primer groups for detecting species-specific Vibrio parahaemolyticus, and can quickly and efficiently detect species-specific genes of Vibrio parahaemolyticus.

[0083] (III) Application of primer sets for species-specific gene detection of Vibrio parahaemolyticus

[0084] The present invention also provides an application of a primer set for detecting species-specific genes of Vibrio parahaemolyticus. The clinical application of the primer set in detecting Vibrio parahaemolyticus includes the following steps: (1) extracting genomic DNA containing a target gene; (2) mixing the genomic DNA with the primer set to obtain a reaction system; (3) performing a fluorescent quantitative PCR amplification reaction on the reaction system; (4) confirming whether the species-specific gene of Vibrio parahaemolyticus is contained by comparing the CT value or the intensity of the fluorescent signal. The primer set exhibits high specificity, accuracy, sensitivity, and stability in the clinical detection of Vibrio parahaemolyticus. Vibrio parahaemolyticus in clinical specimens can be directly and rapidly detected by PCR technology without the need for isolated bacterial culture, which greatly shortens the detection time, improves the detection efficiency, and is suitable for clinical promotion.

[0085] In summary, the present invention provides a primer set and screening method for detecting species-specific genes of Vibrio parahaemolyticus. Through fluorescent quantitative PCR technology, specificity, cross-reactivity, repeatability and sensitivity tests, a primer set with strong specificity, good repeatability and high sensitivity is screened out, thereby improving the specificity of PCR detection of Vibrio parahaemolyticus. The present invention also provides an application of a primer set for detecting species-specific genes of Vibrio parahaemolyticus. Vibrio parahaemolyticus in clinical specimens can be directly and quickly detected through fluorescent quantitative PCR technology without the need for bacterial isolation and culture, thereby shortening clinical detection time, improving detection efficiency, shortening the waiting time for patients to see a doctor, and improving the quality of medical services; in addition, the specificity and sensitivity of the detection are improved, and specific detection of Vibrio parahaemolyticus is achieved, thereby improving the accuracy of clinical detection. The present invention can be widely used in the field of detection technology.

[0086] The embodiments described above are only used to illustrate the technical solutions of the present application, rather than to limit them. Although the present application has been described in detail with reference to the aforementioned embodiments, a person skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present application, and should all be included in the protection scope of the present application.

Claims

1. A primer set for detecting species-specific genes of Vibrio parahaemolyticus, characterized in that: It includes any one of gyrB and DAADH or a combination of at least two of them.

2. The primer set for detecting species-specific genes of Vibrio parahaemolyticus according to claim 1, characterized in that: The gyrB includes any one of gyrB-F1, gyrB-R1, gyrB-F2, gyrB-R2, gyrB-F3, and gyrB-R3, or a combination of at least two of them; the DAADH includes any one of DAADH-F1, DAADH-R1, DAADH-F2, DAADH-R2, DAADH-F3, and DAADH-R3, or a combination of at least two of them.

3. The primer set for detecting species-specific genes of Vibrio parahaemolyticus according to claim 2, characterized in that: The nucleotide sequence of gyrB-F1 is CCACAACATCATCATCAT; The nucleotide sequence of gyrB-R1 is GTAGAAGAAGGTCAACAG; The nucleotide sequence of gyrB-F2 is TCAGCCACCACTATACAA; The nucleotide sequence of the gyrB-R2 is GTCCAATGCCAATGATACT; The nucleotide sequence of gyrB-F3 is TGAGCTATCGTTCTTGAA; The nucleotide sequence of the gyrB-R3 is ACCACCTTCATACATGAA.

4. The primer set for detecting species-specific genes of Vibrio parahaemolyticus according to claim 2, characterized in that: The nucleotide sequence of DAADH-F1 is AATTCAATACCGAAGTGAGTAAT; The nucleotide sequence of the DAADH-R1 is TACCAGAAGCAACGACAA; The nucleotide sequence of DAADH-F2 is TGTCGTTGCTTCTGGTAG; The nucleotide sequence of the DAADH-R2 is TAGCGTCAGTGAATATCCTT; The nucleotide sequence of DAADH-F3 is TCGCTATCAAATCAACAAA; The nucleotide sequence of the DAADH-R3 is CGTCCTTGGTATTCAATC.

5. The primer set for detecting species-specific genes of Vibrio parahaemolyticus according to claim 2, characterized in that: The mass ratio of each primer in the primer set is 1:

1.

6. A method for screening a primer set for detecting species-specific genes of Vibrio parahaemolyticus according to any one of claims 1 to 5, characterized in that: The following steps are involved: (1) Extract genomic DNA containing the target gene; (2) mixing the genomic DNA with the primer set to obtain a reaction system; (3) performing fluorescent quantitative PCR amplification reaction on the reaction system; (4) Screening the primer set based on the reaction results.

7. The method for screening a primer set for detecting species-specific genes of Vibrio parahaemolyticus according to claim 6, characterized in that: In step (2), the reaction system also includes a nucleic acid amplification reagent, which includes Taq DNA polymerase, dNTPs, Mg 2+ Reagents, buffers, and ddH2O.

8. The method for screening a primer set for detecting species-specific genes of Vibrio parahaemolyticus according to claim 6, characterized in that: In step (3), the amplification program of the fluorescent quantitative PCR amplification reaction is 95°C-5 min, 95°C-15 s, 60°C-34 s, 35 cycles; 95°C-15 s, 60°C-1 min, 95°C-15 s, 60°C-15 s.

9. Use of a primer set for detecting species-specific genes of Vibrio parahaemolyticus according to any one of claims 1 to 5, characterized in that: The primer set is used clinically in detecting Vibrio parahaemolyticus.

Images