Plant endophytic bacterium absolute quantification method based on gradient internal reference

Abstract

The invention discloses a gradient internal reference-based absolute quantification method for plant endophyte bacteria, which comprises the following steps of: designing a specific primer for amplifying a plant endophyte bacteria absolute quantification internal reference sequence of a part matched with conserved sequences on two wings of an internal reference sequence; the method comprises the following steps: obtaining an internal reference sequence for amplifying absolute quantification of plant endophyte bacteria and increasing conserved sequences on two wings, and a specific primer for amplifying the plant endophyte bacteria 16SV5V7, mixing the series of internal reference sequences according to a certain gradient proportion, and jointly amplifying and building a library together with total DNA of a plant tissue sample, so as to obtain a specific primer for amplifying the plant endophyte bacteria 16SV5V7. The abundance of the endophyte flora in the plant tissue sample is absolutely quantified, so that the condition of quantitative distortion in plant endophyte detection is eliminated.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and relates to a method for quantifying plant endophytes, and in particular to an absolute quantification method for plant endophytic bacteria based on a gradient internal reference. Background Art

[0002] qPCR and internal standard sequencing are the current mainstream methods for detecting the absolute copy number of bacterial 16S, and each has its own advantages. However, the study of the absolute copy number of endophytic bacteria in plants faces challenges: the specific primers conventionally used to detect bacterial 16S amplicons easily match the mitochondrial and chloroplast genomes of plants, amplify plant host sequences, and the product size is comparable to that of bacterial 16S products, making it impossible to distinguish whether the amplified products are derived from plants or endophytic bacteria. In addition, the genome content of plant hosts is much higher than that of endophytic bacteria in plants, resulting in a large number of plant hosts in the amplified products.

[0003] Since qPCR detection only collects the fluorescent signal of the amplified product, the result cannot distinguish the content of the target endophyte from that of the plant host, resulting in complete distortion of the qPCR test results; although the internal standard sequencing method can distinguish the plant host from the endophytic bacteria through the sequence obtained by sequencing, when the host ratio is extremely high, it is very easy to waste data due to the extremely low copy number of endophytic bacteria, or the quantitative results are distorted due to the great difference between the copy number of endophytic bacteria and the copy number of the added internal standard DNA. On the other hand, for the relative quantification of plant endophytic bacteria, primers matching the V5V7 region are used to amplify endophytic bacteria. Although such primers may also mismatch with the plant genome, there is a difference between the length of the amplified product and the length of the endophytic bacterial amplified product. Therefore, during the library construction process, the interference of host DNA can be eliminated experimentally by cutting the gel.

[0004] Although we have designed a specific internal reference standard in patent CN109943654B to perform absolute quantitative detection of the content of microorganisms; however, it is mainly a detection of the content of microorganisms, and the length of the internal reference amplification product is comparable to the size of the non-specific product of the plant host. It is impossible to directly use the internal reference sequence in patent CN109943654B to detect the absolute copy number of endophytes in plant samples.

[0005] Therefore, based on the above technical problems, it is necessary to develop a set of methods suitable for the absolute quantification of endophytic bacteria in plants, so as to eliminate the quantitative distortion in the detection of endophytic bacteria in plants. Summary of the invention

[0006] The object of the present invention is to provide a method for absolute quantification of endophytic bacteria in plants based on gradient internal references. The method comprises adding specific primers for amplifying an absolute quantification internal reference sequence for endophytic bacteria in plants that contains conservative sequences on both sides of the internal reference sequence, obtaining an internal reference sequence for absolute quantification of endophytic bacteria in plants with added conservative sequences on both sides, and specific primers for amplifying endophytic bacteria 16SV5V7 in plants, which are co-amplified with total DNA of plant tissue samples to build a library, thereby achieving absolute quantification of the abundance of endophytic bacteria in plant tissue samples, thereby eliminating the situation of quantitative distortion in the detection of endophytic bacteria in plants.

[0007] In order to achieve the above object, a technical solution provided by a specific embodiment of the present invention is as follows:

[0008] In one aspect, the present invention provides specific primers for amplifying an absolute quantitative internal reference sequence of plant endophytic bacteria, comprising a first upstream primer and a first downstream primer respectively matching conserved sequences on both sides of the absolute quantitative internal reference sequence of plant endophytic bacteria, wherein the conserved sequences on both sides are the nucleotide sequence shown in SEQ ID NO: 1: AAC(A / C)GGATTAGATACCC(G / T)G, and the nucleotide sequence shown in SEQ ID NO: 2: GGAAGGTGGGGATGACGT;

[0009] The sequence of the first upstream primer is the nucleotide sequence shown in SEQ ID NO: 3:

[0010] AAC(A / C)GGATTAGATACCC(G / T)GGTGCCAGC(A / C)GCCGCGTAA;

[0011] The sequence of the first downstream primer is the nucleotide sequence shown in SEQ ID NO:4:

[0012] ACGTCATCCCCACCTTCCTCTAATCCTGTTTGCTCCCC.

[0013] On the other hand, the present invention also provides an internal reference standard for amplifying absolute quantification of plant endophytic bacteria, which is selected from at least 3 of the following internal reference sequences, and the internal reference sequences are amplified by the above-mentioned specific primers:

[0014] 1) a first internal reference sequence R1, the nucleotide sequence of which is shown in SEQ ID NO: 5;

[0015] 2) a second internal reference sequence R2, the nucleotide sequence of which is shown in SEQ ID NO: 6;

[0016] 3) a third internal reference sequence R3, the nucleotide sequence of which is shown in SEQ ID NO: 7;

[0017] 4) a fourth internal reference sequence R4, the nucleotide sequence of which is shown in SEQ ID NO: 8;

[0018] 5) a fifth internal reference sequence R5, the nucleotide sequence of which is shown in SEQ ID NO: 9;

[0019] 6) a sixth internal reference sequence R6, the nucleotide sequence of which is shown in SEQ ID NO: 10;

[0020] 7) a seventh internal reference sequence R7, the nucleotide sequence of which is shown in SEQ ID NO: 11;

[0021] 8) an eighth internal reference sequence R8, the nucleotide sequence of which is shown in SEQ ID NO:12.

[0022] In another aspect, the present invention provides a kit for absolute quantification of endophytic bacteria in plants, comprising at least three internal reference sequences selected from the above-mentioned internal reference standards, and specific primers for amplifying endophytic bacteria 16SV5V7.

[0023] In one or more embodiments of the present invention, the specific primers for amplifying the plant endophyte bacteria 16SV5V7 include a second upstream primer and a second downstream primer, the sequence of the second upstream primer is as shown in SEQ ID NO: 13: AAC(A / C)GGATTAGATACCC(G / T)G; the sequence of the second downstream primer is as shown in SEQ ID NO: 14: ACGTCATCCCCACCTTCC.

[0024] Preferably, the 5' end of the primer-specific primer is provided with a fluorescent base modification, and the fluorescent base modification is preferably FAM or ROX modification.

[0025] In one or more embodiments of the present invention, the internal reference sequences in the kit are mixed in 10-fold gradients, with two internal reference sequences repeated in each gradient, for a total of 4 gradients;

[0026] Preferably, the standard contains the following components in molar proportions: R1: 1000 parts, R2: 1000 parts, R3: 100 parts, R4: 100 parts, R5: 10 parts, R6: 10 parts, R7: 1 part, R8: 1 part

[0027] In one or more embodiments of the present invention, the internal reference sequence is a random sequence, the GC content of the internal reference sequence is 35% to 55%, and the length is between 300 and 350 bp.

[0028] On the other hand, the present invention also provides the specific primers for amplifying the absolute quantitative internal reference sequence of plant endophytes, or the internal reference standard for amplifying the absolute quantitative detection of plant endophytes, or the use of the kit in the absolute quantitative detection of plant endophytes.

[0029] In another aspect, the present invention further provides a method for absolute quantification of endophytic bacteria in plants, comprising the following steps:

[0030] 1) taking a sample to be tested, extracting its total DNA, and obtaining a total DNA sample;

[0031] 2) adding an appropriate amount of a mixture of at least three internal reference sequences in the above internal reference standard and specific primers for amplifying plant endophytic bacteria 16SV5V7 to the total DNA sample to obtain a PCR reaction sample, and then subjecting the PCR reaction sample to a PCR amplification reaction to obtain a PCR amplification product, wherein the at least three internal reference sequences account for 15-45% in the PCR reaction sample;

[0032] 3) Then the PCR amplification product is used as a template to amplify the sequencing library to obtain a sequencing library PCR product;

[0033] 4) Analyze the PCR products of the sequencing library, remove the adapter and low-quality sequences according to the analysis results, and then calculate the bacterial content in the sample to be tested according to the standard curve calculation method or the single gradient internal reference calculation method.

[0034] In one or more embodiments of the present invention, in step 2), the proportions of at least three internal reference sequences in the PCR reaction sample are adjusted by a method comprising the following steps:

[0035] The amplified product is analyzed, and the peak area of ​​the internal reference sequence and the 16S amplification target peak area in the sample to be tested are calculated to obtain the internal reference sequence ratio, and the amount of the internal reference sequence mixed solution is adjusted according to the internal reference ratio, so that the internal reference sequence ratio is 15-45%.

[0036] In one or more embodiments of the present invention, in step 4), the bacterial content in the sample to be tested is calculated according to a standard curve calculation method comprising the following steps:

[0037] A1. After the sequencing data is quality filtered, the read abundance values ​​of the internal reference sequence are obtained, with the abundance value of the internal reference sequence as the horizontal axis and the absolute copy number as the vertical axis. The logarithms are taken to draw the standard curve;

[0038] B1. The remaining sequencing data is then used to analyze the microbial community structure, and the number of reads annotated to each bacterial taxonomic unit is then calculated;

[0039] C1. Then, the total abundance in the sample to be tested is substituted into the standard curve in step A1 to calculate the total 16S copy number in the sample to be tested; or

[0040] Substitute the abundance of each bacterial taxonomic unit into the standard curve in step A1 to calculate and obtain the absolute copy number information of each bacterial taxonomic unit, thereby obtaining the copy number of each bacterial taxonomic unit in the sample to be tested.

[0041] In one or more embodiments of the present invention, the total copy number of 16S in the sample to be tested is calculated in step C1 by the following formula Z1:

[0042] N_total=n_total×(N / N'I) Formula Z1; or

[0043] The step C1 calculates the content of each bacterial taxon in the sample to be tested by the following formula Z2:

[0044] N_x=n_x×(N / N'I) Formula Z2,

[0045] Among them, N_total is the total number of bacterial copies in a unit sample.

[0046] n_total is the total copy number of 16S in the PCR amplification product,

[0047] n_x is the copy number of each bacterial taxonomic unit,

[0048] N is the total amount of DNA extracted from the sample to be tested, in ng.

[0049] N' is the total amount of DNA sample used as template in step 2), in ng.

[0050] I is the total amount of the sample to be tested used to extract DNA.

[0051] In one or more embodiments of the present invention, in step 4), the bacterial content in the sample to be tested is calculated according to a single gradient internal reference calculation method comprising the following steps:

[0052] A2. After the sequencing data is quality filtered, the read abundance values ​​of the at least three internal reference sequences are extracted and recorded as M_SPK, and the average theoretical copy number of the highest gradient internal reference sequence is recorded as C_SPK;

[0053] B2. Calculate the total number of 16S copies and the number of copies of each bacterial classification unit in the sample to be tested according to the following formula Z3 and the above formulas Z1 and Z2:

[0054] M_SPK / C_SPK=OTU_total / n_total Formula Z3,

[0055] N_total=n_total×(N / N'I) formula Z1,

[0056] N_x=n_x×(N / N'I) Formula Z2.

[0057] The gradient internal reference calculation method can be used to detect samples with very low endophyte content, such as samples with a copy number of less than 100 in the PCR system.

[0058] Compared with the prior art, the method for absolute quantification of endophytic bacteria in plants based on gradient internal references of the present invention obtains internal reference sequences for absolute quantification of endophytic bacteria in plants with added conserved sequences on both wings, and specific primers for amplifying 16SV5V7 of endophytic bacteria in plants, by adding specific primers for amplifying the absolute quantification internal reference sequences for endophytic bacteria in plants that match the conserved sequences on both wings of the internal reference sequences. The series of internal reference sequences are mixed in a certain gradient ratio, and are amplified and constructed together with the total DNA of plant tissue samples, so as to calculate the absolute copy number of bacterial 16S in the sample to be tested through a standard curve or a single gradient internal reference.

[0059] For samples with high endophyte content, compared with adding 1-2 independent internal reference samples, the standard curve can cover a larger copy number range and provide more accurate detection; in addition, the gradient of the standard curve itself can be used to measure the stability and reliability of the experiment to avoid distortion of results due to experimental deviations. At the same time, taking into account samples with low endophyte content, when standard curve fitting is not possible, a single gradient internal reference absolute copy number calculation solution is provided, making the detection experiment more compatible with various samples and obtaining more accurate absolute copy number results, thereby eliminating quantitative distortion in plant endophyte detection.

[0060] In addition, for samples with relatively high content of plant endophytes, the gradient internal reference related data was used to prepare the standard curve, and the standard curve was applied for absolute quantitative calculation; for samples with low content of plant endophytes, only a single gradient internal reference calculation method was used for absolute quantification (the ratio of the single highest gradient internal reference sequencing reads to the known theoretical copy number), and the reads of each bacterial community in the sample were converted to absolute copy number; and experiments showed that the copy number results of the two methods were consistent with those of the standard, and the detection accuracy was very high, which further expanded the scope of application of this detection method. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0062] Figure 1 The standard curve of the three replicate samples in Example 2 of the present invention;

[0063] Figure 2 This is a graph showing the absolute quantitative detection results of endophytes using the ZYMO standard DNA in Example 3 of the present invention;

[0064] Figure 3 This is a graph comparing the results of absolute quantification of endophytes of ZYMO standard DNA in Example 3 of the present invention detected by two methods.

[0065] Figure 4 The fluorescence peak of the 16SV5V7 internal reference sequence detected in the real plant sample in Example 4 of the present invention, the fluorescence peak of the 16SV5V7 region of the endophyte in the sample, and the fluorescence peak of the plant host sequence region. DETAILED DESCRIPTION

[0066] In order to enable those skilled in the art to better understand the technical solutions in the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0067] Unless otherwise specified, the reagents and materials herein can be purchased from conventional channels.

[0068] Unless otherwise specified, "16SV5V7-SPK9" herein refers to the "internal reference standard" of the present invention, and "16SV5V7-SPK5" refers to the "internal reference standard" after dilution.

[0069] Unless otherwise specified, "M" in the sequences herein refers to "A or C", and "K" in the sequences herein refers to "G or T".

[0070] Example 1 Preparation and Evaluation of Internal Reference Standards

[0071] 1. Preparation of internal reference standards for absolute quantification of endophytic bacteria in plants

[0072] 1. The gradient internal reference "GS_BSIS9" (SEQ ID NO: 15) of patent CN 109943654 B was used as a template and amplified using specific primers (see Table 1). The amplified internal reference sequence contained 8 internal reference sequences in patent CN109943654B, and two wing conservative sequences were added on the basis of these 8 internal reference sequences. The specific names are as follows: Gs_BSI1 (first internal reference sequence), Gs_BSI2 (second internal reference sequence), Gs_BSI3 (third internal reference sequence), Gs_BSI4 (fourth internal reference sequence), Gs_BSI5 (fifth internal reference sequence), Gs_BSI6 (sixth internal reference sequence), Gs_BSI7 (seventh internal reference sequence) and Gs_BSI8 (eighth internal reference sequence).

[0073] Table 1. Specific primers for amplifying plant bacterial absolute quantitative internal reference sequences

[0074]

[0075] 2. The internal standard DNA in step 1 was purified 1× using MagicPure Size Selection DNA Beads (Transgen, EC401-03). The recovered product was standardized to 38 ng / μL using TE (10 mM Tris-Cl, 1 mM EDTA, pH 8.0) and labeled 16SV5V7-SPK. The corresponding 8 internal reference copy numbers are shown in Table 2.

[0076] Table 216SV5V7-SPK internal reference sequence gradient copy number

[0077]

[0078] 3. Dilute 16SV5V7-SPK 100 times and record it as 16SV5V7-SPK9, corresponding to a total number of molecules of 1.10E+09 copies / μL;

[0079] 4. 16SV5V7-SPK9 was diluted 10-fold in a series. The nomenclature and corresponding molecular copy numbers are shown in Table 3;

[0080] Table 3. Correspondence between 10-fold serial dilution and copy number

[0081]

[0082]

[0083] 2. Use internal reference standards for sample testing and evaluation

[0084] 1. Based on the absolute quantification method of plant endophytic bacteria with gradient internal reference, specific primers for amplifying plant endophytic bacteria 16SV5V7 were designed and synthesized. The primer sequences are shown in Table 4.

[0085] 2. The total DNA in the sample is extracted by any method. The amount of each sample used for extraction must be equal, and the amount of sample (such as plant leaves, roots, etc.) must be strictly recorded, recorded as I, and the total amount of DNA extracted N (in ng);

[0086] 3. Use Qubit to accurately determine DNA concentration and standardize the sample to 900 ng / 30 μL using 1×TE;

[0087] 4. Take 2 μL of the standardized DNA for electrophoresis detection to determine the consistency of concentration between samples and the integrity of the DNA; samples with obvious concentration deviations need to be re-standardized, and degraded samples are regarded as quality control failure samples and no subsequent experiments are performed;

[0088] 5. Take 1 μL of the diluted 16SV5V7-SPK5 in step 1, add it to 1 μL of the standardized DNA sample, and use the specific primers for amplifying the plant endophytic bacteria 16SV5V7 obtained in step 1 to perform 25 cycles of PCR amplification to obtain a PCR amplification product;

[0089] Table 4. Specific primers for amplifying plant endophytic bacteria 16SV5V7

[0090]

[0091] 6. Take 1 μL of the 5-fold diluted PCR amplification product, mix it with 8.9 μL HiDi and 0.1 μL Liz500, and perform STR program detection using ABI 3730 genetic analyzer;

[0092] 7. Use PeakScan software (ABI) to calculate the peak area of ​​the fluorescent internal reference sequence and the peak area of ​​the sample target band, and calculate the data of (peak area of ​​internal reference sequence / (peak area of ​​internal reference sequence + peak area of ​​sample target band)), which is the proportion of internal reference in the sample. The proportion of internal reference in the sample is required to be between 15% and 45%;

[0093] 8. At the same time, according to the formula: added internal reference sequence copy number / internal reference sequence peak area = sample target gene copy number / sample target band peak area, estimate the sample target gene copy number; according to the estimated target gene copy number, reversely infer the copy number internal reference level that needs to be added when the internal reference sequence accounts for 15%-45%, recorded as C;

[0094] 9. According to the internal reference addition amount information C obtained by reverse deduction, take 1 μL of the internal reference diluted to C, add it to 1 μL of the standardized DNA sample, and use the specific primers for amplifying plant endophytic bacteria 16SV5V7 (primer sequences are shown in Table 4) to perform 25 cycles of PCR amplification;

[0095] 10. Repeat step 6 to verify whether the proportion of internal reference sequences is between 15% and 45%;

[0096] 11. Amplicon sequencing library (Index PCR), select PCR products with internal reference sequence ratio between 15% and 45%, perform index PCR, add index sequences for distinguishing samples and universal sequences required by Illumina sequencing platform to both ends of the amplicon library, and obtain sequencing library PCR products;

[0097] 12. The concentration of the PCR product in the sequencing library is determined by qubit, the molar concentration is detected by qPCR, and the length of the inserted fragment is detected by Agilent 2100. Finally, NGS sequencing is performed on the Illumina platform (such as Novasek6000) to obtain PE250 data.

[0098] Example 2. Preparation of internal reference standard and standard curve

[0099] 1. Design and synthesize the following primers:

[0100] Specific primers for amplifying plant bacterial absolute quantitative internal reference sequence internal reference sequence:

[0101] 799F-515F:AACMGGATTAGATACCCKGGTGCCAGCMGCCGCGGTAA(SEQ ID NO:3)

[0102] 1193R_R_new:ACGTCATCCCCACCTTCCTCTAATCCTGTTTGCTCCCC(SEQ ID NO:4)

[0103] Specific primers for amplifying plant endophytic bacteria 16SV5V7:

[0104] 799F:AACMGGATTAGATACCCKG(SEQ ID NO:13)

[0105] 1193R:ACGTCATCCCCACCTTCC(SEQ ID NO:14)

[0106] 2. Use GS_BSIS9 of patent CN 109943654 B as PCR amplification template to prepare 16SV5V7 absolute quantitative internal reference sequence. Use TransStart TopTaq DNA Polymerase Kit of Quan Formula Gold for amplification, and the amplification system is as follows:

[0107] Table 5

[0108] Reagents Volume (μL) 10XTopTaqBuffer 2 dNTP 1.6 799F-515F(10uM) 0.4 1193R_R_new(10uM) 0.4 TopTaq (2.5U / μL) 0.4 RFH2O Upto20 BSIS-9 1

[0109] The PCR amplification procedure is as follows:

[0110] Table 6

[0111] step transsexual annealing extend Keep Number of cycles Step 1 95℃2min Step 2 95℃30S 55℃30S 72℃1min 20 Step 3 72℃5min Step 4 4℃

[0112] 3. Use MagicPure Size Selection DNABeads from Quanshijin Company to purify PCR. The purified product is standardized to 38 ng / μL using TE (10 mM Tris-Cl, 1 mM EDTA, pH 8.0) and labeled 16SV5V7-SPK. 16SV5V7-SPK contains 8 internal reference sequences in Example 1. The specific sequence information is as follows:

[0113] >Gs_BSI1

[0114] AACMGGATTAGATACCCKGGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGTCCGATACGAAACTTCTTGCACAGGCATGAGGCACGCGTGCGTACCAGACGGCCTCGGAATACACC GGAAACCTTTGAGGCCGCTCCCAGGTGTACGCGAGGCACCAAAGCGGTATCCATGGTAGAGAACACTGCTGCGGATTACCGACATTTAGCCTCGCGTATAGCACCCTGCCGTTGCGTGGGGAGCAAACAGGATTAGAGGAAGGTGGGGATGACGT(SEQ ID NO:5)

[0115] >Gs_BSI2

[0116] AACMGGATTAGATACCCKGgtgccagcagccgcggtaatacggagggtgcaagcgttaatcggaattactgggcgtaaagcgcacgcaggcggttTGGTTAGGCACACATGGCACCGGTCTGCGTTGTGAGCGTACCTTTCACCTCCTATCGCCGTCGTCGGCGTTATAGACAGCACTCCTTCGTTGCTACTACCTGGGTAGGTTAGCACCACGAATCATCCCGACGAAATGACACCGGATCGGGCTGATAGGTGACTCGGAAAGCTGAATCGAGgtggggagcaaacaggattagaGGAAGGTGGGGATGACGT(SEQ ID NO:6)

[0117] >Gs_BSI3

[0118] AACMGGATTAGATACCCKGgtgccagcagccgcggtaatacgtaggtggcaagcgttgtccggatttactgggcgtaaagggagcgtaggtggatTGCCTAGCCTAGCGGTTGGAGCGGGAATACTAAGGTGCAGTGTTTCCCATGGCCGGATTTAGGCGCTTCACGGGATCGTCGAGTTCGTCTGGGCATAGGTCGCGTCACGCTTTCATTCGAAGCCGATCTCGGACCGCCACCGATAAGGCAGTAGTCGCCTGTGGCATGTGCCTCGCTGAGgtggggagcaaacaggattagaGGAAGGTGGGGATGACGT(SEQ ID NO:7)

[0119] >Gs_BSI4

[0120] AACMGGATTAGATACCCKGgtgccagcagccgcggtaatacggagggtgcaagcgttaatcggaattactgggcgtaaagcgcacgcaggcggttGCCGGGTATTGTAGAGACGTCGCACTTACTTGCTCCACCCGACTCGACCCTGTTGGGTTACCGCGGAAAGTTTGGTCGTCCTCTCTGCCATCAGGCGGGATATAGGGAGCTCCGGCAAACGTGGTGCATCCGCAGAGCGGGATGCTGTGGTCAGCTTGGACTTGACGACTGTACCTCAGCgtggggagcaaacaggattagaGGAAGGTGGGGATGACGT(SEQ ID NO:8)

[0121] >Gs_BSI5

[0122] AACMGGATTAGATACCCKGgtgccagcagccgcggtaatacggagggtgcaagcgttaatcggaattactgggcgtaaagcgcacgcaggcggttGTAAGGCGACTTCTCTTATGACCAAAGTGGGCGTCCATGGCTTAGACTCGTGTGGCTCGAACCGAAGTCTTGACGTGATCTCGGGAGGGATGGTCGAGCTACTACCACACTCTCGGCTCAATTACCGTGTGACATCGGATACTCCAACATGGCACGGCGACTGTATTACACGATCCTGGTgtggggagcaaacaggattagaGGAAGGTGGGGATGACGT(SEQ ID NO:9)

[0123] >Gs_BSI6

[0124] AACMGGATTAGATACCCKGgtgccagcagccgcggtaacacgtaagttgcgagcgttgttcggaattattgagcgtaaagggcatgtaggcggttGTTTGCTCGACATGGTTCGAGCTGGTAGAGATGCGGCCGTCCTAAGAGGAGAGTAGTGCGTCGCAAAGCACCCGGGTCAAGAGCCGGAGTTGACAGCACACCTTGACTCACTCGTATGGCAATAGCAGGACCACATTCGGGTTCGCGCATTACGATTACCACGTGGTCCTTGCTCGACCCgcggggagcaaacaggattagaGGAAGGTGGGGATGACGT(SEQ ID NO:10)

[0125] >Gs_BSI7

[0126] AACMGGATTAGATACCCKGgtgccagcagccgcggtaatacggagggtgcaagcgttaatcggaattactgggcgtaaagcgcacgcaggcggttCATCGCGAGGCTTTATACGAGGCACCAAATAAGCACCGTAATAAGTGAGTCCCGCGGGCTTATTGTGCTGCAGTATAGCTACTATAGCGTAGGGATCGATATCAGCTATACCTAGATGAGAGCCCATTTCCGCTCGATATACCTAGGGACACGTAGATGTACTATTTCGGCGACTTGGATgtggggagcaaacaggattagaGGAAGGTGGGGATGACGT(SEQ ID NO:11)

[0127] >Gs_BSI8

[0128] AACMGGATTAGATACCCKGgtgccagcagccgcggtaatacggagggtgcaagcgttaatcggaattactgggcgtaaagcgcacgcaggcggttGAAGGCGTTGCGTTCTTCTCGCTGGACCAGACTCTAATGGCATGTCTCATTCTGTCGTGGCCTGTATTCGCGGAGTGTGTGAGTCTTTGGGCAATGTCAGCAGTGAGCTACCCTGGGAGCAGCCGGACCTCTCTTGAGCGAATGCAGACGGGTTACCGAATCACACCCACCCTCACAGCGgtggggagcaaacaggattagaGGAAGGTGGGGATGACGT(SEQ ID NO:12)

[0129] >Gs_BSI9

[0130] (SEQ ID NO:15)

[0131] 4. Dilute 16SV5V7-SPK to 16SV5V7-SPK6, use it as a template, and use Beijing Quanshijin Biotechnology's TransStart TopTaq DNA Polymerase Kit for PCR amplification. Set up 3 replicates, and the amplification system is as follows to obtain the PCR amplification product:

[0132] Table 7

[0133] Reagents Volume (μL) 10XTopTaqBuffer 1 dNTP 0.8 799F(10uM) 0.2 1193R(10uM) 0.2 TopTaq (2.5U / μL) 0.2 RFH2O Upto10 16SV5V7-SPK6 1

[0134] The amplification procedure is as follows:

[0135] Table 8

[0136] step transsexual annealing extend Keep Number of cycles Step 1 95℃2min Step 2 95℃30S 55℃30S 72℃1min 20 Step 3 72℃5min Step 4 4℃

[0137] 5. Then the PCR amplification product was diluted 5 times and used as a template amplicon sequencing library (index PCR). The index sequence used to distinguish the samples and the universal sequence required by the Illumina sequencing platform were added to both ends of the amplicon sequencing library to obtain the sequencing library PCR product.

[0138] 6. After the sequencing library PCR product (Index PCR product) is purified by MagicPure Size Selection DNA Beads, the purified library is loaded onto the Illumina sequencing platform to obtain PE250 data with a data volume of approximately 150,000 reads;

[0139] 7. The obtained PE250 data were analyzed, and the exported Fastq files were removed from the adapters and low-quality sequences. Eight internal reference sequences were extracted, and the abundance (OTU) of the eight internal reference sequences was used as the horizontal axis, and the absolute copy number was used as the vertical axis. After taking the logarithm, standard curve fitting was performed.

[0140] 8. See the results Figure 1 ,It can be seen from the figure that the linear fitting coefficient R2 of the standard curve of the three replicate samples is greater than 0.99, and the gradient of the standard curve is good.

[0141] Example 3. Determination of the absolute content of bacteria in the ZYMO standard sample

[0142] 1. Prepare the internal reference sequence 16SV5V7-SPK9 according to the method of Example 2, and synthesize specific primers for amplifying plant endophytic bacteria 16SV5V7: 799F and 1193R primers;

[0143] 2. Take ZYMO standard DNA (ZymoBIOMICS Microbial Community DNA Standard, ZYMO, D6305 (purchased from Weibaiao (Beijing) Biotechnology), which is a standard including 8 kinds of bacteria, namely Bacillus subtilis, Listeria monocytogenes, Staphylococcus aureus, Enterococcus faecalis, Lactobacillus fermentum, Salmonella enterica, Escherichia coli and Pseudomonas aeruginosa), and standardize the ZYMO standard DNA to 5 ng / μL, and its bacterial copy number is 7.05E+06Copies / μL, recorded as ZYMO-6;

[0144] 3. ZYMO-6 was diluted 10 times in a gradient manner and recorded as ZYMO-5. 1 μL ZYMO-5 was taken and added with 1 μL 16SV5V7-SPK5 as a PCR template. Deionized water was used as a negative control for parallel experiments. PCR amplification and library construction were performed according to the method in Example 1, and the library was sequenced on an Illumina platform to obtain PE250 data.

[0145] 4. After removing the adapter and low-quality sequence from the obtained PE250 data and exported Fastq files, the bacterial copy number in the ZYMO standard was absolutely quantitatively calculated using the standard curve calculation method and the single gradient internal reference calculation method;

[0146] Specifically, the bacterial copy number in the ZYMO standard was absolutely quantitatively calculated using the following standard curve calculation method:

[0147] Substitute the total abundance in the sample to be tested into the standard curve in step A1, and calculate the total copy number of 16S in the sample to be tested by the following formula Z1:

[0148] N_total=n_total×(N / N'I) Formula Z1; or

[0149] Substitute the abundance of each bacterial taxonomic unit into the standard curve in step A1, and calculate the absolute copy number information of each bacterial taxonomic unit using the following formula Z2;

[0150] N_x=n_x×(N / N'I) Formula Z2,

[0151] Among them, N_total is the total number of bacterial copies in a unit sample.

[0152] n_total is the total copy number of 16S in the PCR amplification product,

[0153] n_x is the copy number of each bacterial taxonomic unit,

[0154] N is the total amount of DNA extracted from the sample to be tested, in ng.

[0155] N' is the total amount of DNA sample used as template in step 2), in ng.

[0156] I is the total amount of the sample to be tested used to extract DNA.

[0157] Or, use the following single gradient internal reference sequence calculation method to perform absolute quantitative calculation of bacterial copy number in ZYMO standard:

[0158] A2. After the sequencing data is quality filtered, the read abundance values ​​of the at least three internal reference sequences are extracted and recorded as M_SPK. The average theoretical copy number of the highest gradient internal reference sequence is recorded as C_SPK;

[0159] B2. Calculate the total number of 16S copies and the number of copies of each bacterial classification unit in the sample to be tested according to the following formula Z3 and the above formulas Z1 and Z2:

[0160] M_SPK / C_SPK=OTU_total / n_total Formula Z3,

[0161] N_total=n_total×(N / N'I) formula Z1,

[0162] N_x=n_x×(N / N'I) Formula Z2.

[0163] The results are as follows Figure 2-3 As shown in the figure, it can be seen that the absolute copy numbers of the eight bacteria calculated by the two methods are close to the theoretical copy numbers in the ZYMO standard, and the differences between the total theoretical copy numbers of the eight bacteria and those calculated by the standard curve and the single gradient internal reference are 1.4 times and 1.18 times, respectively, both within the normal fluctuation range (plus or minus 2 times), and the accuracy of the two calculation methods is relatively ideal; Figure 3 As shown in the figure, the absolute copy numbers of the eight bacteria calculated by the two methods were highly consistent, and the linear fitting coefficient R2 was equal to 1.

[0164] Example 4. Determination of the absolute copy number of bacteria in real plant samples

[0165] 1. Prepare the internal reference sequence 16SV5V7-SPK9 according to method 1 of Example 2, and synthesize specific primers for amplifying plant endophytic bacteria 16SV5V7: 799F and 1193R primers;

[0166] 2. Perform gradient dilution on 16SV5V7-SPK9 to obtain 16SV5V7-SPK5 for later use;

[0167] 3. Take 18 moss samples, extract DNA, take 900ng of DNA that meets quality control standards, and standardize to 900ng / 30μL;

[0168] 4. Take 1 μL of the standardized DNA, add 1 μL of 16SV5V7-SPK5, and perform PCR amplification according to the PCR system and procedure in Example 2, and perform parallel experiments using deionized water as a negative control;

[0169] 5. After the amplified product was diluted 5 times, 9 μL HiDi (highly deionized-formamide) and 0.1 μL Liz-500 were mixed and STR program detection was performed using ABI 3730 genetic analyzer;

[0170] 6. Use PeakScan software (ABI) to calculate the peak area of ​​the fluorescent internal reference sequence and the peak area of ​​the sample target band, and calculate the data of (internal reference sequence peak area / (internal reference sequence peak area + sample target band peak area)), which is the proportion of the internal reference sequence in the sample. Check that the proportion of the internal reference sequence in the sample is between 15% and 45%;

[0171] 7. For samples whose internal reference sequence ratio is not within the range, estimate the target gene copy number of the sample according to: added internal reference sequence copy number / internal reference sequence peak area = sample target gene copy number / sample target band peak area; based on the estimated target gene copy number, reversely infer the copy number internal reference sequence level that needs to be added when the internal reference sequence ratio is between 15% and 45%, recorded as C;

[0172] 8. Based on the C calculated in step 7, re-dilute 16SV5V7-SPK9 to C, take 1 μL of the diluted C internal reference sequence and add it to 1 μL of the standardized DNA, and re-perform PCR amplification.

[0173] 9. When the proportion of internal reference sequences in all samples is between 15% and 45%, the PCR products of all samples are subjected to index PCR, library construction, and sequencing on the Illumina platform to obtain PE250 data;

[0174] 10. The obtained PE250 data was analyzed, and the exported Fastq file was removed from the adapter and low-quality sequence, and 8 internal reference sequences were extracted. The abundance (OTU) of the 8 internal reference sequences was used as the abscissa, and the absolute copy number was used as the ordinate. After taking the logarithm, the standard curve was fitted, and the absolute copy number of bacteria in each sample was calculated using the standard curve of each sample (specifically the same as in Example 3);

[0175] The results are as follows Figure 4 As shown in the ABI 3730 gene analyzer test results, the fluorescence peak of the internal reference sequence product is separated from the fluorescence peak of the sample 16SV5V7 region amplification product, and the size difference is about 100bp; higher fluorescence peaks can be seen in the longer fragment region, which is the host amplification product of moss plants; the fluorescence peak area of ​​the internal reference sequence and the fluorescence peak area of ​​the sample 16SV5V7 region can be counted to calculate the proportion of the internal reference sequence;

[0176] The standard curve equations and R2 of the 18 samples are shown in Table 9 below;

[0177] Table 9

[0178]

[0179]

[0180] As can be seen from Table 9, the detection method of the present invention can reproduce the gradient between the internal reference sequences in the sequencing data, so that the absolute copy number of endophytic bacteria in the plant sample can be obtained more accurately. Because the internal reference sequence and the sample are sequenced and quantitatively tested in the same reaction system, the quantitative distortion in the detection of plant endophytes in detection methods such as qPCR can be effectively avoided.

[0181] In summary, the method for absolute quantification of endophytic bacteria in plants based on gradient internal references of the present invention adds specific primers for amplifying absolute quantification internal reference sequences for endophytic bacteria in plants that contain conserved sequences on both wings that match the internal reference sequences, thereby obtaining internal reference sequences for absolute quantification of endophytic bacteria in plants with added conserved sequences on both wings, as well as specific primers for amplifying endophytic bacteria 16SV5V7 in plants, and mixing this series of internal reference sequences in a certain gradient ratio, and amplifying and constructing a library together with the total DNA of plant tissue samples, so as to calculate the absolute copy number of bacterial 16S in the sample to be tested through a standard curve or a single gradient internal reference.

[0182] For samples with high endophyte content, compared with adding 1-2 independent internal reference samples, the standard curve can cover a larger copy number range and provide more accurate detection; in addition, the gradient of the standard curve itself can be used to measure the stability and reliability of the experiment to avoid distortion of results due to experimental deviations. At the same time, taking into account samples with low endophyte content, when standard curve fitting is not possible, a single gradient internal reference absolute copy number calculation solution is provided, making the detection experiment more compatible with various samples and obtaining more accurate absolute copy number results. This eliminates the situation of quantitative distortion in plant endophyte detection.

[0183] In addition, for samples with relatively high content of plant endophytes, the gradient internal reference related data was used to prepare the standard curve, and the standard curve was applied for absolute quantitative calculation; for samples with low content of plant endophytes, only a single gradient internal reference calculation method was used for absolute quantification (the ratio of the single highest gradient internal reference sequencing reads to the known theoretical copy number), and the reads of each bacterial community in the sample were converted to absolute copy number; and experiments showed that the copy number results of the two methods were consistent with those of the standard, and the detection accuracy was very high, which further expanded the scope of application of this detection method.

[0184] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

[0185] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A specific primer for amplifying an absolute quantitative internal reference sequence for plant endophytes and bacteria, comprising a first upstream primer and a first downstream primer respectively matching the conserved sequences on both sides of the internal reference sequence, wherein the conserved sequences on both sides are the nucleotide sequence shown in SEQ ID NO: 1: AAC(A / C)GGATTAGATACCC(G / T)G, and the nucleotide sequence shown in SEQ ID NO: 2: GGAAGGTGGGGATGACGT; The sequence of the first upstream primer is the nucleotide sequence shown in SEQ ID NO: 3: AAC(A / C)GGATTAGATACCC(G / T)GGTGCCAGC(A / C)GCCGCGTAA; The sequence of the first downstream primer is the nucleotide sequence shown in SEQ ID NO:4: ACGTCATCCCCACCTTCCTCTAATCCTGTTTGCTCCCC.

2. An internal reference standard for amplifying absolute quantification of plant endophytic bacteria, which is selected from at least three of the following internal reference sequences, wherein the internal reference sequences are amplified by the specific primers according to claim 1: 1) a first internal reference sequence R1, the nucleotide sequence of which is shown in SEQ ID NO: 5; 2) a second internal reference sequence R2, the nucleotide sequence of which is shown in SEQ ID NO: 6; 3) a third internal reference sequence R3, the nucleotide sequence of which is shown in SEQ ID NO: 7; 4) a fourth internal reference sequence R4, the nucleotide sequence of which is shown in SEQ ID NO: 8; 5) a fifth internal reference sequence R5, the nucleotide sequence of which is shown in SEQ ID NO: 9; 6) a sixth internal reference sequence R6, the nucleotide sequence of which is shown in SEQ ID NO: 10; 7) a seventh internal reference sequence R7, the nucleotide sequence of which is shown in SEQ ID NO: 11; 8) an eighth internal reference sequence R8, the nucleotide sequence of which is shown in SEQ ID NO:

12.

3. A kit for absolute quantification of plant endophytic bacteria, comprising at least three internal reference sequences selected from the internal reference standard of claim 2, and specific primers for amplifying plant endophytic bacteria 16SV5V7.

4. The kit for absolute quantification of endophytic bacteria in plants according to claim 3, characterized in that: The specific primers for amplifying the plant endophyte bacteria 16SV5V7 include a second upstream primer and a second downstream primer, wherein the sequence of the second upstream primer is as shown in SEQ ID NO: 13: AAC(A / C)GGATTAGATACCC(G / T)G; the sequence of the second upstream primer is as shown in SEQ ID NO: 14: ACGTCATCCCCACCTTCC; Preferably, the 5' end of the specific primer for amplifying the plant endophytic bacteria 16SV5V7 is provided with a fluorescent base modification, and the fluorescent base modification is preferably a FAM or ROX modification.

5. The internal reference kit for absolute quantification of endophytic bacteria in plants according to claim 4, characterized in that: The internal reference sequences in the kit were mixed in 10-fold gradients, with two internal reference sequences repeated in each gradient, for a total of 4 gradients; Preferably, the standard contains the following components in molar parts: R1: 1000 parts, R2: 1000 parts, R3: 100 parts, R4: 100 parts, R5: 10 parts, R6: 10 parts, R7: 1 part, R8: 1 part.

6. The internal reference kit for absolute quantification of endophytic bacteria in plants according to any one of claims 3 to 5, characterized in that: The internal reference sequence is a random sequence, the GC content of the internal reference sequence is 35% to 55%, and the length is between 300 and 350 bp.

7. Use of the specific primers for amplifying the internal reference sequence for absolute quantification of plant endophytes according to claim 1, or the internal reference standard for amplifying the absolute quantification of plant endophytes according to claim 2, or the internal reference kit according to any one of claims 3 to 6 in absolute quantification detection of plant endophytes.

8. A method for absolute quantification of endophytic bacteria in plants, comprising the following steps: 1) taking a sample to be tested, extracting its total DNA, and obtaining a total DNA sample; 2) adding an appropriate amount of a mixture of at least three internal reference sequences in the internal reference standard of claim 2 and the specific primers for amplifying plant endophytic bacteria 16SV5V7 of claim 4 to the total DNA sample to obtain a PCR reaction sample, and then subjecting the PCR reaction sample to a PCR amplification reaction to obtain a PCR amplification product, wherein the at least three internal reference sequences account for 15-45% in the PCR reaction sample; 3) Then the PCR amplification product is used as a template to amplify the sequencing library to obtain a sequencing library PCR product; 4) Analyze the PCR products of the sequencing library, remove the adapter and low-quality sequences according to the analysis results, and then calculate the bacterial content in the sample to be tested according to the standard curve calculation method or the single gradient internal reference calculation method.

9. The method for absolute quantification of endophytic bacteria in plants according to claim 8, characterized in that: In step 2), the proportions of at least three internal reference sequences in the PCR reaction sample are adjusted by a method comprising the following steps: The amplified product is analyzed, and the peak area of ​​the internal reference sequence and the 16S amplification target peak area in the sample to be tested are calculated to obtain the internal reference sequence ratio, and the amount of the internal reference sequence mixed solution is adjusted according to the internal reference ratio, so that the internal reference sequence ratio is 15-45%.

10. The method for absolute quantification of endophytic bacteria in plants according to claim 8, characterized in that: In step 4), the bacterial content in the sample to be tested is calculated according to a standard curve calculation method comprising the following steps: A1. After the sequencing data is quality filtered, the read abundance values ​​of the internal reference sequence are obtained, with the abundance value of the internal reference sequence as the horizontal axis and the absolute copy number as the vertical axis. The logarithms are taken to draw the standard curve; B1. The remaining sequencing data is then used to analyze the microbial community structure, and the number of reads annotated to each bacterial taxonomic unit is then calculated; C1. Then, the total abundance in the sample to be tested is brought into the standard curve and substituted into the standard curve in step A1 to calculate the total 16S copy number in the sample to be tested; or Substitute the abundance of each bacterial taxonomic unit into the standard curve in step A1 to calculate and obtain the absolute copy number information of each bacterial taxonomic unit, thereby obtaining the copy number of each bacterial taxonomic unit in the sample to be tested.

11. The method for absolute quantification of endophytic bacteria in plants according to claim 10, characterized in that: In step C1, the total copy number of 16S in the sample to be tested is calculated by the following formula Z1: N_total=n_total×(N / N'I) Formula Z1; or The step C1 calculates the content of each bacterial taxon in the sample to be tested by the following formula Z2: N_x=n_x×(N / N'I) Formula Z2, Among them, N_total is the total number of bacterial copies in a unit sample. n_total is the total copy number of 16S in the PCR amplification product, n_x is the copy number of each bacterial taxonomic unit, N is the total amount of DNA extracted from the sample to be tested, in ng. N' is the total amount of DNA sample used as template in step 2), in ng. I is the total amount of the sample to be tested used to extract DNA.

12. The method for absolute quantification of endophytic bacteria in plants according to claim 11, characterized in that: In step 4), the bacterial content in the sample to be tested is calculated according to a single gradient internal reference calculation method comprising the following steps: A2. After the sequencing data is quality filtered, the read abundance values ​​of the at least three internal reference sequences are extracted and recorded as M_SPK, and the average theoretical copy number of the highest gradient internal reference sequence is recorded as C_SPK; B2. Then, according to the following formula Z3 and the formulas Z1 and Z2 in claim 10, the total copy number of 16S in the sample to be tested and the copy number of each bacterial classification unit are calculated: M_SPK / C_SPK=OTU_total / n_total Formula Z3, N_total=n_total×(N / N'I) formula Z1, N_x=n_x×(N / N'I) Formula Z2.

Images