KASP marker for detecting wheat grain hardness gene Pinb-D1d

Abstract

The invention belongs to the technical field of wheat molecular breeding, and particularly relates to a KASP molecular marker for detecting a wheat grain hardness gene Pinb-D1d and application of the KASP molecular marker. The KASP marker is a group of primers for PCR (Polymerase Chain Reaction) amplification. In the application, aiming at a specific Pinb-D1d genotype (the research in the application considers that the hardness index of wheat containing the genotype can reach the mixed wheat level: 40lt, the hardness index lt, 60), the wheat grain hardness containing the genotype is measured and statistically analyzed, and a corresponding KASP marker is developed aiming at the 217 SNP sites of the genotype. Based on related achievements, a certain technical foundation can be laid for subsequent screening of germplasm resources of wheat grains with different hardness and further wheat molecule assisted breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat molecular breeding, and particularly relates to a KASP molecular marker for detecting a wheat grain hardness gene Pinb-D1d and an application thereof. Background Art

[0002] wheat( Triticum aestivum L., 2n=6x=42, AABBDD) As one of the most important food crops in the world, it has a wide planting range and strong adaptability, providing humans with important nutrients such as protein, dietary fiber and carbohydrates. In the process of wheat processing or quality evaluation, wheat grain hardness is an important technical indicator. Grain hardness refers to the force required to destroy the structure of wheat grains, which directly reflects the physical hardness characteristics of the grains. Therefore, wheat grain hardness is a key trait that determines the quality of wheat flour, and has a significant impact on the efficiency of wheat processing and the quality of the final product.

[0003] In the industrial field of wheat processing and trade, wheat is usually divided into two categories: hard wheat and soft wheat, based on the difference in grain hardness. Among them, the flour obtained after soft wheat milling has smaller particle size and lower damaged starch content, higher protein content, and relatively weak water absorption capacity, which is more suitable for making soft foods such as biscuits and cakes. Compared with soft wheat, hard wheat flour has larger particle size, higher damaged starch content, and lower protein content. These properties give hard wheat flour a stronger water absorption capacity, and it is mainly used to produce high-gluten flour and make bread, pasta and other pasta products with a tighter structure.

[0004] In order to understand the difference in quality between hard wheat and soft wheat, researchers isolated the Friabilin protein from the washed starch of soft wheat. The protein is present in large quantities in soft wheat but is very rare or absent in hard wheat. Analysis shows that the molecular weight of Friabilin protein is about 15kD. The Friabilin protein complex is mainly composed of Puroindoline a (Pina) and Puroindoline b (Pinb) proteins, which are encoded by Pina-D1 and Pinb-D1 genes, respectively. Together, they form the molecular genetic basis of wheat grain hardness.

[0005] In summary, given that wheat grain hardness has a very important impact on wheat quality and processing uses, strengthening in-depth research on wheat hardness regulatory genes has very important technical significance for breeding new wheat varieties or determining the optimal processing uses of different wheat varieties. Summary of the invention

[0006] The purpose of this application is to provide a KASP molecular marker for detecting the wheat grain hardness gene Pinb-D1d, thereby laying a certain technical foundation for the subsequent breeding of new wheat varieties with different hardness.

[0007] The specific technical solutions adopted in this application are as follows.

[0008] The wheat grain hardness gene Pinb-D1d is detected using a KASP marker, which is a set of primers for PCR amplification; the specific primer set is designed as follows: Pinb-D1d-F1: 5'-AGTCACCTGGCCCACAAAATGGA-3', Pinb-D1d-F2: 5'-AGTCACCTGGCCCACAAAATGGT-3', Pinb-D1d-R: 5'-ACTCGCCGGATAGAATCACAGCG-3'; In specific applications, a FAM fluorescent label sequence can be added before the F1 sequence: 5'-GAAGGTGACCAAGTTCATGCT-3', A HEX fluorescent tag sequence can be added before the F2 sequence: 5'-GAAGGTCGGAGTCAACGGATT-3'; The KASP marker is designed for the SNP site +217 of the Pinb-D1d gene; The Pinb-D1d gene, the base sequence is shown in SEQ ID No.1; The polymorphism of the SNP site at +217 of the Pinb-D1 gene is A or T; When the +217 position of the Pinb-D1 gene is A, the wheat grain hardness is higher; When the +217 position of the Pinb-D1 gene is T, the wheat grain hardness is lower.

[0009] The KASP marker is used in wheat grain hardness detection and determination, and is used for screening and distinguishing wheat germplasm resources with different hardness or for wheat molecular assisted breeding.

[0010] The method for detecting wheat grain hardness using the KASP marker comprises the following steps: 1. Extracting genome Wheat grains or leaves were used as samples to extract genomic DNA; When extracting genomic DNA, you can refer to the CTAB method for extraction, using wheat leaves as samples. The specific operation process is as follows: Place wheat leaf tissue and steel balls in a centrifuge tube, freeze in liquid nitrogen for 3 minutes, and then shake (to crush the leaf tissue); After the shaking treatment, CTAB buffer was added and treated in a 65°C water bath; After the water bath, add chloroform, mix thoroughly, and centrifuge; After centrifugation, the supernatant was aspirated, the DNA was precipitated with isopropanol, and after washing and dissolving the DNA, a sample was taken and the concentration of the prepared DNA was measured using a spectrophotometer to ensure that it met the requirements of subsequent PCR amplification; 2. PCR amplification Performing PCR amplification using the KASP marker; The amplification system reference is: 1 μl of DNA template extracted and prepared in step (i); KASP Master Mix (2×), 2.5μl; KASP Primer Mix, 0.7 μl; MgCl2, 0.04 μl; ddH2O, 0.76 μl; The KASP Primer Mix mixed solution, by volume ratio, Pinb-D1d-F1: Pinb-D1d-F2: Pinb-D1d-R: ddH2O=12:12:30:46; The PCR amplification program reference is: Step 1: 94°C for 15 minutes, cycle once; Step 2: 94℃ for 30 seconds, 65-57℃ for 60 seconds, 10 cycles, 0.8℃ lower each cycle; Step 3: 94°C for 30 seconds, 57°C for 60 seconds, and cycle 30 times; Step 4: Keep at 16℃ for 60 seconds, cycle once; (III) Detection and judgment Conduct electrophoresis detection and analysis on the PCR amplification product of step (ii); Based on the fluorescence detection results, the SNP site +217 of the Pinb-D1 gene of the tested sample was genotyped; When the +217 position of the Pinb-D1 gene is A, the wheat grain hardness is higher; When the +217 position of the Pinb-D1 gene is T, the wheat grain hardness is lower.

[0011] Studies have shown that the Pina-D1 and Pinb-D1 genes related to wheat grain hardness are both located on the short arm of chromosome 5D and are tightly linked. Their coding regions are both 447 bases, and the encoded amino acid sequences have a similarity of 60%, and neither has introns. In addition, wheat grain softness is dominant over hardness, that is, when both Pina-D1 and Pinb-D1 are wild-type, the grain is soft, and when one of them is missing or mutated, the grain is hard.

[0012] However, further in-depth studies in recent years have shown that there are more than 26 types of Pina-D1 genotypes, such as Pina-D1y and Pina-D1z, and more than 30 types of Pinb-D1 genes. Therefore, it means that different genotypes have a certain influence on the regulation of wheat grain hardness.

[0013] In this application, for a specific Pinb-D1d genotype (this application study believes that the hardness index of wheat containing this genotype can reach the level of mixed wheat: 40<hardness index<60), the hardness of wheat grains containing this genotype was measured and statistically analyzed, and the corresponding KASP markers were developed for 217 SNP sites of this genotype. Based on the relevant results, a certain technical foundation can be laid for the subsequent screening of wheat grain germplasm resources with different hardness and further molecular-assisted breeding of wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the electrophoresis result of PCR amplification product. It can be seen that a clear band appears at 680 bp; Figure 2 The comparison results of sequence differences show that a single base mutation occurred at position +217; Figure 3 The test results of different wheat materials; in the figure: the orange point indicates that only the FAM signal is detected, which is the AA genotype, and the wheat grain has a high grain hardness index; the blue point indicates that only the HEX signal is detected, which is the TT genotype, and the wheat grain has a low grain hardness index; the black point represents NTC (control). DETAILED DESCRIPTION

[0015] The present application is further explained below in conjunction with the embodiments. Before introducing the specific embodiments, some experimental backgrounds in the following embodiments are briefly introduced as follows.

[0016] Biomaterials: The relevant wheat germplasm materials involved in the following embodiments are all existing materials and can be obtained from public market channels or relevant germplasm resource banks; because the applicant and the inventor belong to professional scientific research institutions and scientific researchers, the applicant has also built a public germplasm resource bank, and therefore has collected and preserved relevant germplasm materials for a long time; The relevant primer synthesis and sequencing work in the following examples were provided by Sangon Biotechnology Co., Ltd.

[0017] Example 1 In view of the fact that wheat grain hardness plays a very important role in wheat quality and use, and in view of the fact that the Pinb-D1 gene plays an important and decisive role in the regulation of wheat grains, in order to further accurately analyze the genotype and gene influence site of the Pinb-D1 gene affecting wheat grain hardness, the inventors used materials with obvious differences in grain hardness index as controls, and conducted further research and analysis. The relevant experimental process is briefly described as follows.

[0018] 1. Experimental Materials Two wheat materials with high kernel hardness index (high hardness): French wheat (average sample hardness index = 66.1) and French B08 (average sample hardness index = 68.3); Three wheat materials with low grain hardness index (low hardness): Yangmai 13 (average sample hardness index = 12), Zhongmai 175 (average sample hardness index = 12.9), and Zhengmai 113 (average sample hardness index = 14.4); It should be explained that the specific wheat grain hardness measurement method can refer to the following operation: The harvested mature wheat grains were naturally dried, and 300 whole seeds without half grains or worm holes were selected and poured into a single-grain grain hardness tester SKCS (model Perten SKCS 4100). The instrument was run to measure and obtain the sample hardness data.

[0019] Select the full-grain materials of the above-mentioned wheat varieties respectively, cultivate seedlings (culture conditions: 25°C, 16 hours of light, 8 hours of darkness), and when the seedlings grow to about 10 cm, cut the leaves as samples.

[0020] 2. Extraction of genomic DNA Take the leaves cut in step (I) as samples and use the CTAB method to extract DNA. The specific operation is as follows: Cut about 0.5 g of leaf sample, put it in a centrifuge tube (2 ml), add 2 stainless steel beads (4 mm diameter), freeze it in liquid nitrogen for 3 min, and then quickly put it in an oscillating ball mill for 1 min (frequency 40 Hz per second) to crush the leaf sample; After the shaking treatment is completed, add 600 μl of CTAB buffer preheated to 65°C, mix by inverting, and incubate at 60°C for 30 minutes (invert and mix every 10 minutes or so to ensure the incubation effect); After the incubation, an equal volume of chloroform was added, mixed thoroughly, and centrifuged at 12,000 rpm for 10 min; After centrifugation, carefully aspirate the supernatant, add an equal volume of isopropanol, mix thoroughly by inversion, and place at room temperature (about 25°C) for 30 minutes; After standing, centrifuge at 12,000 rpm for 10 minutes, discard the supernatant, add 500 μl of 75% ethanol, shake and mix, centrifuge at 12,000 rpm for 10 minutes, discard the supernatant, and dry; Finally, add 100 μl of TE buffer to dissolve the DNA and dilute the DNA to 100 ng / ul for later use.

[0021] 3. PCR amplification With reference to the existing wheat genome and combined with the inventor's previous research and analysis, the PinbD1d genotype located at -119bp and +561bp of the Pinb-D1 gene was used as the research object, and the primer sequences for PCR amplification were designed as follows: PinbD1dF: 5'-GTGAGCATTAGCCAAAGCAACACA-3', PinbD1dR: 5'-CGAACACAGATCAATATACAAGGGTG-3'; Using the above primer pairs, PCR amplification was performed using the high-hardness material genome and low-hardness material genome DNA extracted in step (ii) as templates. The 20 μl amplification system is as follows: 2×Phanta Flash Master Mix, 10ul; PinbD1dF primer, 0.6ul; PinbD1dR primer, 0.6ul; DNA template, 2 μl; Water, 6.8 μl; The PCR amplification program is as follows: 98°C, 30s; 98°C, 10s, 60°C, 5s, 72°C, 5s, 35 cycles; 72°C, 1min; electrophoresis analysis of PCR amplification products (electrophoresis results are shown in Figure 1 As shown, it can be seen that the target fragment sequence length is 680bp, which is consistent with expectations).

[0022] 4. Sequencing comparison Referring to the existing conventional operation, the amplified product obtained in step (iii) was purified, connected with the BLUNT3 vector, and transformed into Escherichia coli. The positive colonies with correct transformation were identified and selected for sequencing analysis to obtain the specific gene sequence of Pinb-D1.

[0023] The final results showed that the Pinb-D1 gene sequences of high-hardness wheat materials (French wheat and French B08) and low-hardness wheat materials (Yangmai 13, Zhongmai 175 and Zhengmai 113) all had an A / T single base sequence SNP variation site at the +217bp position (sequence alignment results are shown in Figure 2 As shown, the +217bp site of the high-hardness material is an A base, and the +217bp site of the low-hardness material is a T).

[0024] The base sequence of the Pinb-D1d gene is shown in SEQ ID No. 1, and is as follows (450 bp): ATGAAGACCTTATTCCTCCTAGCTCTCCTTGCTCTTGTAGCGAGCACAACCTTCGCGCAATACTCAGAAGTTGGCGGCTGGTACAATGAAGTTGGCGGAGGAGGTGGTTCTCAACAATGTCCGCAGGAGCGCCGAAGCTAGCTCTTGCAAGGATTACGTGATGGAGCGATGTTTCACAATGAAGGATTTTCCAGTCACCTGGCCCACAAAATGGAGGAAGGGC GGCTGTGAGCATGAGGTTCGGGAGGTGCTGCAAGCAGCTGAGCCAGATAGCACCACAATGTCGCTGTGATTCTATCCGGCGAGTGATCCAAGGCAGGCTCGGTGGCTTCTTGGGCATTTGGCGAGGTGAGGTATTCAAACAACTTCAGAGGGCCCAGAGCCTCCCCTCAAAGTGCAACATGGGCGCCGACTGCAAGTTCCCTAGTGGCTATTACTGGTGATGA.

[0025] Example 2 On the basis of the results of Example 1, the inventors designed a set of primers for PCR amplification based on the principle of KASP technology and took into account the need for subsequent identification and differentiation. They also identified and differentiated wheat materials with different hardness indexes to further examine the accuracy of the relevant primer design and application. The relevant experimental results are briefly described as follows.

[0026] 1. KASP molecular marker design Based on the polymorphic SNP variation at the +217bp site of the Pinb-D1 gene sequence determined by sequencing comparative analysis in Example 1, a set of primers for PCR amplification was designed. The specific primer sequences were designed as follows: Pinb-D1d-F1::5'-AGTCACCTGGCCCACAAAATGGA-3', Pinb-D1d-F2: 5'-AGTCACCTGGCCCACAAAATGGT-3', Pinb-D1d-R: 5'-ACTCGCCGGATAGAATCACAGCG-3'; In addition, considering the need for fluorescence identification after subsequent PCR amplification, a FAM fluorescent label sequence was added before the F1 sequence: 5'-GAAGGTGACCAAGTTCATGCT-3', A HEX fluorescent tag sequence was added before the F2 sequence: 5'-GAAGGTCGGAGTCAACGGATT-3'.

[0027] 2. PCR amplification Referring to the operation of Example 1, different wheat germplasm materials were used as samples, and their genomic DNA was extracted and adjusted to 100 ng / ul, and used as a template for PCR amplification; PCR amplification was performed using the primer set designed in step (I) above. The 5 μl amplification system was designed as follows: KASP Master Mix (2×), 2.5μl; KASP Primer Mix, 0.7 μl; MgCl2, 0.04 μl; DNA template, 1 μl; ddH2O, 0.76 μl; The KASP Primer Mix (mixed solution), in each 100 μl of the mixed solution, the volume ratio is Pinb-D1d-F1: Pinb-D1d-F2: Pinb-D1d-R: ddH2O=12:12:30:46; The PCR amplification program was set up as follows: Step 1: 94°C, 15 minutes, one cycle; Step 2: 94℃, 30 seconds, 65-57℃ for 60 seconds, 10 cycles, 0.8℃ lower each cycle; Step 3: 94°C, 30 seconds, 57°C, 60 seconds, 30 cycles; Step 4: 16°C, 60 seconds, cycle once.

[0028] (III) Result determination After the PCR amplification in step (ii) is completed, the fluorescence data is read, analyzed and the results are exported; when the results are analyzed (the results are as follows Figure 3As shown in the figure): the materials carrying the label FAM are clustered near the X-axis of the coordinate system, and the corresponding SNP site is A; the materials carrying the label HXE are clustered near the Y-axis of the coordinate system, and the corresponding SNP site is T.

[0029] Combining the hardness index test results of different wheat materials and the corresponding SNP site results, they are summarized in Table 1 below.

[0030] Table 1. Corresponding results of different wheat seed material genotypes and average hardness index From the data analysis of the 58 wheat materials in the above table, it can be seen that the hardness index of the "AA genotype" wheat germplasm material corresponding to the SNP site A is between 45.1 and 68.3 (the average hardness index of the three materials is 59.7), while the hardness index of the "TT genotype" wheat germplasm material corresponding to the SNP site T is only between 12.0 and 30.4.

[0031] That is, the "AA genotype" wheat germplasm with A at the +217bp site of the Pinb-D1 gene sequence belongs to the high hardness wheat germplasm material, and the "TT genotype" wheat germplasm with T at the +217bp site of the Pinb-D1 gene sequence belongs to the low hardness wheat germplasm material.

Claims

1. KASP marker for detecting wheat grain hardness gene Pinb-D1d, characterized in that: The KASP marker is a set of primers for PCR amplification; the specific primer set is designed as follows: Pinb-D1d-F1: 5'-AGTCACCTGGCCCACAAAATGGA-3', Pinb-D1d-F2: 5'-AGTCACCTGGCCCACAAAATGGT-3', Pinb-D1d-R: 5'-ACTCGCCGGATAGAATCACAGCG-3'; The KASP marker is designed for the SNP site +217 of the Pinb-D1d gene; The Pinb-D1d gene has a base sequence as shown in SEQ ID No.

1.

2. The KASP marker of claim 1 is used in wheat grain hardness detection and determination, characterized in that: Used to screen and distinguish wheat germplasm resources with different hardness or for wheat molecular assisted breeding.

3. The method for detecting wheat grain hardness using the KASP marker of claim 1, characterized in that: The steps include:

1. Extracting genome Wheat grains or leaves were used as samples to extract genomic DNA; 2. PCR amplification Performing PCR amplification using the KASP marker; (III) Detection and judgment Perform electrophoresis analysis and determination on the PCR amplification product of step (ii), and determine: When the +217 position of the Pinb-D1 gene is A, the wheat grain hardness is higher; When the +217 position of the Pinb-D1 gene is T, the wheat grain hardness is lower.

4. Application of wheat Pinb-D1d gene in wheat breeding, characterized in that: The Pinb-D1d gene has a base sequence as shown in SEQ ID No. 1; when used, when the +217 position of the Pinb-D1 gene is A, the wheat grain hardness is higher; When the +217 position of the Pinb-D1 gene is T, the wheat grain hardness is lower.

Images