KASP molecular marker related to early blossoming character of corn and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker related to the early blossoming character of corn and application of the KASP molecular marker, and belongs to the field of crop genetic breeding. A gene of a corn germplasm material is analyzed, it is found that the ZCN7 gene is remarkably related to the flowering period of corn, and it is found through further analysis that G / A allelic variation exists in a promoter region Chr6: 170682583 site of the ZCN7 gene, so that the functional KASP molecular marker is developed. According to the invention, the KASP molecular marker is utilized to assist in distinguishing early-flowering and late-flowering maize varieties, two super-early-flowering combinations, 14 middle-early-flowering combinations and one late-flowering combination are bred by utilizing the molecular marker, and part of germplasm resources pass verification or participate in various tests. The invention provides a new molecular marker and a scientific basis for character improvement in the flowering period of corn.

Description

Technical Field

[0001] The invention relates to the field of crop genetic breeding, and in particular to a KASP molecular marker related to early flowering traits of corn and an application thereof. Background Art

[0002] Corn is the largest grain crop in my country. In the Huanghuaihai region, grain production adopts a unique wheat-corn rotation and two-crop farming system, which greatly limits the production time of corn and wheat. For corn, the current growth time of corn in the Huanghuaihai region is generally about 105 days, of which vegetative growth accounts for half of the time. Although the time from flowering to maturity of corn is short, it is very important for yield formation. The primary factor for insufficient growth period to reduce yield is shortening the filling time of corn and reducing grain weight. Most of the photosynthetic products of leaves during the growth period are transported to the grains to form yield. During the filling period, not only is the amount of dry matter produced large, but it is also mainly used for grain formation, which is directly related to the level of economic coefficient. Relevant statistics show that 80% to 90% of corn grain yield comes from photosynthetic products during the filling period, and only 10% to 20% is stored in organs such as stems and leaf sheaths before flowering, and then transported to the grains during the filling period. Therefore, extending the growth period of corn, increasing the filling period, and the greater the filling intensity, the higher the corn yield. Therefore, breeding new corn varieties that bloom early and have a long growing period is of great significance for increasing corn grain yield and ensuring national food security.

[0003] After a long period of evolutionary selection, corn has evolved from teosinte to the modern corn development form, producing two inflorescences with completely different forms and functions: male inflorescence and female inflorescence. As a monocot plant with hermaphrodites, the apical inflorescence meristem produces male inflorescence. During the growth of corn, the appearance of spike inflorescence at the top of the corn marks the beginning of flowering, that is, the beginning of reproductive growth.

[0004] Flowering traits of plants are important environmental adaptability-related traits, which are regulated by internal factors such as growth period and environmental factors such as temperature and photoperiod. Arabidopsis FT (Flower Locus T) and TFL1 (Terminal Flower1) are key genes controlling flowering period. Both encode phosphatidylethanolamine binding proteins, but there is an amino acid difference in their protein sequences that leads to opposite functions, that is, FT promotes flowering and TFL1 inhibits flowering. There are 25 homologous genes of FT and TFL1 in maize, named ZCN genes (Zea CENTRORADIALIS). Among them, overexpression of four genes, ZCN1, ZCN2, ZCN4 and ZCN7, will lead to late flowering; ZCN9, ZCN10 and ZCN15 are mainly expressed in grains; ZCN3 and ZCN6 affect the morphology of male spikes; overexpression of ZCN8 and ZCN8 will lead to early flowering. Studies have found that a SNP variant site in the promoter region of the maize ZCN8 gene is significantly associated with the flowering period of maize, but there is no relevant report on the association between ZCN7 and maize flowering. Summary of the invention

[0005] The purpose of the present invention is to provide a KASP molecular marker related to the early flowering trait of corn and its application to solve the problems existing in the above-mentioned prior art. The KASP molecular marker can be used to assist in screening early flowering corn varieties and provide a scientific basis for corn improvement and breeding of new varieties.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The invention provides a KASP molecular marker related to the early flowering trait of corn. The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO: 1, and a G / A mutation exists at the 46th position of the molecular marker.

[0008] The above-mentioned KASP molecular marker is the presence of a G / A mutation at the Chr6:170682583 site of the ZCN7 gene, and the reference genome accession number of the Chr6:170682583 site is Zm00001eb293080.

[0009] Optionally, the genotype of the mutation site of the molecular marker is AA, AG and GG.

[0010] The present invention also provides a primer set for amplifying the KASP molecular marker, and the nucleotide sequence of the primer set is shown in SEQ ID NO: 2-4.

[0011] The present invention also provides a kit for identifying the early flowering trait of corn, comprising a primer set for amplifying the KASP molecular marker, wherein the nucleotide sequence of the primer set is shown in SEQ ID NO: 2-4.

[0012] The present invention also provides an application of the KASP molecular marker, the primer set or the kit in identifying the early flowering trait of corn.

[0013] The present invention also provides an application of the KASP molecular marker, the primer set or the kit in improving the flowering traits of corn.

[0014] The present invention also provides an application of the KASP molecular marker, the primer set or the kit in cultivating corn with early flowering traits.

[0015] The present invention also provides a method for identifying the early flowering trait of corn, comprising the following steps:

[0016] The genomic DNA of the corn sample to be tested is used as a template, the primer set shown in SEQ ID NO: 2-4 is used to amplify the KASP molecular marker, and the corn early flowering trait is determined according to the genotype of the KASP molecular marker mutation site.

[0017] Optionally, when the genotype of the KASP molecular marker mutation site is AA and AG, it indicates that the corn sample to be tested is corn with early flowering trait. When the genotype of the KASP molecular marker mutation site is GG, it indicates that the corn sample to be tested is corn with late flowering trait.

[0018] The present invention discloses the following technical effects:

[0019] The invention analyzes the coding region and promoter region of the ZCN7 gene of the maize inbred lines independently bred by the Shandong Academy of Agricultural Sciences and some backbone inbred lines, identifies the G / A allele variation at the Chr6:170682583 position of the promoter region (i.e., the G / A allele variation exists at the 46th position of the sequence shown in SEQ ID NO: 1), and develops a functional KASP molecular marker based on this.

[0020] The present invention uses the developed KASP molecular marker to screen and identify corn germplasm materials. The results show that when the molecular marker polymorphic site is AA genotype, it is a super early flowering corn variety, AG genotype is an early flowering corn variety, and GG genotype is a late flowering variety. The present invention uses KASP molecular markers to screen out different early and late flowering germplasm resources, and selects and breeds multiple excellent combinations of different growth periods such as Ludan 510 and Ludan 509. Through approval or participation in various tests, new molecular markers and breeding directions are provided for the development of new corn varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 Results of sequencing analysis (reverse complementary sequence) of key sites for flowering regulation;

[0023] Figure 2 To distinguish corn materials with different flowering periods using KASPEF molecular markers; early flowering materials are marked in red, late flowering materials are marked in blue, intermediate materials are marked in green, and negative controls are marked in black;

[0024] Figure 3 The expression results of ZCN7 gene in different developmental stages of the breeding variety Ludan 510 and the control variety Zhengdan 958;

[0025] Figure 4 Paraffin section analysis of male spikes of Ludan 510 and Zhengdan 958; A: Ludan 510, B: Zhengdan 958, A and B are V5 and V6 stages from left to right;

[0026] Figure 5 The flowering period of Ludan 510 and Zhengdan 958 was compared in the field; the yellow-green ones are the selected early-flowering materials (already bloomed, showing a yellowish tint), and the dark green ones are the selected late-flowering materials. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0029] Example 1

[0030] (1) Through the investigation of the flowering period of more than 600 breeding materials preserved by Shandong Academy of Agricultural Sciences, 10 materials with early flowering and 10 materials with late flowering were selected. The literature was consulted to find known flowering regulating genes (see Table 1), and quantitative PCR primers were designed based on the gene sequences (part of which were obtained by homologous comparison) (see Table 2). By comparing the expression levels of the above genes in early-flowering and late-flowering germplasm materials, it was identified that the expression level of the gene ZCN7 (Zm00001eb293080), which encodes chlorophyll binding protein D1, an important component of the reaction center of maize photosystem II, is closely related to the flowering period.

[0031] Table 1 Related information of the selected early-flowering and late-flowering materials

[0032] Germplasm material number Flowering time type Germplasm material number Flowering time type 23S0230 Early Flower 23S0454 Late Flower 23S0458 Early Flower 23S0457 Late Flower 23S0182 Early Flower 23S0460 Late Flower 23S0183 Early Flower 23S0461 Late Flower 23S0198 Early Flower 23S0466 Late Flower 23S0201 Early Flower 23S0469 Late Flower 23S0220 Early Flower 23S0470 Late Flower 23S0221 Early Flower 23S0471 Late Flower 23S0223 Early Flower 23S0472 Late Flower 23S0227 Early Flower 23S0473 Late Flower

[0033] Table 2 Primer sequences for quantitative PCR detection of flowering genes

[0034]

[0035]

[0036]

[0037] The quantitative PCR detection system is shown in Table 3 below:

[0038] Table 3 qPCR reaction system (20 μL)

[0039]

[0040] The qPCR reaction program (45 cycles) is shown in Table 4 below.

[0041] Table 4 qPCR reaction procedure

[0042]

[0043] According to the Ct value of the internal reference gene and the gene to be tested, 2 -ΔΔct The CT value comparison method was used to perform relative quantitative analysis on the genes to be tested.

[0044] (2) The promoter is a key region that determines the level of gene expression. By comparing the promoter region sequences of early-flowering and late-flowering materials, it was found that the G / A allelic variation at position Chr6:170682583 (corn reference genome version V5) in the promoter region of the ZCN7 gene is a key site that determines the differential expression of ZCN7. Analysis of promoter cis-acting elements found that the G / A at position Chr6:170682583 is located within the AE-box element (see Figure 1 ), and the AE-box is related to the light response.

[0045] (3) SNP_Primer_Pipeline2 was used to build the KASP molecular marker development platform on the unit server, and the functional molecular marker KASPEF was developed using this tool. The sequences of its FAM, HEX and R primers are as follows:

[0046] KASPEF-F (SEQ ID NO.2): 5'-GAAGGTGACCAAGTTCATGCTTTTCAGATCAGACGAAAAGAGAAAC-3';

[0047] KASPEF-H (SEQ ID NO.3): 5'-GAAGGTCGGAGTCAACGGATTTTTCAGATCAGACGAAAAGAGAAAT-3';

[0048] KASPEF-R (SEQ ID NO. 4): 5'-GCATATTAGGTTAAATATCTAAGTAGTGT-3'.

[0049] The reaction system is shown in Table 5 below.

[0050] Table 5 Reaction system

[0051]

[0052]

[0053] The reaction conditions are shown in Table 6 below.

[0054] Table 6 Reaction procedure

[0055]

[0056] The amplified sequence (SEQ ID NO.1) is as follows:

[0057] GAAGGTGACCAAGTTCATGCTTTTCAGATCAGACGAAAAGAGAAA[C / T]AAGACAACACTACTTAGATATTTAACCTAATATGC.

[0058] Note: [C / T] indicates the mutation site.

[0059] (4) Application of flowering marker KASPEF

[0060] Using the KASPEF molecular marker developed above, the materials with different flowering periods were screened and identified in the breeding materials of Shandong Academy of Agricultural Sciences. The DNA of the materials was extracted, and then the molecular marker KASPEF was used for screening and identification. The results are as follows: Figure 2 shown.

[0061] The results showed that 526 materials of early-flowering genotype A and 350 materials of late-flowering genotype were screened and identified. The early-flowering and late-flowering materials were hybridized and matched, and considering the hybrid advantage pattern and yield factors, 2 super-early flowering combinations (flowering in 40-41 days), 14 medium-early flowering combinations (flowering in 42-48 days) and 1 late flowering combination (flowering 57 days after sowing) were created. Some varieties have passed the national or Shandong provincial approval, see Table 7.

[0062] Table 7 Statistics of excellent combination genotypes, flowering period and test results

[0063]

[0064]

[0065] Example 2

[0066] Analysis of phenotypes and flowering gene expression levels of materials with different flowering periods. Taking two materials with different flowering periods, Zhengdan 958 (genotype GG) and Ludan 510 (genotype AA), as examples, summer corn was sown in the Huanghuaihai region to analyze their phenotypes and flowering gene expression levels.

[0067] like Figure 3-Figure 5 As shown, the results showed that Ludan 510 bloomed about 7 days earlier than Zhengdan 958; paraffin section analysis of early female spike differentiation found that Ludan 510 had begun to differentiate male spikes at the five-sixth leaf stage, while Zhengdan 958 only began to differentiate at the sixth-seventh leaf. By comparing the expression level of the flowering-related gene ZCN7 during the male spike formation period, it was found that the expression level of ZCN7 in Ludan 510 was more than 6 times that of Zhengdan 958 during the critical period of male spike formation, V4 and V5, while the expression level of this gene in Zhengdan 958 only increased rapidly in the V6 stage, which was about one leaf age later than Ludan 510 (about 1 week). This gene was highly expressed during the male spike formation process and rapidly downregulated after the male spike formation.

[0068] It can be seen from the results of the above embodiments that the present invention detects all flowering-related genes by comparing corn inbred lines and hybrids with different flowering periods, identifies that ZCN7 has an important function in regulating flowering, and identifies the G / A allelic variation at position Chr6:170682583 in the promoter region of the gene, thereby developing a functional molecular marker; and performs sequence analysis on it to discover the key elements for regulating gene expression, develop functional markers, and use them to screen germplasm, and select and breed 2 super-early flowering combinations, 14 medium-early flowering combinations, and 1 late flowering combination.

[0069] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A KASP molecular marker associated with early flowering traits of maize, characterized in that: The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO: 1, and there is a G / A mutation at the 46th position of the molecular marker.

2. The KASP molecular marker according to claim 1, characterized in that The genotypes of the mutation sites of the molecular markers are AA, AG and GG.

3. A primer set for amplifying the KASP molecular marker according to claim 1 or 2, characterized in that: The nucleotide sequences of the primer sets are shown in SEQ ID NOs: 2-4.

4. A kit for identifying early flowering traits of corn, characterized in that: It comprises a primer set for amplifying the KASP molecular marker according to claim 1, and the nucleotide sequence of the primer set is shown as SEQ ID NO: 2-4.

5. Use of the KASP molecular marker according to any one of claims 1 to 2, the primer set according to claim 3, or the kit according to claim 4 in identifying early flowering traits of corn.

6. Use of the KASP molecular marker according to any one of claims 1 to 2, the primer set according to claim 3, or the kit according to claim 4 in improving flowering traits of maize.

7. Use of the KASP molecular marker according to any one of claims 1 to 2, the primer set according to claim 3, or the kit according to claim 4 in cultivating corn with early flowering traits.

8. A method for identifying early flowering traits of corn, characterized in that: The following steps are involved: The genomic DNA of the corn sample to be tested is used as a template, and the primer set shown in SEQ ID NO: 2-4 is used to amplify the KASP molecular marker according to claim 1 or 2, and the corn early flowering trait is determined according to the genotype of the KASP molecular marker mutation site.

9. The method according to claim 8, characterized in that When the genotype of the KASP molecular marker mutation site is AA and AG, it indicates that the corn sample to be tested is corn with early flowering trait.

Images